A high-throughput method for mining molecular elements of microorganisms in response to toxic and recalcitrant organic pollutants and applications thereof

Abstract

The application discloses a high-throughput mining method and application of a molecular element of a microorganism responding to a toxic and hard-to-degrade organic pollutant stress, and the method is used for high-throughput mining of a molecular element of a microorganism responding to a toxic and hard-to-degrade organic pollutant stress, and important functional elements obtained through the mining are applied to toxic and hard-to-degrade organic pollutant monitoring and modification of a technical chassis cell.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a high-throughput mining method and application of molecular elements of microorganisms responding to stress of toxic and refractory organic pollutants. BACKGROUND

[0002] With the rapid development of economic society, the types of toxic and refractory organic pollutants in the environment are increasing, which seriously threatens the ecological environment and human health, and it is urgent to establish new and efficient toxic and refractory organic pollutants prevention and control technology. Microorganisms have many enzyme systems and regulatory networks in the body, which can efficiently respond to external nutrients or toxic substances, thereby effectively taking in, excreting, metabolizing or transforming. At present, there are a large number of successful cases reported on the application of monitoring and management of toxic pollutants based on molecular elements of microorganisms responding to environmental pollution stress. For example, the decomposition and metabolism elements of microorganisms are used for efficient degradation and removal of toxic pollutants, and the transcriptional regulatory elements of microorganisms are used for accurate identification and monitoring of toxic pollutants. Although some microorganisms have been reported to have certain degradation function for toxic and refractory organic pollutants, the related microbial resources are still extremely scarce, and the molecular elements of microorganisms responding to stress of toxic and refractory organic pollutants are rarely reported, which seriously limits the innovation and development of green and efficient toxic and refractory organic pollutants prevention and control technology.

[0003] In the process of microorganisms responding to environmental pollution stress, promoters act as the "switch" of gene expression regulation, and regulate the transcription initiation time and expression degree of different genes through the combination with transcription factors. The interaction between transcription factors and promoters is one of the key mechanisms of microorganisms responding to environmental pollution stress and regulating gene expression. Due to the lack of simple and efficient methods, many regulatory elements of microorganisms responding to environmental pollution stress have not been effectively mined and utilized. In view of this technical problem, the patent "A method for screening and identifying stress response gene expression regulatory factors (ZL202010699515.0)" is invented and authorized by the patentee, which effectively mines the molecular elements of microorganisms responding to environmental pollution stress. However, in the actual application process, the method still has some problems in cost, time consumption, universality, data acquisition, etc. In view of this, the present application further optimizes the screening and identification method of molecular elements of microorganisms responding to environmental pollution stress by changing the screening marker, replacing the broad host vector, optimizing the protein-DNA binding amplification and screening steps, and introducing DNA high-throughput sequencing technology, etc. The optimized method is used to high-throughput mine the molecular elements of microorganisms responding to stress of toxic and refractory organic pollutants, and the important functional elements mined are applied to the modification of toxic and refractory organic pollutants monitoring and management chassis cells. SUMMARY

[0004] The present application aims at the deficiency of the existing element mining technology and the lack of toxic and refractory organic pollutant responsive elements, and provides an optimized high-throughput screening and identification method of molecular elements of microorganisms responding to environmental pollution stress, uses the optimized method to high-throughput mine the molecular elements of microorganisms responding to toxic and refractory organic pollutant stress, and applies the important functional elements obtained by mining to the toxic and refractory organic pollutant monitoring and the modification of the chassis cell of the treatment technology.

[0005] The high-throughput mining method and application of the molecular elements of microorganisms responding to toxic and refractory organic pollutant stress of the present application comprise the following steps:

[0006] a. Extracting the genomic DNA of the cell to be screened and identified, then digesting and treating the genomic DNA with a restriction endonuclease Mnli, adding 5'Mix and 3'Mix adaptors to the DNA fragments after digestion, using a forward primer H1-F containing a HindIII restriction site and a part of the homologous arm sequence near the corresponding restriction site of pBBR1MCS-5 and a reverse primer X1-R containing an XbaI restriction site and a part of the homologous arm sequence near the corresponding restriction site of pBBR1MCS-5 to amplify the ligation product of the Mnli digestion product with adaptors by PCR, and recovering and purifying the PCR product, which is the genomic DNA library with adaptors;

[0007] b. Stressing the cell to be screened and identified with a pollutant, using no pollutant as a control, then extracting the stress response protein, combining the response protein solution with the genomic DNA library, after the protein and DNA are fully combined, loading onto a pre-washed nitrocellulose membrane filter column, centrifuging and discarding the effluent, washing multiple times with a filter washing buffer, and eluting to obtain the response protein-bound DNA fragments with an elution buffer;

[0008] c. Inserting the kanamycin resistance gene with a promoter and a multiple cloning site into pBBR1MCS-5 plasmid DNA, then inserting the response protein-bound DNA fragments into pBBR1MCS-5 plasmid DNA, and recombining into the cell to be screened and identified, screening through kanamycin, extracting the genomic DNA of the positive clones obtained by screening, and performing high-throughput sequencing of the environmental pollution stress response protein-bound DNA fragments in the recombinant plasmid.

[0009] Preferably, the cell to be screened and identified is Sphingobium xenophagum C1.

[0010] The present invention also provides an efflux protein pump gene cluster composed of AcrA, AcrB, TolC, and AdaB, wherein the encoding nucleotide sequences of AcrA, AcrB, TolC, and AdaB are shown in SEQ ID NO.2 to NO.5, respectively.

[0011] This invention also provides the application of the efflux protein pump gene cluster composed of the above-mentioned AcrA, AcrB, TolC, and AdaB in improving the strain's tolerance to TBBPA.

[0012] The present invention also provides a ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein, the encoding nucleotide sequence of which is shown in SEQ ID NO.21.

[0013] The present invention also provides the application of the above-mentioned ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in the degradation of TBBPA.

[0014] Preferably, the gene encoding the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein is introduced into engineered bacteria, which produce the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein for the degradation of TBBPA.

[0015] Preferably, the engineered bacteria is Escherichia coli.

[0016] The present invention also provides a xenobiotic-responsive transcription factor chr1_2605, the nucleotide sequence of which is shown in SEQ ID NO.22.

[0017] This invention also provides the application of xenobiotic-responsive transcription factor chr1_2605 in monitoring TBBPA contamination.

[0018] The optimized screening and identification technology for molecular elements of microbial responses to environmental pollution stress, as described in this invention, represents a significant improvement over the original patented technology in terms of cost, time consumption, versatility, and data acquisition. First, the screening marker has been changed from luciferase activity detection to antibiotic resistance screening, greatly reducing the expensive cost of using substrate luciferase for signal detection. Second, the screening process has been changed to a two-round antibiotic resistance screening, significantly reducing false negatives caused by the previous single-round antibiotic resistance screening and the enormous workload of random strain selection for verification. Furthermore, the manipulation vector has been changed from pACYC-Luc to the broad-host vector pBBR1MCS-5, which can adapt to most host strains except Escherichia coli, providing greater versatility in screening molecular elements of environmental strains. Finally, high-throughput DNA sequencing analysis by merging all positive clones significantly reduces the workload and greatly increases the amount of data acquired compared to the previous method of random strain selection for verification sequencing.

[0019] Optimized methods were used to perform high-throughput mining and analysis of molecular elements in microbial responses to stress from toxic and recalcitrant organic pollutants (ROCs). Several molecular elements were identified, primarily involved in the efflux or uptake of ROCs, toxic responses to ROCs, non-specific detoxification of ROCs, specific degradation of ROCs, and some processes with unclear functions. Important functional elements include: ① Efflux protein system elements: the chr1_112–chr1_119 gene cluster, comprising acrR, acrA, acrB, tolC, adaB, fabG, modC, and modB genes, involved in the AcrAB-TolC efflux protein pump and molybdate transport system; and the chr1_1648–chr1_1650 gene cluster, comprising pitA, ykaA, and lysR genes, involved in the phosphate / sulfate transport system. ② Transcriptional regulation and degradation molecular elements: The chr1_2604~chr1_2605 operons encode a ketoglutarate / Fe-dependent dioxygenase with a conserved COG4340 domain and a xenobiotic-responsive transcription factor with a conserved COG3800 domain, respectively; the p2_166~p2_168 gene cluster encodes the hypothetical proteins hp2 and hp3, and the mucR transcriptional regulator, respectively. ③ Detoxification or toxicity response molecular elements: The chr1_709~chr1_713 gene cluster contains the gstA, nrdA, hp1, nrdB, and ulaG genes, which are involved in cellular detoxification processes mediated by glutathione S-transferases and DNA replication / recombination / repair, etc.; chr1_2603 is an lpd gene involved in glutathione disulfide reductase; the chr1_1993~chr1_1995 gene cluster contains the nlpD, iscA, and xthA genes, respectively. It participates in cell wall / cell membrane synthesis, Fe-S cluster biosynthesis, and DNA replication / recombination / repair processes mediated by exonucleases.

[0020] ① A highly tolerant artificial cell system for recalcitrant organic pollutants, *Sphingobium xenophagum* C1 (pBBR-118-115), was constructed based on the AcrAB-TolC efflux protein pump elements chr1_118–chr1_115 and the broad-host vector pBBR1MCS-5. This demonstrated that increasing the copy number of the AcrAB-TolC efflux protein pump can improve the strain's tolerance to stress from recalcitrant organic pollutants, providing a novel highly tolerant molecular element for the development of bioaugmentation technologies for the remediation of high concentrations of recalcitrant organic pollutants in the environment. ② A highly tolerant artificial cell system for the degradation of recalcitrant organic pollutants, *E. coli* BL21 (DE3, pET30b-2604), was constructed based on the ketoglutarate / Fe-dependent dioxygenase element chr1_2604 and the expression vector pET30b. This study confirmed that the induced expression and early accumulation of the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in chassis cells demonstrated a strong oxidative degradation capacity for toxic and recalcitrant organic pollutants, providing a novel molecular element for the development of bioaugmentation technologies for the remediation of such pollutants in the environment. ③ Based on the xenobiotic-responsive transcription factor element chr1_2605 and the broad-host vector pBBR1MCS-5, a typical toxic and recalcitrant organic pollutant, Tetrabromobisphenol A (TBBPA), was monitored using the Sphingobium xenophagum C1 (pBBR-2605-HiBiT) cell line. At the tested concentration of TBBPA, 7.0 μM TBBPA pollution stress induced the largest luciferase signal, with a detection limit between 0.01 and 0.05 μM. This study confirms the feasibility of xenobiotic-responsive transcription factor elements in responding to the stress of toxic and recalcitrant organic pollutants, providing novel molecular elements for the development of biomonitoring technologies for toxic and recalcitrant organic pollutants in the environment. Attached Figure Description

[0021] Figure 1 Flowchart of optimized screening and identification technology for molecular elements of microbial response to environmental pollution stress.

[0022] Figure 2 Abundance changes of different amplicon sequence variants (ASVs) in microbial response to TBBPA pollution stress.

[0023] Figure 3 Information on key functional gene clusters that are significantly induced in microbial responses to TBBPA pollution stress.

[0024] Figure 4 Growth of highly tolerant artificial cells constructed based on efflux protein pump elements under different concentrations of TBBPA pollution stress.

[0025] Figure 5 Degradation of TBBPA at different concentrations by artificial cells constructed based on dioxygenase elements.

[0026] Figure 6 The fluorescence response of pollution monitoring sensor cells constructed based on xenobiotic-responsive transcription factor elements to different concentrations of TBBPA. Detailed Implementation

[0027] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0028] Example 1: Optimization of a screening and identification method for molecular elements of microbial response to environmental pollution stress.

[0029] 1. Construction of genomic DNA library

[0030] (1) Extraction and enzyme digestion of genomic DNA

[0031] Sphingobium xenophagum C1 (see Int J Syst Evol Microbiol. 2016, 66(10):3912-3916; Int J Syst Evol Microbiol. 2019, 69(7):2161-2165., which the applicant also holds and guarantees to make available to the public within 20 years from the date of application) was inoculated into 5 mL of LB medium (each liter of medium contains 10.0 g peptone, 5.0 g yeast extract, and 5.0 g NaCl, with water as the solvent; the preparation method is to dissolve each component in water and sterilize it) and cultured overnight at 30°C. The bacterial cells were collected by centrifugation at room temperature, and the whole genome DNA of strain C1 was extracted using a bacterial genome extraction kit. The genome of strain C1 was digested at 37°C for 1 hour using Mnli restriction endonuclease (5'…CCTC(N)7…3'), resulting in a (N) bulge at the 3' end of the digested DNA fragment.

[0032] (2) Preparation of DNA adapters

[0033] Linker primers containing partial homologous arm sequences near the restriction sites of the broad-host vector pBBR1MCS-5 were designed and synthesized, and annealed under the conditions shown in Table 1 below to form double linkers.

[0034] Table 1: Primer sequences and annealing temperatures

[0035]

[0036] (3) Adding adapters to Mnli enzyme digestion products and amplification

[0037] 5'Mix and 3'Mix adapters were added to the DNA fragments digested by Mnli, and ligation was performed overnight at 4°C using T4 DNA ligase to add adapter sequences to both ends of the Mnli digestion product. The forward primer H1-F (5'-ACTCATTAGGCACCCCAGGC) containing the HindIII restriction site and a partial homologous arm sequence near the corresponding pBBR1MCS-5 restriction site was then used. AAGCTT GTC-3') and the reverse primer X1-R (5'-GAATATGGCTCAT) containing the XbaI restriction site and a partial homologous arm sequence near the corresponding pBBR1MCS-5 restriction site. TCTAGA The ligation product (GCATCATGGTGAGT-3') was amplified using conventional PCR methods with an appropriate amount of Mnli enzyme digestion products and adapters. The PCR product was then recovered and purified using a DNA product purification kit, resulting in a genomic DNA library with adapters.

[0038] 2. Interaction between genomic DNA library and pollution stress response proteins

[0039] (1) Microbial response to environmental pollution stress

[0040] Inoculate *Sphingobium xenophagum* C1 into 5 mL of LB medium and incubate overnight at 30°C. Inoculate the overnight culture at a 1% inoculation rate into six fresh 100 mL flasks of LB medium and incubate at 30°C until the bacterial OD reaches 100%. 600 ≈0.4~0.6. Collect bacterial cells by centrifugation at room temperature using an inorganic salt buffer (containing 2.0g Na2HPO4·12H2O, 0.7g KH2PO4, 0.5g NH4Cl, 0.3g NaCl, 0.1g MgSO4·7H2O, 0.05g CaSO4·2H2O, 0.2mg FeCl3·6H2O, 0.2mg NaMoO4, 0.2mg MnCl2·4H2O, 0.2mg CuCl2·2H2O, 0.2mg ZnSO4, 0.3mg H3BO3, and 0.3mg CoCl2·6H2O per liter). 0.4 mg of peptone, 0.2 g / L of yeast extract, and water as the solvent; the preparation method is to dissolve each component in water and sterilize. After washing the bacterial cells twice, they were finally resuspended in the same volume of inorganic salt buffer. Three bottles of culture medium were respectively added to the target environmental pollutant, and the other three bottles of culture medium served as blank controls. All culture flasks were placed on a shaker and incubated at 30°C for a certain period of time.

[0041] (2) Extraction of proteins responding to environmental pollution stress

[0042] Collect 100 mL of bacterial cells by centrifugation at room temperature. Wash the cells twice with inorganic salt buffer, then add 2–4 mL of cell lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 0.25% Triton X-100, pH 8.0). Add lysozyme to a final concentration of 0.5 mg / mL, add protease inhibitor, and lyse at room temperature for approximately 30 min. Then centrifuge the cell lysis buffer at 8500 × g for 5–10 min at 4 °C and collect the supernatant, which is the environmental pollution stress response protein mixture.

[0043] (3) Protein-DNA interaction and separation of bound DNA fragments

[0044] The 2 mL of response protein mixture extracted in step 2 (2) was digested with 25 μL (about 15 μg) extracted in step 1 (3) and then combined with the genomic DNA library of the adapter. The mixture was incubated at room temperature for about 30 min in binding buffer (20 mM Hepes, 10 mM ammonium sulfate, 10 mM KCl, 0.2% Tween-20, 1 mM DTT, pH 7.6).

[0045] Transfer the protein-DNA binding mixture to a nitrocellulose membrane filter column that has been pre-washed with binding buffer and incubate on ice for approximately 20 min. Then centrifuge at 6000×g for 2 min at 4°C and discard the eluent. Add 2 mL of pre-chilled wash buffer (100 mM Tris-HCl, 2.5 mM EDTA·2Na, 0.1% Tween-20, pH 7.6) to wash away unbound DNA fragments. Centrifuge at 6000×g for 2 min at 4°C and discard the eluent. Repeat this washing process four times. Finally, elute the responsive protein-bound DNA fragments from the nitrocellulose membrane column using elution buffer (0.5% SDS). Purify the eluted DNA fragments using a DNA product purification kit to obtain the DNA fragments bound to the environmental pollution stress response protein.

[0046] 3. High-throughput sequencing of DNA fragments bound to proteins responding to environmental pollution stress

[0047] (1) Modification of the broad-host vector pBBR1MCS-5

[0048] DNA from the pET24a plasmid was extracted using a plasmid extraction kit. Primers Kana-R (5'-AAATATTAACGCCTCGAGTTAGAAAAACTCATCGAGC-3') and Kana-F (5'-CATTAGGCACCCCAGGCAAGCTTGTCGACGGAGCTCGAATTCGGATCCTCTAGAGA AGATCCTTTGATC-3') were used to amplify the kanamycin resistance gene encoding sequence and the multiple cloning site sequence using conventional PCR methods with pET24a plasmid DNA as a template. Primers Primer4 (5'-GCCTGGGGTGCCTAATGAGTGAGCTAACTC-3') and pBBR-F (5'-CTCGAGGCGTTAATATTTTGTTAAAATTCGCG-3') were used to reverse amplify the pBBR1MCS-5 plasmid DNA using conventional PCR methods to obtain a linearized vector. The kanamycin resistance gene fragment and the linearized pBBR1MCS-5 plasmid fragment were recovered and purified using a purification kit. The pBBR1MCS-5 plasmid DNA and the kanamycin resistance gene fragment were ligated using recombinase, and the mixture was heat-transformed into *E. coli* DH5α competent cells. Positive clones were selected using 50 mg / L gentamicin resistance screening. DNA from the positive clones was picked for PCR amplification and sequencing verification of the kanamycin resistance gene fragment, yielding a successfully modified pBBR1MCS-5 recombinant plasmid containing a multiple cloning site and a promoter, named pBBR1MCS-Km1.

[0049] Using primers Kana-R (base sequence as above) and Kana-F2 (5'-CGAATTCGGATCCTCTAGAATGAGCCATATTCAACGG-3'), pET24a plasmid DNA was used as a template to amplify the kanamycin resistance gene encoding DNA sequence without the promoter sequence using conventional PCR methods. The pBBR1MCS-Km1 plasmid was digested with restriction endonucleases XbaI and XhoI at 37°C for 30 min. The kanamycin resistance gene fragment and the restriction-digested pBBR1MCS-Km1 plasmid fragment were then purified using a purification and recovery kit. The pBBR1MCS-Km1 plasmid and kanamycin resistance gene fragment were ligated using recombinase, and the resulting fragment was heat-transformed into *E. coli* DH5α competent cells. Positive clones were selected using 50 mg / L gentamicin resistance screening. DNA from positive clones was selected for PCR amplification and sequencing verification of the kanamycin resistance gene. The resulting pBBR1MCS-5 recombinant plasmid, which was successfully modified to have an insertion site for multiple cloning and no promoter, was named pBBR1MCS-Km2.

[0050] (2) Enzymatic digestion preparation of modified vectors and homologous recombination with DNA fragments

[0051] DNA from the recombinant plasmid pBBR1MCS-Km2 was extracted using a plasmid extraction kit. The DNA was digested with restriction endonucleases HindIII and XbaI at 37°C to obtain a linearized vector. The pBBR1MCS-Km2 plasmid DNA was ligated with a DNA fragment binding to an environmental pollution stress response protein using recombinase, and then heat-transformed into *E. coli* DH5α competent cells. Positive clones were selected for resistance with 50 mg / L gentamicin. All positive clones were simultaneously inoculated into LB medium containing 50 mg / L gentamicin and cultured overnight at 37°C. DNA from the recombinant plasmid was extracted using a plasmid extraction kit, and the recombinant plasmid was electroporated (2200 V, 25 μF, 200 Ω, 1 mm) into *Sphingobium xenophagum* C1 competent cells. Selection was performed using dual resistance with 50 mg / L gentamicin and 50 mg / L kanamycin.

[0052] (3) High-throughput sequencing of recombinant plasmids containing DNA fragments that bind to environmental pollution stress response proteins

[0053] All positive clones on the double-antibiotic plates were inoculated into LB cultures containing 50 mg / L gentamicin and 50 mg / L kanamycin and cultured overnight at 30°C. Whole-genome DNA was extracted from the double-antibiotic recombinant plasmid strain using a bacterial genome extraction kit and sent to Guangdong Meggene Technology Co., Ltd. High-throughput sequencing primers were used for PCR amplification and high-throughput sequencing of the DNA fragments binding to environmental pollution stress response proteins in the recombinant plasmid. The amplification primers used for high-throughput sequencing were: Barcode X(5'- NNNNNNNNNNNN The specific barcode X primer sequences are shown in Table 2 below: ACTCATTAGGCACCCCAGGC-3') and X1-R(5'-GAATATGGCTCATTCTAGAGCATCATGGTGAGT-3').

[0054] Table 2: Barcode X primer sequences used in high-throughput sequencing

[0055] Primer name Sequence (5' - 3') Barcode 1 AGCTGTCGGTAAACTCATTAGGCACCCCAGGC Barcode 2 GCAAAGGTCACTACTCATTAGGCACCCCAGGC Barcode 3 CTTAGAATCCGAACTCATTAGGCACCCCAGGC Barcode 4 GTCCGTACCTTGACTCATTAGGCACCCCAGGC Barcode 5 AACGCATGAGGAACTCATTAGGCACCCCAGGC Barcode 6 CTGTTGACTGACACTCATTAGGCACCCCAGGC

[0056] The optimized screening and identification technology for molecular elements in microbial responses to environmental pollution stress, as described in this invention, represents a significant improvement over the original patented technology in terms of cost, time consumption, versatility, and data acquisition. First, the screening marker has been changed from luciferase activity detection to antibiotic resistance screening, greatly reducing the expensive cost of using substrate luciferase for signal detection. Second, the screening process has been changed to two rounds of antibiotic resistance screening, significantly reducing false negatives caused by the previous single-round antibiotic resistance screening and the substantial workload of random strain selection for verification. Third, the manipulation vector has been changed from pACYC-Luc to the broad-host vector pBBR1MCS-5, which can adapt to most host strains except *E. coli*, providing greater versatility in screening molecular elements of environmental strains. Finally, high-throughput DNA sequencing analysis by merging all positive clones significantly reduces the workload and greatly increases the amount of data acquired compared to the previous method of random strain selection for verification. The optimized screening and identification technology workflow is described below. Figure 1 As shown.

[0057] Example 2: High-throughput mining and analysis of molecular elements in microbial response to TBBPA pollution stress.

[0058] 1. Construction of genomic DNA library

[0059] The above operation is the same as in Example 1.

[0060] 2. Interaction between genomic DNA library and TBBPA-responsive protein

[0061] (1) Microbial response to TBBPA stress

[0062] Inoculate *Sphingobium xenophagum* C1 into 5 mL of LB medium and incubate overnight at 30°C. Inoculate the overnight culture at a 1% inoculation rate into six fresh 100 mL flasks of LB medium and incubate at 30°C until the bacterial OD reaches 100%. 600 ≈0.4~0.6. Collect bacterial cells by centrifugation at room temperature, wash twice with inorganic salt buffer, and finally resuspend in the same volume of inorganic salt buffer. Add 10 μL of TBBPA stock solution (200 mg / mL) dissolved in 1 mol / L NaOH to three of the culture bottles to bring the final TBBPA concentration to 10 mg / L. The other three culture bottles serve as blank controls. Incubate all culture bottles on a shaker at 30°C for approximately 16 hours.

[0063] (2) Extraction of TBBPA stress response proteins

[0064] The above operation is the same as in Example 1.

[0065] (3) Protein-DNA interaction and separation of bound DNA fragments

[0066] The above operation is the same as in Example 1.

[0067] 3. High-throughput sequencing of DNA fragments bound to TBBPA stress-response proteins.

[0068] The above operation is the same as in Example 1.

[0069] 4. Comparative analysis of high-throughput sequencing data

[0070] The raw data from functional element amplicon sequencing were processed using Cutadapt (V3.4 with Python 3.8.3) (Martin, 2011. CUTADAPT removes adapter sequences from high-throughput sequencing reads. EMBnet journal.) to remove the barcode X primer fragments from the paired-end sequences based on the sequences of the amplification primers used in high-throughput sequencing. Low-quality sequences were then removed using Fastp (V0.21.0, parameters -W 4–M 20). Finally, the paired-end data were spliced ​​using vsearch–fastq_mergepairs (V2.19.0) (Rognes et al., 2016. VSEARCH: an aversatile open source tool for metagenomics. Peerj 4.) to obtain CleanTags. Based on dada2 (Callahan et al., 2017. Exact sequence variants should replace operational taxonomic units in marker-gene data analysis. ISME J 11(12), 2639-2643.; Callahan et al., 2016. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13(7), 581-583.), Clean Tags were quickly filtered and denoised to obtain amplicon sequence variants (ASVs) with 100% similarity, and the sequence abundance was statistically analyzed. Analysis showed that a total of 573+790 ASVs were detected in the TBBPA stress response treatment group and the non-stress response control group. Among them, 77+125 ASVs were upregulated (log2FC>1) under TBBPA stress response conditions compared to the non-stress response conditions, while 129+167 ASVs were downregulated (log2FC<1). Figure 2 Among them, ASV86 showed the greatest difference in induction under TBBPA stress response conditions compared to non-stress response conditions, with a log2FC of 7.69, while it was not detected under TBBPA non-stress response conditions; while ASV76 showed the greatest difference in induction under significant deregulation, with a log2FC of -4.70.

[0071] By comparing different ASV sequences with the whole genome of *Sphingobium xenophagum* C1 in the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi), the gene locations and gene cluster structures of different ASVs were identified. Promoter sequences in the gene cluster structures were predicted using the BPROM module of the Softberry website (http: / / www.softberry.com / berry.phtml?topic=bprom&group=programs&subgroup=gfindb). Comparative analysis revealed that most of the significantly different ASVs matched functional genes such as efflux protein gene clusters, transcription regulatory factors and their structural genes, oxidoreductase gene clusters, and DNA synthesis / replication / recombination / repair systems. Information on important functional gene clusters significantly induced in the TBBPA pollution stress response group was provided. Figure 3 As shown.

[0072] A typical representative of the efflux protein gene cluster is ASV86 (log2FC = 7.69), which belongs to the chr1_115~chr1_119 gene cluster, namely acrR (chr1_119, sequence as shown in SEQ ID NO.1), acrA (chr1_118, sequence as shown in SEQ ID NO.2), acrB (chr1_117, sequence as shown in SEQ ID NO.3), tolC (chr1_116, sequence as shown in SEQ ID NO.4) and adaB (chr1_115, sequence as shown in SEQ ID NO.5). AcrR, belonging to the TetR family of transcriptional regulators, possesses a conserved triple-helix N-terminal DNA-binding domain and a diverse C-terminal ligand-binding domain. It plays a central role in regulating the expression of the AcrAB-TolC efflux pump. However, little is known about the inducing ligands for AcrR activity; only ethidium bromide, proflavin, and polyamines (putrescine, cadaverine, and spermine) have been identified. The chr1_119–chr1_115 gene cluster discovered in this invention likely plays a crucial role in the efflux transport of TBBPA, and TBBPA may be a novel inducing ligand for AcrR activity. The chr1_119–chr1_115 gene cluster may enhance the strain's tolerance to TBBPA contamination stress. Furthermore, upstream of the chr1_119–chr1_115 gene cluster are molybdate transport system-related genes fabG (chr1_114, sequence shown in SEQ ID NO. 6), modC (chr1_113, sequence shown in SEQ ID NO. 7), and modB (chr1_112, sequence shown in SEQ ID NO. 8), which may also play a role in TBBPA membrane transport. Another phosphate / sulfate transport system gene cluster, chr1_1648–chr1_1650, is located at the ASV71 (log2FC = 4.88) location and is also significantly upregulated by TBBPA. These genes are pitA (chr1_1648, sequence shown in SEQ ID NO. 9), ykaA (chr1_1649, sequence shown in SEQ ID NO. 10), and lysR (chr1_1650, sequence shown in SEQ ID NO. 11). These results suggest that inorganic salt transport systems may also play an important role in the efflux or uptake of TBBPA.

[0073] ASV48 (log2FC = 5.76) is located in the chr1_709–chr1_713 gene cluster. chr1_709 is the gstA gene (chr1_709, sequence shown in SEQ ID NO. 12), which encodes glutathione S-transferase, participating in cellular detoxification by catalyzing the covalent binding of glutathione to a wide range of endogenous and exogenous toxins and oxidative stress products. Furthermore, the lpd gene (chr1_2603, sequence shown in SEQ ID NO. 13), which encodes glutathione disulfide reductase, was also significantly upregulated, indicating that glutathione detoxification likely participates in the cellular response to TBBPA toxicity. In addition, the chr1_710–chr1_713 gene clusters are nrdA (chr1_710, sequence as shown in SEQ ID NO.14), the hypothetical protein gene hp1 (chr1_711, sequence as shown in SEQ ID NO.15), nrdB (chr1_712, sequence as shown in SEQ ID NO.16), and ulaG (chr1_713, sequence as shown in SEQ ID NO.17), which are involved in DNA replication / recombination / repair and may be related to the toxic response of microorganisms induced by TBBPA. ASV76 (log2FC = -4.70) is located in the chr1_1993–chr1_1995 gene cluster, which are nlpD (chr1_1993, sequence as shown in SEQ ID NO.18), iscA (chr1_1994, sequence as shown in SEQ ID NO.19), and xthA (chr1_1995, sequence as shown in SEQ ID NO.20), which are genes. It is involved in cell wall / cell membrane synthesis, Fe-S cluster biosynthesis, and exonuclease-mediated DNA replication / recombination / repair processes, and may also be related to TBBPA-induced toxic responses in microorganisms.

[0074] The downstream operons chr1_2604–chr1_2605 of the glutathione disulfide reductase lpd gene (chr1_2603, sequence shown in SEQ ID NO.13) were also significantly upregulated. Chr1_2604 (sequence shown in SEQ ID NO.21) possesses a conserved COG4340 domain, encoding a ketoglutarate / Fe-dependent dioxygenase, which likely has oxidative degradation function against TBBPA. Chr1_2605 (sequence shown in SEQ ID NO.22) possesses a conserved COG3800 domain, encoding a xenobiotic-responsive transcription factor, which likely directly binds to TBBPA and responds to its pollution stress. ASV121 (log2FC = 5.37) is located in the p2_166-p2_168 gene cluster, encoding the hypothetical proteins hp2 (p2_166, sequence shown in SEQ ID NO. 23) and hp3 (p2_168, sequence shown in SEQ ID NO. 24) as well as the mucR transcriptional regulator (p2_167, sequence shown in SEQ ID NO. 25), the specific functions of which are not yet clear.

[0075] The above results indicate that the microbial response to TBBPA pollution stress is a complex process involving several important biochemical processes and molecular elements, including TBBPA efflux or uptake, TBBPA toxicity response, non-specific detoxification of TBBPA, specific degradation of TBBPA, and some functional processes that are not yet fully understood.

[0076] Example 3: Construction of a TBBPA-tolerant artificial cell system based on efflux protein pump elements.

[0077] Sphingobium xenophagum C1, a heterotrophic sphingotroph, was inoculated into 5 mL of LB medium and cultured overnight at 30°C. The cells were collected by centrifugation at room temperature. The whole-genome DNA of strain C1 was extracted using a bacterial genomic extraction kit. Using this DNA as a template, the DNA sequence containing the AcrAB-TolC-AdaB efflux protein pump chr1_118–chr1_115 gene cluster was amplified by conventional PCR using primers 86-F3 (5'-AAACTAGTGGATCCTAGACATTTTCTCTCTTGAATTC-3') and 86-R3 (5'-TCACCATGAATTCTGTTCCCAAAACCTGC-3'). (Sequences shown in SEQ ID NO. 2–NO. 5). Plasmid DNA was extracted from the broad-host vector pBBR1MCS-5. The pBBR1MCS-5 plasmid DNA was digested with BamHI and EcoRI restriction endonucleases at 37°C. The digested plasmid fragments were then purified using a purification kit. The chr1_118–chr1_115 gene fragment was ligated into the linearized pBBR1MCS-5 vector using recombinase, and then transformed into *E. coli* DH5α competent cells by heat shock. Positive clones were selected by 50 mg / L gentamicin resistance. DNA from positive clones was picked for PCR amplification and sequencing verification of the chr1_118–chr1_115 gene fragment, yielding the successfully ligated recombinant plasmid pBBR-118-115. The recombinant plasmid pBBR-118-115 was transformed into C1 competent cells by electroporation, and positive clones were selected by 50 mg / L gentamicin resistance. DNA from positive clones was picked for PCR amplification and verification of the chr1_118–chr1_115 gene fragment. Finally, chassis cell C1 (pBBR-118-115) containing multiple copies of the pBBR-118-115 vector was obtained.

[0078] C1 (pBBR-118-115) chassis cells were inoculated into LB liquid medium containing 50 mg / L gentamicin and cultured overnight at 30°C. The overnight culture was then inoculated at a rate of 1% into fresh LB medium containing 50 mg / L gentamicin and cultured at 30°C until the cell OD reached its maximum. 600 ≈0.4. Collect bacterial cells by centrifugation at room temperature, wash the cells twice with inorganic salt buffer, and then resuspend the cells in the same volume of inorganic salt buffer to allow the bacterial cells to reach an OD value of 0.4. 600 The concentration was approximately 0.4. Gentamicin (50 mg / L), glucose (5 g / L), and different concentrations of TBBPA (0, 5.0, 10.0, 15.0, 20.0, 25.0, 50.0, 75.0, and 100.0 mg / L) were added. The mixture was incubated at 30°C for 38 hours, and the OD of the bacterial cells was measured at half-hour intervals.600 value.

[0079] The test results showed that increasing the copy number of the AcrAB-TolC efflux protein pump in the heterotrophic sphingobium xenophagum C1 strain could improve the strain's tolerance to TBBPA contamination stress. Under the tested TBBPA concentrations, the multicopy C1 (pBBR-118-115) strain achieved higher biomass than the control strain C1 (pBBR), specifically 4.21% (0 mg / L), 22.14% (5.0 mg / L), 22.32% (10.0 mg / L), 28.66% (15.0 mg / L), 31.60% (20.0 mg / L), 28.51% (25.0 mg / L), 17.41% (50.0 mg / L), 18.15% (75.0 mg / L), and 13.24% (100.0 mg / L). Figure 4 As TBBPA concentration increased, the degree of biomass increase among strains began to decrease, indicating that the AcrAB-TolC efflux protein pump conferred a certain range of TBBPA concentration tolerance to the strains. These results also confirm the hypothesis mentioned in Example 2 that the AcrAB-TolC efflux protein pump chr1_118~chr1_115 gene cluster (sequences shown in SEQ ID NO.2~NO.5) elements can enhance the strains' tolerance to TBBPA pollution stress. Furthermore, this provides novel, highly tolerant molecular elements for the development of biotechnology for monitoring and controlling high concentrations of TBBPA in the environment.

[0080] Example 4: Construction of a TBBPA-degrading artificial cell system based on dioxygenase elements.

[0081] The molecular element of the ketoglutarate / Fe-dependent dioxygenase chr1_2604 (sequence shown in SEQ ID NO.21) was optimized to match the codon usage frequency in *E. coli*. The codon-optimized chr1_2604 molecular element was synthesized using a gene synthesis method, and NdeI and XhoI restriction sites were designed at both ends of the optimized gene fragment. DNA was extracted from the *E. coli* expression vector pET30b, and the gene fragment and pET30b plasmid DNA were treated with NdeI and XhoI restriction endonucleases at 37°C. The digested gene fragment and plasmid fragment were purified using a purification kit. The gene fragment was ligated to the linearized vector using recombinase, and the cells were heat-transformed into *E. coli* BL21(ED3) competent cells. Positive clones were selected by 50 mg / L kanamycin resistance. DNA from positive clones was selected for PCR amplification and sequencing verification of the chr1_2604 gene fragment, and finally, E. coli BL21(DE3, pET30b-2604) chassis cells expressing the recombinant plasmid were successfully obtained.

[0082] E. coli BL21(DE3, pET30b-2604) basal cells were inoculated into LB broth containing 50 mg / L kanamycin and cultured overnight at 37°C. The overnight culture was then inoculated at a rate of 1% into fresh LB broth containing 50 mg / L kanamycin and cultured at 37°C until the cell OD reached 0.5%. 600 ≈0.8. Add 1 mM isopropyl-β-D-thiogalactoside (IPTG) and induce culture at 37℃ for 3 h. Collect bacterial cells by centrifugation at room temperature, wash twice with inorganic salt buffer, and resuspend the cells in the same volume of inorganic salt buffer. Add 50 mg / L kanamycin, 1.0 mM IPTG, 0.06 mg / L α-ketoglutarate, 0.05 mg / L FeSO4, and 2.0–3.0 mg / L TBBPA, and culture at 37℃ for 120 h. At each set time point, remove 3 vials of culture medium and freeze at -80℃. Then, freeze-dry the sample vials. Add 4 mL of methanol and recovery indicator BBPA-F (0.5 mg / L) to the dried sample and perform multiple freeze-thaw extractions. Finally, filter through a 0.45 μm filter membrane, and analyze the TBBPA concentration using HPLC.

[0083] The test results showed that efficient degradation of TBBPA was achieved by inducing a large amount of expression and early accumulation of the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in E. coli BL21(DE3, pET30b-2604) cells. At 3 days, the degradation rate of 2.0 mg / L TBBPA in E. coli BL21(DE3, pET30b-2604) cells reached 44.41%. The TBBPA loss rates in different control groups (without E. coli BL21(DE3, pET30b-2604), without IPTG induction, with IPTG induction but without FeSO4, and with IPTG induction but without ketoglutarate) were 3.97%, 9.88%, 14.29%, and 17.93%, respectively. Figure 5 These results indicate that the induced expression and early accumulation of the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 protein in chassis cells demonstrates a strong oxidative degradation capacity for TBBPA. This also confirms the hypothesis mentioned in Example 2 that the ketoglutarate / Fe-dependent dioxygenase Chr1_2604 (sequence shown in SEQ ID NO.21) element has an oxidative degradation function for TBBPA. Furthermore, it provides a novel molecular element for the development of bioremediation technologies for TBBPA pollution in the environment.

[0084] Example 5: Construction of TBBPA pollution monitoring sensor cells based on xenobiotic-responsive transcription factor elements.

[0085] A fusion gene fragment, including the upstream promoter sequence of the chr1_2605 gene (5′-TTCCCGCGATTGCGATTTTTCGCAAATGTAAATT-3′), was synthesized by adding the coding sequence for the small subunit of firefly luciferase to the 3′ end of the xenobiotic-responsive transcription factor chr1_2605. BamHI and XhoI restriction sites were designed at both ends of the fusion gene fragment. DNA was extracted from the broad-host vector pBBR1MCS-5, and the fusion gene fragment and pBBR1MCS-5 plasmid DNA were treated with BamHI and XhoI restriction endonucleases at 37°C. The digested fusion gene fragment and plasmid fragment were then purified using a purification kit. The fusion gene fragment was ligated to a linearized vector using recombinase, and the resulting fragment was transformed into *E. coli* DH5α competent cells by heat shock. Positive clones were selected using 50 mg / L gentamicin. DNA from positive clones was picked for PCR amplification and sequencing verification of the chr1_2605 fusion gene fragment, yielding the successfully ligated recombinant plasmid pBBR-2605-HiBiT. The recombinant plasmid pBBR-2605 was then transformed into competent C1 cells by electroporation, and positive clones were selected using 50 mg / L gentamicin. DNA from positive clones was picked for PCR amplification and verification of the chr1_2605 fusion gene fragment. Finally, chassis cells C1 containing the pBBR-2605-HiBiT fluorescent reporter vector were obtained (pBBR-2605-HiBiT).

[0086] C1 (pBBR-2605-HiBiT) chassis cells were inoculated into LB liquid medium containing 50 mg / L gentamicin and cultured overnight at 30°C. The cells were collected by centrifugation at room temperature, washed twice with inorganic salt buffer, and then resuspended in a specific volume of inorganic salt buffer to allow the cells to reach OD500. 600≈1.0. Different concentrations of fluorinated compounds were added to brown glass bottles: perfluorohexyl sulfonic acid (0, 1.25, 2.5, 5.0, 10.0 μM), perfluorooctyl sulfonic acid (0, 1.25, 2.5, 5.0 μM), and perfluorooctane sulfonic acid (0, 1.25, 2.5, 5.0 μM); chlorinated compounds: trichlorfon (0, 1.25, 2.5, 5.0, 10.0 μM), pentachlorophenol (0, 0.05, 0.1, 0.2, 0.3 μM), and hexachlorobutadiene (0...). The following solutions were prepared: 0.5, 1.0, 2.0, 4.0 μM 0, 1.25, 2.5, 5.0, 10.0 μM bromine derivatives: tetrabromobisphenol A (0, 0.01, 0.05, 0.125, 0.25, 0.50, 1.25, 3.0, 5.0, 7.0, 8.0, 10.0 μM), decabromodiphenyl ether (0, 1.25, 2.5, 5.0 μM), inorganic salt buffer, 50 mg / L gentamicin, and 5 g / L glucose. The washed and resuspended C1 (pBBR-2605-HiBiT) chassis cell suspension was inoculated at a 2% inoculation rate and cultured in a shaker at 30°C until the cell OD reached 0.5%. 600 ≈0.4. A portion of the cell culture medium from the chassis was taken out for biomass analysis to ensure that the biomass concentration of each sample was basically consistent. 100 μL of cell culture medium from the chassis was taken out, and 100 μL of intracellular lysis buffer (containing lysis buffer, firefly luciferase large subunit LgBiT and luciferase luminescent substrate furimazine, Promega) was added. Luciferase activity was analyzed on a chemiluminescence analyzer.

[0087] Analysis of luciferase activity in sensor cells under different pollutant stresses showed that C1 (pBBR-2605-HiBiT) chassis cells did not show a significant response to fluorinated compounds (perfluorohexyl sulfonate, perfluorooctyl sulfonate, perfluorooctane sulfonate), chlorinated compounds (trichlorfon, pentachlorophenol, hexachlorobutadiene, decachlorobiphenyl), or decabromodiphenyl ether among the brominated compounds. They only exhibited responsive fluorescence activity to TBBPA pollution stress. Figure 6In the experimentally tested concentrations of TBBPA, the highest luciferase signal was induced by 7.0 μM TBBPA pollution stress. As the TBBPA concentration increased above 7.0 μM, the luciferase signal decreased slowly rather than abruptly, indicating that high concentrations of TBBPA affected the enzyme activity of chassis cells but were not lethal. The detection limit for C1 (pBBR-2605-HiBiT) sensor cells at the experimentally tested concentrations of TBBPA ranged from 0.01 to 0.05 μM, approximately 5.43 to 27.19 μg / L. These results also confirm the hypothesis mentioned in Example 2 that the xenobiotic-responsive transcription factor chr1_2605 (sequence shown in SEQ ID NO. 22) element responds to TBBPA pollution stress, and also provide a novel molecular element for the development of biomonitoring technologies for TBBPA pollution in the environment.

[0088] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be considered as limitations on the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. For those skilled in the art, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Xenobiotic-responsive transcription factors chr1_2605 Application in monitoring TBBPA contamination, the aforementioned xenobiotic-responsive transcription factor chr1_2605 The nucleotide sequence is shown in SEQ ID NO.22.

Images