Drought-resistant gene osap4 and protein encoded thereby and use thereof

By cloning and editing the drought-resistant gene OsAP4 and its encoded protein, the problem of slowed plant growth and development under drought conditions has been solved, and the effect of improving plant drought resistance has been achieved. This method is applicable to the improvement of drought resistance in a variety of crops.

CN119639765BActive Publication Date: 2026-04-24WUHAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
WUHAN UNIV
Filing Date
2024-12-27
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

In arid environments, the osmotic balance between the inside and outside of plant cells is disrupted, leading to slowed growth and development, decreased quality, reduced yield, and even plant death. Existing technologies are insufficient to effectively enhance the drought resistance of plants.

Method used

By cloning and editing the drought-resistant gene OsAP4 and its encoded protein, and using genetic engineering techniques to overexpress or knock out the OsAP4 gene in plants, expression vectors are constructed and genetic transformation is carried out to improve the drought resistance of plants.

Benefits of technology

It significantly improves the drought resistance of plants, enhances their survival rate and growth capacity under drought conditions, and is applicable to the drought resistance improvement of various crops such as rice, corn, and wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119639765B_ABST
    Figure CN119639765B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and provides a drought-resistant gene OsAP4, a protein coded by the gene and application; after editing the OsAP4 gene in rice, the plant shows drought resistance under the simulated drought stress condition of PEG6000 treatment; after overexpressing the OsAP4 gene in rice, the drought resistance of the plant is reduced, which indicates that the drought resistance of rice can be regulated by changing the function of the gene. The editing of the gene by transferring the editing vector containing the OsAP4 editing site into rice can improve the drought resistance of rice; the OsAP4 gene can also be used as a molecular marker in molecular breeding. The OsAP4 gene has great application prospect in molecular breeding and drought-resistant rice breeding by using genetic engineering means.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to the drought-resistant gene OsAP4 and its encoded protein and applications. Background Technology

[0002] In arid environments, the osmotic balance between the inside and outside of plant cells is disrupted, slowing growth and development, which may lead to decreased quality, reduced yield, or even plant death. Researchers have cloned drought-resistant genes derived from natural rice and discovered drought-resistant genes through genetic engineering techniques, thereby enriching the genetic diversity of drought-resistant genes to address the severe challenges posed by harsh climatic environments in rice production and promote the sustainable development of the rice industry.

[0003] Therefore, how to cope with the impact of drought, especially how to enhance the adaptability of plants to drought, is a key issue that urgently needs to be addressed. Summary of the Invention

[0004] The purpose of this invention is to overcome the deficiencies of the prior art and to provide the drought-resistant gene OsAP4, its encoded protein, and its applications. The OsAP4 gene can be used to improve the drought resistance of plants.

[0005] To achieve the above objectives, the present invention is implemented as follows:

[0006] In a first aspect of the present invention, a drought-resistant gene OsAP4 is provided, wherein the drought-resistant gene OsAP4 is any one of the following genes (1)-(3):

[0007] (1) Its nucleotide sequence is the genome sequence shown in SEQ ID NO.1;

[0008] (2) Its nucleotide sequence is the transcribed sequence shown in SEQ ID NO.2;

[0009] (3) Its nucleotide sequence is the CDS sequence shown in SEQ ID NO.3.

[0010] Furthermore, the drought-resistant gene OsAP4 has a drought-resistant nucleotide sequence with more than 90% homology, resulting from the addition, substitution, insertion, or deletion of one or more nucleotides in the nucleotide sequences shown in SEQ ID NO:1-SEQ ID NO:3. The addition of one or more nucleotides includes the addition of a tag sequence.

[0011] In the above technical solution,

[0012] The nucleotide sequence shown in SEQ ID NO.1 consists of 1986 bases, including the 5'UTR, exon, and 3'UTR.

[0013] The nucleotide sequence shown in SEQ ID NO.2 is a transcribed sequence, with positions 1 to 138 being the 5' UTR and positions 1654 to 1986 being the 3' UTR.

[0014] The nucleotide sequence shown in SEQ ID NO.3 is a CDS-coded sequence.

[0015] In a second aspect of the invention, a protein encoded by the drought-resistant gene OsAP4 is provided, the protein having an amino acid sequence as shown in SEQ ID NO: 4 or a derivative protein having at least 95% homology and drought resistance obtained by modifying the amino acid sequence shown in SEQ ID NO: 4 by one or more amino acid residues.

[0016] Specifically, a tag sequence can be added to the amino acid sequence shown in SEQ ID NO.4.

[0017] To facilitate the study and use of the OsAP4 protein in (1), a tag as shown in Table 1 can be attached to the amino terminus of the protein sequence.

[0018] Table 1. Tags and their amino acid sequences

[0019] Label residues sequence Poly-His 6 HHHHHH FLAG 8 DYKDDDDK c-myc 10 EQKLISEEDL

[0020] The derived protein can be synthesized directly or obtained through transcription and translation of its base sequence. The coding gene for OsAP4 can be obtained by deleting or adding one or more amino acid residues to the codon of the sequence shown in SEQ ID NO.4, and / or by performing a missense mutation of one or more base pairs, and / or by attaching the coding sequence of the tag shown in Table 1 to its 5' end and / or 3' end.

[0021] In a third aspect of the invention, an expression vector is provided for expressing the protein encoded by the drought-resistant gene OsAP4.

[0022] In a fourth aspect of the invention, a method for constructing an expression vector for the drought-resistant gene OsAP4 is provided, the method comprising:

[0023] The drought-resistant gene OsAP4 was cloned into an expression vector to obtain the expression vector of the drought-resistant gene OsAP4.

[0024] In a fifth aspect of the invention, a transformant of the expression vector is provided.

[0025] In some embodiments, the transformant is Agrobacterium tumefaciens and / or plant cells (or organisms); the organism is a transgenic drought-resistant plant, one of the following: tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0026] In a sixth aspect of the invention, the application of the drought-resistant gene OsAP4, the expression vector, the expression vector prepared by the method, or the transformant is provided in improving plant drought resistance.

[0027] The plant is selected from at least one of the following: tomato, rice, corn, wheat, barley, tobacco, soybean, sorghum, cotton, hemp, peanut, rapeseed, sugarcane, or sugar beet.

[0028] Drought-resistant varieties can be improved by reducing the expression level of OsAP4. Specifically, the OsAP4 gene is knocked out in the crop by knocking it out.

[0029] To construct recombinant vectors containing OsAP4, existing crop modification vectors can be selected. These crop modification vectors include binary Agrobacterium vectors and vectors suitable for crop micro-bombardment, such as pCAMBIA3301, pYLCRISPR / Cas9Pubi-B, pYLCRISPR / Cas9P35S-H, pYLCRISPR / Cas9P35S-N, pCAMBIA2301, pH7WG2D, or other editing technology-related vectors, such as TALENs and ZFNs.

[0030] To modify crops using the OsAP4 gene, any promoter that helps alter OsAP4 gene expression can be added before the gene start site during vector construction, such as the cauliflower mosaic virus (CAMV) 35S promoter or the ubiquitin gene promoter (pUbi). Alternatively, enhancers can be added to achieve differential expression. Regardless of the method used, the correct coding sequence must be ensured to obtain the correct OsAP4 protein structure.

[0031] Recombinant vectors can be constructed using vectors containing marker genes such as RUBY, GUS, GFP, hygromycin resistance genes, and herbicide resistance genes. This operation is beneficial for subsequent crop screening.

[0032] The recombinant vector containing OsAP4 can be transformed into crop tissues or cells using common methods such as Agrobacterium-mediated genetic transformation, Ti plasmids, and viral vectors.

[0033] In a seventh aspect of the invention, a method for improving plant drought resistance is provided, wherein the expression vector mediates plant genetic transformation by means of genetic engineering, and the resulting transgenic plant improves plant drought resistance.

[0034] In an eighth aspect of the invention, the application of the drought-resistant gene OsAP4 as a molecular marker in rice breeding is provided.

[0035] The beneficial effects of this invention are:

[0036] This invention modifies the drought resistance of rice by editing the OsAP4 gene, demonstrating that this gene can be used as a drought-resistant gene in rice breeding. Therefore, the OsAP4 gene has the potential for application in marker-assisted breeding and in cultivating drought-resistant rice varieties using genetic engineering methods. Attached Figure Description

[0037] Figure 1 This is a structural diagram of the OsAP4 gene, which contains an aspartic protease (AP) domain;

[0038] Figure 2 The image shows the survival performance of OsAP4OE overexpression materials after drought stress (the left image shows seedlings from different groups, and the right image shows the survival rate statistics).

[0039] Figure 3 This describes the base editing and protein translation of the OsAP4 gene in knockout rice materials.

[0040] Figure 4 This is the survival performance of the OsAP4KO knockout material after drought stress.

[0041] The above Figure 2-4 In the figure, OsAP4: unedited gene, OsAP4OE: overexpressed gene, OsAP4KO: edited gene, "**": significance level reached P < 0.01. Detailed Implementation

[0042] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.

[0043] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.

[0044] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0045] The technical solution of this application embodiment is to solve the above-mentioned technical problems, and the general idea is as follows:

[0046] The applicant discovered the OsAP4 gene through differential expression in rice, and named it the drought-resistant gene OsAP4.

[0047] Next, this invention demonstrated that knocking out OsAP4 in the rice variety 9311 significantly increased the survival rate of seedlings subjected to drought stress simulated by PEG6000; conversely, overexpressing OsAP4 seedlings showed a significant decrease in survival rate after PEG6000-simulated drought stress treatment, indicating a close relationship between OsAP4 and drought tolerance. The functional domains of the OsAP4 protein are highly conserved in other important food crops (maize, wheat, etc.), suggesting that this gene has similar biological functions in regulating drought tolerance in other crops. Therefore, OsAP4 can also regulate the drought tolerance of other monocotyledonous grasses.

[0048] The present invention will now be described in detail with reference to the embodiments.

[0049] Example 1: Obtaining the drought-resistant gene OsAP4

[0050] I. Discovery and Cloning of the Drought-Resistant Gene OsAP4

[0051] 1. The drought-resistant gene OsAP4 of this invention was discovered by the applicant through differential expression of the OsAP4 gene in rice, and the applicant named it drought-resistant gene OsAP4.

[0052] 2. Obtaining the full-length fragment of the OsAP4 gene: Using rice cDNA as a template, primer pair OsAP4-F / R was designed and corresponding recombinant sequences were added to the 5' end of each primer. The primer sequences are shown in Table 2. PCR amplification was performed, and the products were sequenced and analyzed. The amplified nucleotide sequence is shown in SEQ ID NO.3.

[0053] Table 2. Primer Sequences

[0054] Primer name Primer sequence (5'-3') OsAP4-F ATGCAGCCTCACATCCTCCT(SEQ ID NO.5) OsAP4-R TTAGCACTTGTTGGAGGTGA(SEQ ID NO.6)

[0055] Example 2: Construction and genetic transformation of OsAP4 gene overexpression vector

[0056] 1. Construction of OsAP4 gene overexpression vector

[0057] The product amplified with primers OsAP4-F / R was inserted into the expression vector pCAMBIA1301 (commercially available, such as UBO Bio #VT1842) containing a strong promoter via a recombination reaction (specifically, insertion was performed using BamHI single enzyme digestion). Positive clones were screened using the marker gene on the vector to obtain the recombinant expression vector OsAP4OE.

[0058] 2. Obtaining transgenic plants overexpressing the OsAP4 gene

[0059] The constructed OsAP4OE vector can be transferred into Agrobacterium tumefaciens EHA105 by electroporation or heat shock. Positive Agrobacterium strains that can be used to infect rice tissues can be screened using the characteristics of the vector and Agrobacterium itself.

[0060] Recombinant Agrobacterium strain containing the recombinant plasmid OsAP4OE was used to infect 9311 callus tissue, which was then cultured in the dark on selection medium containing 50 mg / L hygromycin to obtain positive transgenic callus. The positive callus was differentiated, rooted, and transplanted to obtain T0 generation plants. T1 generation plants were obtained through routine molecular detection and rice cultivation methods.

[0061] 3. Evaluation of drought tolerance in plants overexpressing the OsAP4 gene

[0062] (1) Detection of OsAP4 gene expression level by RT-qPCR:

[0063] The Ubi promoter, as a strong promoter in plants, can enhance the expression level of target genes in plants. Total RNA was obtained from OsAP4-overexpressing plants and wild-type plants using conventional RNA extraction methods, and the corresponding cDNA was obtained using a reverse transcription kit (purchased from Novizan). The expression level of OsAP4 was detected by RT-qPCR using primer OsAP4-RT-F / R, with the PCR product of primer Actin-RT-F / R used as an internal control. The primer sequences are shown in Table 3.

[0064] Table 3. Primer Sequences

[0065] Primer name Primer sequence (5'-3') OsAP4-RT-F ACGTACTGCCTGGCGTTC(SEQ ID NO.7) OsAP4-RT-R GGACTTGGCCGTGTCGAA(SEQ ID NO.8) Actin-RT-F ACCACTTCGACCGCCACTACT(SEQ ID NO.9) Actin-RT-R ACGCCTAAGCCTGCTGGTT(SEQ ID NO.10)

[0066] (2) Evaluation of drought tolerance of transgenic plants:

[0067] Overexpression materials and wild-type 9311 seeds were soaked and germinated using conventional methods, then transplanted into hydroponic boxes. When the materials reached two weeks of age, the seedlings were treated with PEG6000 (simulating drought stress). After treatment, the seedlings were restored to normal growth conditions, and the survival rate of the seedlings was counted.

[0068] The results are as follows Figure 2 As shown, the survival rate of overexpressing plants was significantly lower than that of wild-type plants, indicating that overexpression of OsAP4 reduced drought resistance.

[0069] Example 3: Identification of drought resistance in plants after OsAP4 gene knockout

[0070] 1. Selection of OsAP4 gene knockout sites

[0071] Knockout sites were designed targeting the coding region of the OsAP4 gene. The gene was then edited using the CRISPR / Cas9 system to alter the structure of OsAP4 and affect its biological function. Primer sequences are shown in Table 4.

[0072] Table 4. Primer Sequences

[0073]

[0074]

[0075] 2. Construction of the OsAP4 gene knockout vector

[0076] The target sequence was amplified into the pYLgRNA vector using overlapping PCR. After enzyme digestion, the expression cassette was ligated into the pYLCRISPR / Cas9 vector using homologous recombination ligation, resulting in a pYLCRISPR / Cas9 vector with the target sequence, which was then used for gene transformation.

[0077] 3. Obtaining OsAP4 gene knockout materials

[0078] The successfully constructed OsAP4 knockout vector was transferred into the EHA105 Agrobacterium tumefaciens strain by electroporation or heat shock. Positive Agrobacterium strains that can be used to infect rice tissues were screened using the characteristics of the vector and Agrobacterium itself.

[0079] 9311 callus tissue was infected with a positive Agrobacterium strain containing a knockout vector and cultured in the dark on selection medium containing 50 mg / L hygromycin to obtain positive transgenic callus. The positive callus was differentiated, rooted, and transplanted to obtain T0 generation plants. T1 generation plants were obtained through routine molecular detection and rice cultivation methods.

[0080] 4. Detection of OsAP4 gene knockout materials

[0081] (1) The editing status of OsAP4 was detected by PCR sequencing:

[0082] Products containing knockout sites in the rice genome were amplified using CRISPR-F / R primers, and sequencing was used to determine the editing status of the knockout sites. Since the knockout sites are located in the functional regions of the gene, the CRISPR / Cas9 system can efficiently alter gene function by editing these sites. Results are as follows... Figure 3As shown, changes of 2 or 1 base in the target sequence led to premature termination of translation of the encoded protein at position 171aa or 315aa, respectively, indicating that the knockout of OsAP4 was successful.

[0083] (2) Evaluation of drought resistance of knockout materials:

[0084] The knockout material and wild-type 9311 seeds were soaked and germinated using conventional methods, then transplanted into hydroponic boxes. When the materials reached two weeks of age, the seedlings were treated with PEG6000 (simulating drought stress). After treatment, the seedlings were restored to normal growth conditions, and the survival rate of the seedlings was calculated. The results are as follows: Figure 4 As shown, the survival rate of the knockout plants was significantly higher than that of the wild type, indicating that knocking out OsAP4 improved drought resistance.

[0085] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0086] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0087] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. Reduce drought resistance gene OsAP4 or the aforementioned drought resistance gene OsAP4 The application of the expression of the encoded protein in improving the drought resistance of rice is characterized by: The drought-resistant gene OsAP4 For any of the following genes (1)-(2): (1) Its nucleotide sequence is the genome sequence shown in SEQ ID NO.1; (2) Its nucleotide sequence is the CDS sequence shown in SEQ ID NO.3.