Sample treatment method before APOE gene detection and application thereof

Abstract

The invention belongs to the field of molecular biology and genetics detection, and particularly relates to a sample treatment method before APOE gene detection and application of the sample treatment method. The invention provides a sample treatment method before APOE gene detection, which comprises the following steps: providing to-be-detected nucleic acid, and performing amplification reaction on a target fragment of the to-be-detected nucleic acid, according to the present invention, the first restriction enzyme and the second restriction enzyme are adopted to perform the first enzyme digestion treatment on the sample after the amplification reaction, and the exonuclease is adopted to perform the second enzyme digestion treatment on the sample after the enzyme digestion treatment, such that the specific double-stranded DNA is degraded into the single-stranded DNA so as to improve the detection specificity; the processing method provided by the invention is further matched with a genotyping detection method, so that the detection sensitivity and specificity can be effectively improved. Furthermore, in combination with a triple helix molecular switch (THMS), signal amplification and fluorescence signal conversion are performed on a target single chain, and rapid and specific genotyping of genotypes is realized through fluorescence signal intensity and ratio.

Description

Technical Field

[0001] The present application belongs to the field of molecular biology and genetic testing, and specifically relates to a sample processing method before APOE gene testing and its application. Background Art

[0002] Single nucleotide polymorphism (SNP) is the most common form of genetic variation in the genome and is widely used in genetic disease risk assessment, drug efficacy prediction, and personalized medicine. The APOE gene is located on human chromosome 19, and its polymorphism is closely related to the occurrence and development of a variety of diseases. Two major polymorphic sites, rs429358 and rs7412, can form three different alleles, namely ε2, ε3, and ε4, and can produce six genotypes, including three homozygous genotypes (ε2 / ε2, ε3 / ε3, ε4 / ε4) and three heterozygous genotypes (ε3 / ε4, ε2 / ε3, ε2 / ε4). Among them, APOE ε4 is considered to be the main risk factor for the onset of sporadic Alzheimer's disease (AD). Therefore, accurate and rapid typing of the polymorphism of the APOE gene is of great significance for the early screening and precise treatment of AD. Current methods for detecting the APOE gene are usually based on amplification strategies, including allele-specific PCR (AS-PCR), PCR-restriction fragment length polymorphism (PCR-RFLP), PCR-single-strand conformation polymorphism (PCR-SSCP), and real-time PCR-based high-resolution melting (HRM).

[0003] Among them, there are APOE genotyping detection methods based on polymerase chain reaction (PCR), such as allele-specific PCR (AS-PCR) and restriction fragment length polymorphism analysis (PCR-RFLP). These methods use specific primer design or enzyme cutting site differences to specifically identify and detect target SNP sites (such as rs429358 and rs7412), while the AS-PCR method can effectively distinguish different genotypes by amplifying the target SNP by designing specific primers; the PCR-RFLP method uses restriction endonucleases to digest the amplified products and performs genotyping by detecting differences in product fragment length. In recent years, high-resolution melting curve analysis (HRM) and real-time fluorescence PCR methods have also been applied to APOE genotyping detection.

[0004] The traditional technology methods currently have the following problems:

[0005] 1. Complex operation: For example, AS-PCR and PCR-RFLP methods require multi-step experiments, including DNA amplification, enzyme digestion, gel electrophoresis analysis, etc. The experimental process is time-consuming and susceptible to human errors; 2. Low detection efficiency: Traditional enzyme digestion methods rely on agarose gel electrophoresis or fluorescence detection, with more reaction steps and longer detection time; 3. Strong instrument dependence: For example, the HRM method has high requirements for fluorescence detectors and complex melting curve analysis, and the data analysis process is complicated; 4. High cost: Although some emerging technologies (such as mass spectrometry and real-time fluorescence PCR) have high accuracy, the equipment is expensive and difficult to promote and apply to large-scale screening. Summary of the invention

[0006] Based on this, an embodiment of the present application provides a sample processing method before APOE gene testing and its application.

[0007] On the one hand, the present application provides a method for processing samples before APOE gene testing, comprising:

[0008] A nucleic acid to be tested is provided, and a target fragment of the nucleic acid to be tested is amplified; and a first restriction endonuclease and a second restriction endonuclease are used to perform a first enzyme digestion treatment on the sample after the amplification reaction.

[0009] The sample after the enzyme digestion treatment is subjected to a second enzyme digestion treatment using a nuclease exonuclease.

[0010] The first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease and the second restriction endonuclease are different.

[0011] The exonuclease includes Lambda exonuclease.

[0012] In some embodiments, the amplification reaction includes a PCR amplification reaction.

[0013] In some of the embodiments, the sequences of the primer pairs for the PCR amplification reaction are shown as SEQ ID NO.1 to SEQ ID NO.2.

[0014] In some embodiments, the conditions of the first enzyme cleavage treatment include: the temperature of the first stage is 36°C~38°C, and the time is 55min~65min; the temperature of the second stage is 80°C~85°C, and the time is 20min~25min.

[0015] In some embodiments, the conditions of the second enzyme digestion treatment include: the temperature of the first stage is 36°C~38°C, and the time is 25min~35min; the temperature of the second stage is 75°C~80°C, and the time is 10min~15min.

[0016] On the other hand, the present application provides a method for typing the APOE gene, comprising:

[0017] The above-mentioned sample processing method before APOE gene detection is used to process, obtain the processed sample to be tested, and perform APOE gene typing detection on the processed sample.

[0018] In some of the embodiments, the method comprises providing a triple-helix molecular switch detection reagent and performing a first incubation.

[0019] The triple-helix molecular switch detection reagent after the first incubation is mixed with the treated sample to be tested, and a second incubation is performed; and the fluorescence signal is detected, and the APOE gene is typed according to the fluorescence signal.

[0020] In some of the embodiments, the triple-helix molecular switch detection reagent includes one or both of an aptamer chain and a detection probe.

[0021] In some of the embodiments, the nucleotide sequence of the aptamer chain is shown as SEQ ID NO.3 to SEQ ID NO.4.

[0022] In some of the embodiments, the nucleotide sequence of the detection probe is shown as SEQ ID NO.5 to SEQ ID NO.6.

[0023] In some embodiments, the 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0024] In some embodiments, the fluorescent reporter group includes one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, TexasRed, RED670 and NED.

[0025] In some embodiments, the conditions of the first incubation include: a temperature of 25°C to 35°C and a time of 25 min to 35 min.

[0026] The conditions of the second incubation include: a temperature of 35° C. to 40° C. and a time of 25 min to 35 min.

[0027] On the other hand, the present application provides an APOE gene detection kit, comprising: an APOE gene amplification primer pair, a first restriction endonuclease, a second restriction endonuclease and a nuclease exonuclease.

[0028] The first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease is different from the second restriction endonuclease.

[0029] In some embodiments, the exonuclease comprises Lambda exonuclease.

[0030] In some embodiments, the APOE gene amplification primer pair is shown as SEQ ID NO.1 to SEQ ID NO.2;

[0031] In some embodiments, the kit further comprises a triple helix molecular switch detection reagent.

[0032] In some of the embodiments, the triple-helix molecular switch detection reagent includes one or more of an aptamer chain and a detection probe.

[0033] In some of the embodiments, the nucleotide sequence of the aptamer chain is shown as SEQ ID NO.3 to SEQ ID NO.4.

[0034] In some of the embodiments, the nucleotide sequence of the detection probe is shown as SEQ ID NO.5 to SEQ ID NO.6.

[0035] The details of one or more embodiments of the present application are set forth in the description which follows, and other features, objects, and advantages of the present application will be apparent from the description and its claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0037] Figure 1 It is the feasibility verification result of a single test; Figure 1 A in the figure is the gel electrophoresis bands of PCR products, AflⅢ endonuclease products and λEXO exonuclease products of three genotypes; Figure 1 B in the figure is the gel electrophoresis bands of PCR products, HaeⅡ endonuclease products and λEXO exonuclease products of three genotypes; Figure 1 C in the figure is the FAM fluorescence and HEX fluorescence of the three different genotype products and the blank group in the single enzyme detection system; Figure 1 D in the figure is the gel electrophoresis diagram of double enzyme detection; Figure 1 E in the figure represents the FAM fluorescence and HEX fluorescence of the three different genotype products and the blank group in the dual enzyme detection system;

[0038] Figure 2 It is the fluorescence peak graph of 6 genotypes;

[0039] Figure 3 are the 6 genotyping thresholds for the APOE gene;

[0040] Figure 4 To perform APOE genotyping on clinical DNA samples by the method and DNA sequencing of the present application;

[0041] Figure 5 The following are the analysis results of SNPs in clinical samples. DETAILED DESCRIPTION

[0042] Below in conjunction with embodiment and example, the application is further described in detail.It should be understood that these embodiments and examples are only used to illustrate the application and are not used to limit the scope of the application, and the purpose of providing these embodiments and examples is to make the understanding of the disclosure of the application more thorough and comprehensive.It should also be understood that the application can be implemented in many different forms, is not limited to the embodiment and example described herein, and those skilled in the art can make various changes or modifications without violating the connotation of the application, and the equivalent form obtained also falls within the protection scope of the application.In addition, in the description below, a large number of specific details are given in order to provide a more comprehensive understanding of the application, and it should be understood that the application can be implemented without one or more of these details.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0044] the term

[0045] Unless otherwise specified or incompatible herewith, the terms and phrases used herein shall have the following meanings:

[0046] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0047] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0048] As used herein, "combination thereof", "any combination thereof", "any combination thereof" etc. include all suitable combinations of any two or more of the listed items.

[0049] Herein, the “suitable” mentioned in “suitable combination”, “suitable method”, “any suitable method”, etc., shall be based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0050] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0051] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0052] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0053] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1 to 10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0054] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0055] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0056] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0057] The term "single nucleotide polymorphism (SNP)" stands for Single Nucleotide Polymorphism, which refers to the variation of a single nucleotide in the genome and is the main source of human genetic diversity.

[0058] The full name of the term "APOE gene": Apolipoprotein E Gene, which is located on human chromosome 19 and is associated with a variety of diseases such as Alzheimer's disease. The APOE gene is located on chromosome 19, with a total length of 3.7Kb and 4 exons. The APOE gene has obvious genetic polymorphism and has 3 main isomers, namely E2, E3, and E4, which are encoded by the three alleles of ε2, ε3, and ε4 respectively. These alleles combine to form 6 genotypes: ε2 / ε2, ε2 / ε3, ε2 / ε4, ε3 / ε3, ε3 / ε4, and ε4 / ε4. The three isomers of APOE, APOE2, APOE3, and APOE4, differ in amino acids 112 and 158, mainly in changes in arginine (Arginine, Arg) and cysteine ​​(Cysteine, Cys). These differences lead to significant differences in the spatial conformation of different APOE proteins, which in turn affects their functions.

[0059] The term "allele-specific PCR (AS-PCR)" Allele-Specific Polymerase Chain Reaction, a technology that amplifies specific alleles through specific primers, is often used in genotyping detection.

[0060] The term "PCR-restriction fragment length polymorphism (PCR-RFLP)" refers to a method that uses restriction endonucleases to cut PCR products and perform genotyping based on differences in fragment length.

[0061] The term "High-Resolution Melting Analysis (HRM)" refers to a technique that uses changes in fluorescent signals to detect differences in the melting temperatures of double-stranded DNA and is used to analyze mutations or polymorphisms.

[0062] The term "FAM" refers to a fluorescein-based fluorescent dye with an excitation wavelength of 494 nm and an emission wavelength of 505 nm to 660 nm.

[0063] The term "HEX" refers to hexahydroxyrhodamine-based fluorescent dye with an excitation wavelength of 533 nm and an emission wavelength of 546 nm to 660 nm.

[0064] The term "Triple-Helix Molecular Switch" refers to a core component for fluorescence signal amplification based on nucleic acid aptamers and signal probes, which is used for high-sensitivity detection of target molecules. Triple-helix molecular switches are biosensors based on triple-helix nucleic acid structures. They use specific nucleic acid sequences to form a triple-helix structure with the major groove of double-stranded DNA through Hoogsteen bonds to output response signals. Triple-helix molecular switches usually consist of two parts: a target-specific oligonucleotide sequence (aptamer sequence) and two arm fragments, and a signal transduction probe (STP) that is sandwiched between the two arm fragments of the aptamer sequence. Under optimal conditions, the triple-helix structure is formed autonomously through Watson-Crick and Hoogsteen base pairing. This structure has high selectivity, strength and affinity, and does not require fluorescent labeling of the original aptamer.

[0065] On the one hand, the present application provides a method for processing samples before APOE gene testing, comprising:

[0066] A nucleic acid to be tested is provided, a target fragment of the nucleic acid to be tested is amplified, and a first restriction endonuclease and a second restriction endonuclease are used to perform a first enzyme digestion treatment on the sample after the amplification reaction.

[0067] The sample after the enzyme digestion treatment is subjected to a second enzyme digestion treatment using a nuclease exonuclease.

[0068] In some embodiments, the amplification reaction comprises a PCR amplification reaction.

[0069] In some of the embodiments, the primer pairs for PCR amplification reaction are shown as SEQ ID NO.1 to SEQ ID NO.2.

[0070] The sequence of the forward primer: 5'-GCTGGGCGCGGACATGGAGGACG-3' (SEQ ID NO. 1).

[0071] Sequence of the reverse primer: 5'-GCCCCGGCCTGGTACACTGCCA-3' (SEQ ID NO. 2).

[0072] In some embodiments, the first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease and the second restriction endonuclease are different.

[0073] Exonucleases include Lambda exonucleases.

[0074] The specific recognition sequence of restriction endonuclease AflⅢ is 5'-ACRYGT-3' (Y = C or T, R = A or G), which can cut the rs429358 (T) site;

[0075] The specific recognition sequence of restriction endonuclease HaeⅡ is 5'-RGCGCY-3', which can cut the rs7412 (C) site. The polymorphisms of rs429358 and rs7412 together lead to the polymorphism of APOE.

[0076] AflIII enzyme is a restriction endonuclease that can recognize a specific DNA sequence and cut the DNA chain at the sequence. AflIII enzyme recognizes and cuts a specific nucleotide sequence (5'-ACRYGT-3', where Y represents C or T, and R represents A or G), that is, AflIII enzyme can recognize DNA containing this specific sequence and cut at the sequence.

[0077] HaeII enzyme is a restriction endonuclease that can recognize a specific DNA sequence and cut the DNA chain at that sequence. The DNA sequence recognized by HaeII enzyme is 5'-RGCGCY-3', where R represents A or G and Y represents C or T. Cutting characteristics: HaeII enzyme cuts DNA at the recognition site, producing DNA fragments with sticky ends.

[0078] Lambda exonuclease is a 5'→3' exonuclease that specifically acts on DNA. Lambda exonuclease is ideal for converting linear double-stranded DNA into single-stranded DNA by preferentially acting on the 5'-phosphorylated end.

[0079] In some embodiments, the conditions of the first enzyme digestion treatment include: a temperature of 36°C to 38°C, a reaction time of 55min to 65min, and a temperature of 80°C to 85°C, an inactivation time of 20min to 25min.

[0080] For example, the temperature of the first stage of the first enzyme digestion treatment is 36°C, 37°C or 38°C and any value in between, and the time is 55min, 56min, 57min, 58min, 59min, 60min, 61min, 62min, 63min, 64min or 65min and any value in between.

[0081] The temperature of the second stage is 80°C, 81°C, 82°C, 83°C, 84°C or 85°C, and the time is 20 min, 21 min, 22 min, 23 min, 24 min or 25 min and any value in between.

[0082] In some embodiments, the conditions of the second enzyme digestion treatment include: the temperature of the first stage is 36° C. to 38° C., and the reaction time is 25 min to 35 min.

[0083] The temperature of the second stage is 75℃~80℃, and the inactivation time is 10min~15min.

[0084] For example, the temperature of the first stage of the second enzyme digestion treatment is 36°C, 37°C or 38°C and any value in between, and the time is 25min, 26min, 27min, 28min, 29min, 30min, 31min, 32min, 33min, 34min or 35min and any value in between.

[0085] For example, the temperature of the second stage of the second enzyme digestion treatment is 75° C., 76° C., 77° C., 78° C., 79° C. or 80° C. and any value therebetween. The time is 10 min, 11 min, 12 min, 13 min, 14 min or 15 min and any value therebetween.

[0086] On the other hand, the present application provides a method for typing the APOE gene. The present application realizes rapid and specific typing detection of double SNP sites (rs429358 and rs7412) of the apolipoprotein E (APOE) gene by integrating double restriction endonucleases (AflIII and HaeII), Lambda exonuclease and triple helix molecular switch (THMS) technology, and specifically comprises the following steps:

[0087] The above-mentioned APOE gene pre-test sample processing method is used to obtain the processed sample to be tested; a triple-helix molecular switch detection reagent is provided for the first incubation.

[0088] The triple-helix molecular switch detection reagent after the first incubation is mixed with the treated sample to be tested, and a second incubation is performed to detect the fluorescence signal, and the APOE gene is typed according to the fluorescence signal.

[0089] Genotype determination includes determining the sample genotype based on the fluorescence signal intensity ratio (FAM signal / HEX signal):

[0090] The fluorescence threshold ranges of six genotypes (ε2 / ε2, ε3 / ε3, ε4 / ε4, ε2 / ε3, ε2 / ε4, ε3 / ε4) were set based on the experimental data.

[0091] Based on the established threshold range, the sample genotype is automatically determined using the two-dimensional fluorescence image.

[0092] In some of the embodiments, the triple helix molecular switch detection reagent includes one or both of an aptamer chain and a detection probe.

[0093] In some of the embodiments, the nucleotide sequence of the aptamer chain is shown as SEQ ID NO.3 to SEQ ID NO.4.

[0094] AL: 5'TTTTTTTTTTCCTCCATGTCCCGCGCCCAGCTTTTTTTTT 3' (SEQ ID NO. 3).

[0095] HL: 5'TTTTTTTTTTTTGCGCCTGGCAGTGTACCATTTTTTTTTTTT 3' (SEQ ID NO. 4).

[0096] In some of the embodiments, the nucleotide sequence of the detection probe is shown as SEQ ID NO.5 to SEQ ID NO.6.

[0097] In some embodiments, the 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.

[0098] In some embodiments, the fluorescent reporter group includes one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, TexasRed, RED670 and NED. The fluorescent reporter group is a special type of fluorescent molecule that can absorb light of a specific wavelength and emit light of a different wavelength.

[0099] In one embodiment, the conditions of the first incubation include: a temperature of 25°C to 35°C and a time of 25 min to 35 min.

[0100] The conditions for the second incubation include: temperature of 35°C to 40°C and time of 25min to 35min.

[0101] The temperature of the first incubation is, for example, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C or 35°C, and any value in between; for example, the time is 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min or 35 min, and any value in between.

[0102] The temperature of the second incubation is, for example, 35° C., 36° C., 37° C., 38° C., 39° C., or 40° C., and any value therebetween. For example, the time is 25 min, 26 min, 27 min, 28 min, 29 min, 30 min, 31 min, 32 min, 33 min, 34 min, or 35 min, and any value therebetween.

[0103] On the other hand, the present application provides an APOE gene detection kit, comprising: an APOE gene amplification primer pair, a first restriction endonuclease, a second restriction endonuclease and a nuclease exonuclease.

[0104] It is understandable that the kit also includes other PCR amplification reagents and amplification buffer.

[0105] In some of the embodiments, the APOE gene amplification primer pair is shown as SEQ ID NO.1 to SEQ ID NO.2.

[0106] In some embodiments, the first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease and the second restriction endonuclease are different.

[0107] In some embodiments, the exonuclease comprises Lambda exonuclease.

[0108] In some embodiments, the kit further comprises a triple helix molecular switch detection reagent.

[0109] On the other hand, the present application provides the use of the above-mentioned kit in products related to the prediction of the risk of developing Alzheimer's disease and the prognosis assessment of patients.

[0110] In some embodiments, the triple helix molecular switch detection reagent includes one or more of an aptamer chain and a detection probe. Aptamers, usually nucleic acid aptamers, are a class of short sequences of artificially synthesized DNA, RNA, XNA (enhanced modified nucleotides) or peptides that can bind to a specific target molecule or a family of target molecules with high affinity and high specificity.

[0111] In some of the embodiments, the nucleotide sequence of the aptamer chain is shown as SEQ ID NO.3 to SEQ ID NO.4.

[0112] In some of the embodiments, the nucleotide sequence of the detection probe is shown as SEQ ID NO.5 to SEQ ID NO.6.

[0113] According to the APOE genotyping method described above, the present application provides, on the other hand, a method for detecting the APOE gene, which is for diagnostic or non-diagnostic purposes and comprises the following steps:

[0114] The above-mentioned APOE gene pre-test sample processing method is used to obtain the processed sample to be tested; a triple-helix molecular switch detection reagent is provided for the first incubation.

[0115] The triple-helix molecular switch detection reagent after the first incubation is mixed with the treated sample to be tested, and a second incubation is performed to detect the fluorescence signal, and the APOE gene is detected according to the fluorescence signal.

[0116] The expression of the APOE gene is associated with a variety of diseases such as Alzheimer's disease, so the method provided in this application has a high clinical testing value.

[0117] In addition, the APOE gene is highly polymorphic and can therefore also be used for research in fields such as sociology (such as racial distribution).

[0118] The present application provides a sample processing method before APOE gene detection, including: providing a nucleic acid to be tested, performing an amplification reaction on a target fragment of the nucleic acid to be tested, performing a first enzyme digestion treatment on the sample after the amplification reaction using a first restriction endonuclease and a second restriction endonuclease, and performing a second enzyme digestion treatment on the sample after the digestion treatment using a nuclease exonuclease, so as to degrade specific double-stranded DNA into single-stranded DNA to improve detection specificity.

[0119] Furthermore, the present application combines a triple helix molecular switch (THMS) to amplify the target single strand and convert the fluorescent signal, and realizes rapid and specific genotyping through the intensity and ratio of the fluorescent signal. Through the precise recognition and shearing of the SNP site by double restriction endonucleases, combined with the single-stranded processing of the exonuclease and the signal amplification mechanism of THMS, non-specific results and detection interference can be effectively avoided, achieving higher detection sensitivity (as low as 2 copies) and specificity.

[0120] In addition, this application can complete dual-site detection in a single reaction system, and the overall detection time is significantly shortened to within a few hours (the total time from sample amplification to fluorescence detection is 3 hours). Compared with high-resolution melting curve analysis (HRM) and mass spectrometry analysis, which rely on expensive detection equipment, this technology only requires a conventional fluorescence spectrophotometer to complete the detection, reducing experimental costs and having a wider potential for clinical promotion.

[0121] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0122] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0123] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0124] Example 1

[0125] An embodiment of the present application provides a sample processing method before APOE gene detection, comprising:

[0126] 1. Sample processing and DNA extraction

[0127] Extract genomic DNA from biological samples (such as blood, saliva or tissue) using a commercial DNA extraction kit (such as TIA Namp Genomic DNA Kit) according to the instructions. Finally, dissolve the DNA in an appropriate amount of nucleic acid preservation solution and measure the concentration using an ultraviolet spectrophotometer.

[0128] 2. PCR amplification of target fragments

[0129] Reagent ratio: Prepare the PCR reaction system according to the ratio in Table 1 below (40 µL total volume):

[0130] Table 1: PCR reaction system

[0131]

[0132] The sequence of the forward primer: 5'-GCTGGGCGCGGACATGGAGGACG-3' (SEQ ID NO. 1).

[0133] Sequence of the reverse primer: 5'-GCCCCGGCCTGGTACACTGCCA-3' (SEQ ID NO. 2).

[0134] The amplification procedure is shown in Table 2 below:

[0135] Table 2: Amplification Procedure

[0136]

[0137] 3. Double restriction enzyme digestion reaction

[0138] Enzyme digestion reaction system: Prepare 50 µL of the system according to the ratio in Table 3 below:

[0139] Table 3: Double restriction enzyme reaction system

[0140]

[0141] Reaction conditions: incubation at 37°C for 60 min, followed by inactivation at 80°C for 20 min.

[0142] 4. Exonuclease digestion

[0143] The reaction system of exonuclease is shown in Table 4:

[0144] Table 4: Exonuclease reaction system

[0145]

[0146] Reaction conditions: incubation at 37°C for 30 min, followed by inactivation at 75°C for 10 min.

[0147] Example 2

[0148] This embodiment provides an APOE gene typing method, including the sample treated by the sample pre-treatment method of embodiment 1 and the steps of fluorescence detection and genotype determination.

[0149] 1. Construction of triple helix molecular switch (THMS)

[0150] THMS preparation: Mix the reagents listed in Table 5 and incubate at 30°C for 30 min.

[0151] Table 5: Triple helix molecular switch system

[0152]

[0153] The aptamer sequences include:

[0154] AL: 5'TTTTTTTTTTCCTCCATGTCCCGCGCCCAGCTTTTTTTTT 3' (SEQ ID NO. 3).

[0155] HL: 5'TTTTTTTTTTTTGCGCCTGGCAGTGTACCATTTTTTTTTTTT 3' (SEQ ID NO. 4).

[0156] Signal probe sequences include:

[0157] 5' BHQ1-GAGGAAAAAAAAAAATTCCTC-HEX 3' (SEQ ID NO. 5).

[0158] 5'BHQ1-ACACCAAAAAAAAAAATGGTGT-FAM 3' (SEQ ID NO. 6).

[0159] This embodiment uses two types of THMS:

[0160] AL-THMS (detection of rs429358): The stem length of the aptamer and probe was designed to be 9 base pairs.

[0161] HL-THMS (detection of rs7412): The stem length of the aptamer and probe was designed to be 13 base pairs.

[0162] 2. Fluorescence signal detection

[0163] Reaction mixing: The product treated by the sample treatment method before APOE gene detection in Example 1 is mixed and incubated with the corresponding THMS. The reaction system is shown in Table 6 below:

[0164] Table 6

[0165]

[0166] The above system was reacted at 37°C for 30 min.

[0167] Fluorescence measurement: The fluorescence intensity of different channels (FAM channel and HEX channel) was detected using a fluorescence spectrophotometer.

[0168] FAM channel: excitation wavelength 494 nm, emission wavelength 505 nm~660 nm.

[0169] HEX channel: excitation wavelength 533 nm, emission wavelength 546 nm~660 nm.

[0170] 5. Genotype determination

[0171] Determine the sample genotype based on the fluorescence signal intensity ratio (FAM signal / HEX signal):

[0172] The fluorescence threshold ranges of six genotypes (ε2 / ε2, ε3 / ε3, ε4 / ε4, ε2 / ε3, ε2 / ε4, ε3 / ε4) were set based on the experimental data.

[0173] Based on the established threshold range, the sample genotype is automatically determined using the two-dimensional fluorescence image.

[0174] Verification results:

[0175] 1. Feasibility verification of single detection

[0176] The present application first verifies the feasibility of the principle in a single detection system. The single detection verification experimental conditions of the APOE gene are endo-cutting for 30 minutes, exo-cutting for 30 minutes, and finally judging whether the reaction is successful by gel electrophoresis.

[0177] The results of AflⅢ restriction digestion were as follows Figure 1As shown in A, both ɛ2 and ɛ3 have the cleavage site of AflIII enzyme, so the cleavage product can be observed at the 25 bp position (red arrow) in lanes 5 and 6, while ɛ4 does not have the cleavage site and therefore no cleavage product is observed. Next, the product is exocuted, and a faint white band can be observed below 25 bp in lanes 8 and 9, indicating that the λ exonuclease further digests the endonuclease product. It is worth noting that although the degradation rate of non-phosphorylated substrates is greatly reduced, the λ exonuclease still has a product that digests the 5' hydroxyl end. Therefore, the present application can observe a band of 80bp in the exocut product.

[0178] The results of HaeⅡ enzyme digestion test are as follows Figure 1 As shown in B, similarly, ɛ3 and ɛ4 both have the restriction site of HaeⅡ enzyme, so the restriction product can be observed at the 25bp position (red arrow) in lanes 5 and 7, while ɛ 2 does not have the restriction site so no restriction product is observed. Next, the product is exonucleated, and a faint white band can be observed below 25 bp in lanes 8 and 10, indicating that the λ exonuclease further digests the endonuclease product. The single-stranded product is combined with the corresponding THMS and incubated at 37°C for 1 h. The specific genotype is determined based on the HEX and FAM fluorescence signals. Figure 1 As shown in C, compared with the blank group (Control), the low fluorescence signal indicates that the corresponding THMS binds to the corresponding exosome, and the STP probe falls off and spontaneously forms a hairpin structure.

[0179] 2. Feasibility verification of dual enzyme detection

[0180] From the single detection system, we can see that the reaction temperature of the two endonucleases is 37℃, so the two enzymes can be put into the same system to shorten the reaction time. The dual detection system is basically the same as the single detection system, except that the two enzymes are reacted together with the buffer rCutsmart buffer (10×). Figure 1 As shown in D, it is consistent with the results of the previous single detection system. A band of about 80 bp can be observed in the exosome. Since the exosome is small, it is not easy to see in the electrophoresis diagram. Figure 1 As shown in E, changes in the fluorescence signal can be observed.

[0181] 3. Optimization of enzyme digestion conditions

[0182] Optimization of endonuclease reaction time: This application first optimized the endonuclease reaction time. According to the results of the cleavage product, 60 minutes was finally selected as the endonuclease digestion time.

[0183] Endonuclease reaction concentration: This application optimizes the enzyme concentration. According to the brightness of the endonuclease band, the concentration of the AflIII enzyme and the concentration of the HaeII enzyme finally used in this application are 8U and 8U, respectively.

[0184] 4. THMS Optimization

[0185] Optimization of stem length of AL-THMS and HL-THMS: The stability of THMS is related to the stem length. Therefore, this application synthesized a group of THMS. First, according to the previous research method, the length of the short chain was fixed, and the optimal THMS stem length was determined by adjusting the length of the stem part of APT. This application determined that the stem length of AL-THMS was 9 nucleotides, and the stem length of HL-THMS was determined to be 13 nucleotides.

[0186] 5. Mg of AL-THMS and HL-THMS synthesis buffer 2+ optimization

[0187] The stability of THMS is also affected by pH and Mg 2+ Since the stem sequence selected in this experiment is AT·A, which is insensitive to pH, only Mg is affected in this step. 2+ Previous reports have shown that the formation and stabilization of THMS require divalent cations (such as Mg 2+ ) to reduce the repulsive force between the skeleton charges. Therefore, this application studies the 2+ Effect of concentration on THMS formation.

[0188] The final optimized Mg 2+ The results were as follows: 25 mM in the AL-THMS system; Mg in the HL-THMS system 2+ The concentration is 100mM.

[0189] 6. Setting of classification threshold

[0190] Next, the present application conducted a full-process experiment using six genotype combinations of synthetic templates to calculate the theoretical typing threshold, and each sample was tested three times in parallel. The experimental reaction conditions for double SNP site typing were as follows: The final concentrations of the PCR primers FP and RP for APOE were both 0.5 μmol L -1， The final concentration of the synthetic template was 25 pM. After pre-denaturation at 95°C for 3 min, the reaction was cycled 35 times at 95°C for 30 sec, 62°C for 30 sec, and 72°C for 30 sec. The PCR product was endo- and exo-cut according to the conditions optimized above, and fluorescence was detected after adding THMS. The fluorescence peaks of the six combinations are shown in Figure 2. Figure 2 As shown, the fluorescence ratio and standard deviation of each combination calculated according to the formula are listed in Table 7.

[0191] With the fluorescence ratio of the FAM channel as the horizontal coordinate and the fluorescence ratio of the HEX channel as the vertical coordinate, the distribution of the six types of genotypes in the first quadrant of the two-dimensional coordinate system can be obtained ( Figure 3 The dashed lines represent the boundaries between genotypes, which are ɛ3 / ɛ3 and ɛ2 / ɛ3 (0.43), ɛ2 / ɛ3 and ɛ2 / ɛ2 (0.76), ɛ3 / ɛ3 and ɛ3 / ɛ4 (0.42), and ɛ3 / ɛ4 and ɛ4 / ɛ4 (0.74). The principle of boundary calculation is to compare the fluorescence ratios of the combinations of two adjacent genotypes, and take the average of the two outermost values ​​while considering the standard deviation. Take the calculation method of the boundary between ɛ3 / ɛ3 and ɛ2 / ɛ3 as an example: by calculation, find the maximum value (0.33) of the FAM channel fluorescence ratio in ɛ3 / ɛ3 plus the standard deviation, and the minimum value (0.53) of the FAM channel fluorescence ratio in 2 / ɛ3 minus the standard deviation. The average value of 0.43 is the typing boundary between ɛ3 / ɛ3 and ɛ2 / ɛ3.

[0192] Table 7

[0193]

[0194] 7. Actual sample testing

[0195] In this application, genomic DNA was extracted from clinical blood samples of 10 AD patients, and then APOE genotyping analysis was performed. APOE SNPs rs429358 and rs7412 in the samples were further genotyped. The amplification and analysis results of each SNP are shown in Figure 4 and Figure 5 shown.

[0196] The results show that the consistency between the genotyping results and sequencing results of each SNP detected by the method of this application is 100%. In the DNA samples of 10 AD patients, APOE rs429358 has two genotypes: TT and CT. The TT genotype accounts for 10% and the CT genotype accounts for 90%. APOE rs7412 has two genotypes, CT and CC. The CT genotype accounts for 80% and the CC genotype accounts for 20%. Previous studies have shown that the frequency of the ɛ4 allele is significantly increased in patients diagnosed with Alzheimer's disease. The results of this application confirm this trend, thereby confirming the hypothesis that the APOE ɛ4 allele is a susceptibility factor for Alzheimer's disease.

[0197] The above-described embodiments only express several implementation methods of the present application, which is convenient for understanding the technical solution of the present application in detail, but it cannot be understood as a limitation on the scope of protection of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of the present application, several deformations and improvements can be made, which all belong to the protection scope of the present application. In addition, it should be understood that after reading the above-mentioned teaching content of the present application, the technicians in this field can make various changes or modifications to the present application, and the equivalent forms obtained also fall within the protection scope of the present application. It should also be understood that the technical solutions obtained by the technicians in this field through logical analysis, reasoning or limited experiments on the basis of the technical solutions provided in the present application are all within the protection scope of the claims attached to the present application. Therefore, the protection scope of the patent of the present application shall be based on the content of the attached claims, and the description can be used to interpret the content of the claims.

Claims

1. A sample processing method before APOE gene detection, characterized in that: include: Providing a nucleic acid to be tested, and performing an amplification reaction on a target fragment of the nucleic acid to be tested; Performing a first restriction endonuclease and a second restriction endonuclease on the sample after the amplification reaction; as well as Performing a second enzyme digestion treatment on the sample after the enzyme digestion treatment using an exonuclease; The first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease is different from the second restriction endonuclease; and / or, The exonuclease includes Lambda exonuclease.

2. The method for sample processing before APOE gene detection according to claim 1, characterized in that: The amplification reaction includes using a PCR amplification reaction; Optionally, the sequences of the primer pairs for the PCR amplification reaction are shown in SEQ ID NO.1 to SEQ ID NO.

2.

3. The method for sample processing before APOE gene detection according to claim 1, characterized in that: The conditions of the first enzyme digestion treatment include: The temperature of the first stage is 36℃~38℃, and the time is 55min~65min; The temperature of the second stage is 80℃~85℃ and the time is 20min~25min.

4. The method for sample processing before APOE gene detection according to claim 1, characterized in that: The conditions of the second enzyme digestion treatment include: The temperature of the first stage is 36℃~38℃, and the time is 25min~35min; The temperature of the second stage is 75℃~80℃ and the time is 10min~15min.

5. A method for typing the APOE gene, characterized in that: include: The sample is processed by the APOE gene pre-test sample processing method described in any one of claims 1 to 4 to obtain the processed sample to be tested, and the APOE gene typing test is performed on the processed sample.

6. The APOE gene typing method according to claim 5, characterized in that: include: Provide triple helix molecular switch detection reagent for the first incubation; Mixing the triple-helix molecular switch detection reagent after the first incubation with the treated sample to be tested, and performing a second incubation; as well as, Detect the fluorescence signal and type the APOE gene according to the fluorescence signal.

7. The APOE gene typing method according to claim 6, characterized in that: The triple helix molecular switch detection reagent includes one or both of an aptamer chain and a detection probe; Optionally, the nucleotide sequence of the aptamer chain is shown in SEQ ID NO.3 to SEQ ID NO.4; Optionally, the nucleotide sequence of the detection probe is shown in SEQ ID NO.5 to SEQ ID NO.

6.

8. The APOE gene typing method according to claim 7, characterized in that: The 5' end of the detection probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; Optionally, the fluorescent reporter group includes one or more of FAM, ROX, HEX, CY5, VIC, TET, JOE, Cy3, Cy7, RED610, Texas Red, RED670 and NED.

9. The APOE gene typing method according to claim 6, characterized in that: The conditions of the first incubation include: a temperature of 25°C to 35°C and a time of 25min to 35min; and / or, The conditions of the second incubation include: a temperature of 35° C. to 40° C. and a time of 25 min to 35 min.

10. An APOE gene detection kit, characterized in that: include: APOE gene amplification primer pair, a first restriction endonuclease, a second restriction endonuclease, and an exonuclease; The first restriction endonuclease and the second restriction endonuclease are each independently selected from AflIII enzyme or HaeII enzyme, and the first restriction endonuclease is different from the second restriction endonuclease; Optionally, the exonuclease comprises Lambda exonuclease; Optionally, the APOE gene amplification primer pair is shown as SEQ ID NO.1 to SEQ ID NO.2; Optionally, the kit further comprises a triple helix molecular switch detection reagent; Optionally, the triple helix molecular switch detection reagent includes one or more of an aptamer chain and a detection probe; Optionally, the nucleotide sequence of the aptamer chain is shown in SEQ ID NO.3 to SEQ ID NO.4; Optionally, the nucleotide sequence of the detection probe is shown in SEQ ID NO.5 to SEQ ID NO.6.

Images