PCR (Polymerase Chain Reaction) kit and method for identifying brucella pathogen and application

Abstract

The invention relates to a PCR (Polymerase Chain Reaction) kit and method for identifying brucella pathogens and application. The PCR kit comprises primer pairs and probes for simultaneously detecting brucella BA0711 vaccine strains, M5-9026 vaccine strains, Rev.1 vaccine strains and wild strains. A primer pair for detecting the brucella BA0711 vaccine strain is shown as SEQ ID NO.1-2, and a probe is shown as SEQ ID NO.3; a primer pair for detecting the M5-9026 vaccine strain is shown as SEQ ID NO.4-5, and a probe is shown as SEQ ID NO.6; a primer pair for detecting the Rev.1 vaccine strain is shown as SEQ ID NO.7-8, and a probe is shown as SEQ ID NO.9; a primer pair for detecting positive brucella is shown as SEQ ID NO.10-11, and a probe is shown as SEQ ID NO.12; the kit has the advantages of high sensitivity and strong specificity, and can simultaneously distinguish a plurality of vaccine strains and wild strains.

Description

Technical Field

[0001] The invention belongs to the technical field of animal disease pathogen detection, and specifically relates to a PCR kit, method and application for identifying Brucella pathogens. Background Art

[0002] Brucellosis is caused by Brucella Brucella Brucellosis is an important zoonosis caused by brucellosis, which is listed as a legally notifiable disease by the World Organization for Animal Health (WOAH) and is also a major animal disease that is given priority in prevention and control in my country. Brucella can infect humans, a variety of domestic animals and wild animals, causing similar clinical symptoms and pathological damage, such as fever, abortion, infertility, chronic arthritis and nerve damage. Due to the widespread prevalence of the disease, it seriously endangers the development of animal husbandry and poses a threat to human health. Therefore, it is of great significance to carry out laboratory diagnosis research on brucellosis.

[0003] Brucella is a Gram-negative facultative anaerobic bacterium that can be divided into smooth type (S) and rough type (R) according to its phenotype. Currently, the genus Brucella can be divided into 9 classical species and 21 biological subtypes according to the host preference of the bacteria, mainly Brucella melitensis ( Brucella melitensis ), Brucella bovis ( Brucella abortus ), Brucella suis ( Brucella suis ), Brucella epididymis Brucella ovis ), Brucella canis ( Brucella canis ), Brucella sarcoma ( Brucella neotomae ), Pinniped Brucella ( Brucella pinnipediae ) and Brucella cetacea ( Brucella cetaceae ) etc. Among them, the sheep species Brucella is the smallest, and very few are in chain or short rod shape. The bacteria have no flagella, do not form spores, have no external toxicity, and parasitize in cells; virulent strains have very thin capsules. In order to protect sheep from Brucella infection, the sheep can be vaccinated. Currently, the vaccine strains that can be used are BA0711 vaccine strain, M5-90△26 vaccine strain, and Rev.1 vaccine strain.

[0004] Vaccine strains are pathogens that have been specifically treated to stimulate the body's immune system to produce antibodies, thereby achieving the purpose of preventing disease. Wild strains are naturally occurring pathogens that are infectious and pathogenic. By detecting and distinguishing between vaccine strains and wild strains, it can help determine whether the vaccine strain has been successfully administered or has produced adverse reactions. At the same time, by analyzing the prevalence of vaccine strains and wild strains, it can reveal the spread of the disease and the difficulties in prevention and control.

[0005] Serological methods are currently the main method for diagnosing animal brucellosis. They are mainly based on the detection of antibodies against Brucella lipopolysaccharide (LPS), but cannot distinguish between natural infection and vaccine immunity. Pathogenic nucleic acid detection of clinical samples is an effective method for rapid diagnosis of epidemic diseases. Through comparative genomics, we can obtain information on the differences between wild strains and vaccine strains of Brucella, obtain differential diagnostic markers, and make it possible to distinguish natural infection from vaccine immunity from a pathogenic perspective.

[0006] Real-time fluorescence quantitative PCR is a method that uses changes in fluorescence signals to detect changes in the amount of amplification products in each cycle of PCR amplification in real time and perform quantitative analysis. This technology uses specific probes to identify quantitative molecules and has high accuracy. It also has the advantages of high sensitivity, fast detection speed, and high throughput. This method is mature and widely used in disease diagnosis.

[0007] In recent years, many real-time fluorescence quantitative detection methods have been developed. Some people use DNA binding dyes, such as SYBR green I or EvaGereen, which are relatively simple and cheap, but non-specific amplification may occur, resulting in false positives. Summary of the invention

[0008] The technical problem to be solved by the present invention is to provide a PCR kit, method and application for identifying Brucella pathogens, which has high sensitivity and strong specificity and can simultaneously distinguish multiple vaccine strains and wild strains.

[0009] The embodiment of the present invention provides a PCR kit for identifying Brucella pathogens, including primer pairs and probes for simultaneously detecting Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and Brucella positive; The primer pair for detecting Brucella BA0711 vaccine strain is SEQ ID NO.1-2, and the probe is SEQ ID NO.3; The primer pair for detecting Brucella M5-90△26 vaccine strain is SEQ ID NO.4-5, and the probe is SEQ ID NO.6; The primer pair for detecting Brucella Rev.1 vaccine strain is SEQ ID NO.7-8, and the probe is SEQ ID NO.9; The primer pair for detecting Brucella positive is SEQ ID NO.10-11, and the probe is SEQ ID NO.12.

[0010] Optionally, the 5' end of the probe for detecting Brucella BA0711 vaccine strain is labeled with a FAM reporter fluorescent group.

[0011] Optionally, the 5' end of the probe for detecting Brucella M5-90Δ26 vaccine strain is labeled with a HEX reporter fluorescent group.

[0012] Optionally, the 5' end of the probe for detecting Brucella Rev.1 vaccine strain is labeled with a Cy5 reporter fluorescent group.

[0013] Optionally, the 5' end of the Brucella-positive probe is labeled with a ROX reporter fluorescent group.

[0014] The 3' end of the probe is labeled with a BHQ1 or BHQ2 quenching fluorescent group.

[0015] Optionally, an amplification solution is also included, wherein the amplification solution includes 2 μL of hot start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, and 13 μL of Oligo Mix.

[0016] The embodiment of the present invention provides a method for identifying Brucella pathogens, which comprises extracting nucleic acid from a sample to be detected, using a PCR kit for identifying Brucella pathogens as described in any one of claims 1 to 6, performing real-time fluorescence quantitative PCR detection after expansion, collecting fluorescence signal data, and judging whether the sample to be detected contains Brucella pathogens according to the fluorescence signal data. If the sample contains Brucella pathogens, judging whether it is one or more of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain, and wild strain.

[0017] Optionally, the detection program of real-time fluorescence quantitative PCR detection is: 95°C pre-denaturation for 2 min, 95°C denaturation for 15 s, 60°C annealing for 30 s, 40 cycles, and collecting fluorescence signal data after each cycle.

[0018] The embodiment of the present invention provides an application of the PCR kit for identifying Brucella pathogens, and the PCR kit for identifying Brucella pathogens is used to identify Brucella pathogens.

[0019] The beneficial effect of the present invention is that, in view of the fact that the current traditional serological methods cannot distinguish between vaccine immunity and natural infection, the quadruple fluorescent PCR detection reagent of the present invention can quickly identify and distinguish between BA0711 vaccine strain, M5-90△26 vaccine strain, and Rev.1 vaccine strain immunity and natural infection. It is simple to use and has a short detection time, which can greatly improve the detection efficiency, while also saving detection costs and solving the limitations of single reactions. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 These are the test results of different primer-probe combinations for the BA0711 vaccine strain.

[0021] Figure 2These are the repeatability and gradient test results of the fluorescent PCR detection method for the BA0711 vaccine strain.

[0022] Figure 3 These are the test results of different primer-probe combinations for the M5-90△26 vaccine strain.

[0023] Figure 4 These are the repeatability and gradient test results of the fluorescence PCR detection method for the M5-90△26 vaccine strain.

[0024] Figure 5 The results of the sensitivity, repeatability and gradient test of different primer-probe pairs in the fluorescent PCR detection method of Rev.1 vaccine strain are compared.

[0025] Figure 6 These are the repeatability and gradient test results (FAM channel) of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple detection fluorescence PCR detection method.

[0026] Figure 7 These are the repeatability and gradient test results (HEX channel) of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple detection fluorescent PCR detection method.

[0027] Figure 8 These are the repeatability and gradient test results (CY5 channel) of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple detection fluorescence PCR detection method.

[0028] Fig. 9 These are the repeatability and gradient test results (ROX channel) of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple detection fluorescence PCR detection method. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with specific embodiments, as follows.

[0030] Example 1: Establishment of a fluorescent quantitative PCR method for identifying and detecting the BA0711 vaccine strain 1. Materials and Methods 1.1 Materials Brucellosis live vaccine (BA0711 strain), Jinhe Youben Biological Products Co., Ltd.; Brucella gene-deficient live vaccine (M5-90△26 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.; Brucellosis live vaccine (Rev.1 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd.

[0031] 1.2 Instruments Instruments and reagents: Fluorescence quantitative PCR instrument, Shanghai Hongshi Medical Technology Co., Ltd.; desktop high-speed centrifuge, Sangon Biotechnology (Shanghai) Co., Ltd.; automatic nucleic acid extraction and purification instrument, Hunan Guoce Biotechnology Co., Ltd.; magnetic bead-based viral nucleic acid extraction kit, Hunan Guoce Biotechnology Co., Ltd.

[0032] 1.3 Extraction of strain nucleic acid, the specific extraction method is as follows: Use the magnetic bead-based viral DNA / RNA efficient extraction kit (prepackaged) produced by Hunan Guoce Biotechnology Co., Ltd. The operation is as follows: take out the prepackaged deep-well plate, invert and mix to resuspend the magnetic beads, gently shake the well plate to concentrate the reagents at the bottom of the well plate, and carefully tear off the aluminum foil sealing film before use to avoid vibration of the well plate and prevent liquid splashing. Add 20μL proteinase K and 200μL sample (the sample needs to be balanced to room temperature) to the second column of the nucleic acid extraction reagent, place it on the base of the nucleic acid extraction instrument based on the magnetic bead adsorption principle, and insert the magnetic rod sleeve into the instrument magnetic rod sleeve holder card slot. Select the running program provided by the manufacturer and run it. After the automation program ends, remove the nucleic acid in the eluate to obtain the sample nucleic acid.

[0033] 1.4 Selection of primers and probes The BA0711 vaccine strain was compared and analyzed with other strains through DNAMAN software to find the deletion / addition fragments unique to the BA0711 vaccine strain. Then the specific fragment was compared with other strains in NCBI to determine the deletion sequence unique to the BA0711 vaccine strain, and specific primer pairs and probes were designed for this.

[0034] The unique deletion sequence of the BA0711 vaccine strain is: GGTCAAATTCTTCAACACCGAAAAAGGTTTCGG TTTCATCAAGCCCGATGATGGCGGCGCGGACATCTTCGTGCATATTTCTGCAGTTCAGGCTTCTGGCCTGCCAGGCCTTGCTGACAATCAGAAGGTTTCCTATGAAACGGAACCAGATCGTCGTGGAAAAGGCCCCAAGGCCGTGAACATCACCATTACCGGCTGA (SEQ ID NO. 13).

[0035] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows: The sequence of the upstream primer BF is: 5'-GCTCCGATCCTTTGTTTTGAC-3' (SEQ ID NO.1), The sequence of the upstream primer B-F2 is: 5'-CCTCTGTCGGGTGTGTGGTGC-3' (SEQ ID NO. 14), The downstream primer BR sequence is: 5'-GAAACCGGACAAGCTTCGTAA-3' (SEQ ID NO. 2), The sequence of downstream primer B-R2 is: 5'-TCTTACGAAGCTTGTCCGGTC-3' (SEQ ID NO.15), The sequence of downstream primer B-R3 is: 5'-GGACAAGCTTCGTAAGAAATGC-3 (SEQ ID NO.16), The sequence of probe B-Probe is: 5'-AACCGTTTCACACTTTTCGGGATGC-3' (SEQ ID NO. 3), The sequence of probe B-Probe2 is: 5'-ACAGGAGATGTAATTCCGCCGATTT-3' (SEQ ID NO. 17), The 5' ends of the probes B-Probe and B-Probe2 are labeled with a FAM reporter fluorescent group, and the 3' ends are labeled with a BHQ1 quencher fluorescent group.

[0036] 1.5 Optimal reaction conditions The optimal amplification system is 50μL: 2μL hot start Taq enzyme, 25μL 2×Probe qPCR Buffer, 13μL Oligo Mix, and the amount of extracted nucleic acid is 10μL.

[0037] Optimal reaction program: After placing the eight-tube strip into the real-time fluorescence quantitative PCR instrument, set the following program for the reaction: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, 40 cycles, and collect FAM channel fluorescence signal data after each cycle.

[0038] 1.6 Results If the Ct value of the FAM channel is ≤35 and the amplification curve is a typical S-type, it is judged as positive for the BA0711 vaccine strain; If 35<FAM channel Ct value≤40 or does not show a typical S-shape, retest is required; If, during retesting, 35 < FAM channel Ct value ≤ 40, then the corresponding result should be determined as positive for BA0711 vaccine strain; If there is no Ct value, it should be judged as negative.

[0039] 1.7 Specificity test of fluorescence PCR detection method for BA0711 vaccine strain The upstream primer, downstream primer and probe described above are used in combination, and the usage schemes are: Scheme 1: upstream primer BF, downstream primer BR, probe B-Probe; Scheme 2: upstream primer B-F2, downstream primer B-R2, probe B-Probe2; Scheme 3: upstream primer BF, downstream primer B-R3, probe B-Probe.

[0040] The extracted nucleic acids of BA0711 vaccine strain, M5-90△26 vaccine strain, and Rev.1 vaccine strain were added to the reaction system. Each nucleic acid sample was repeated in triplicate and tested under the above optimal reaction conditions. The results are as follows: Figure 1 .

[0041] Based on the results, the most preferred option is scheme 1: upstream primer BF, downstream primer BR, and probe B-Probe.

[0042] 1.8 Repeatability and gradient test of fluorescence PCR detection method for BA0711 vaccine strain The extracted nucleic acid was diluted in a gradient manner, and each gradient sample was repeated three times. The test was performed according to the above optimal reaction conditions. The results are as follows: Figure 2 and Table 1; the coefficient of variation CV of each gradient was about 1%, and the repeatability and gradient were good.

[0043] Table 1 Repeatability of fluorescence PCR detection method for BA0711 vaccine strain and test results of gradient test

[0044] Example 2: Establishment of a fluorescent quantitative PCR method for identifying and detecting the M5-90Δ26 vaccine strain 2. Materials and Methods 2.1 Materials Brucella gene-deficient live vaccine (M5-90△26 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd. Brucellosis live vaccine (BA0711 strain), Jinhe Youben Biological Products Co., Ltd. Brucellosis live vaccine (Rev.1 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd. 2.2 Instrument (same as Example 1) 2.3 Extraction of nucleic acid from strains (same as in Example 1) 2.4 Selection of primers and probes Search for the Bp26 gene information of the M5-90 strain in NCBI. The M5-90△26 vaccine strain is the M5-90 strain lacking the Bp26 gene. Design specific primers and probes based on this information.

[0045] The M5-90△26 vaccine strain lacks the Bp26 gene, but has a unique sequence added: GGTACCATGATTGAACA (SEQ ID NO.22).

[0046] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows: The sequence of the upstream primer MF was: 5′-CGTTGTCACTGAAGCGGGAA-3′ (SEQ ID NO. 4); The sequence of the upstream primer M-F2 was: 5′-TATGACGCCCTTTGCCACCTGAT-3′ (SEQ ID NO. 18); The sequence of the downstream primer MR is: 5′-GGCAGGAGCAAGGTGAGATG-3′ (SEQ ID NO. 5); The sequence of the downstream primer M-R2 was: 5′-GCGGATTCAATCAGATCGAAA-3′ (SEQ ID NO. 19); The sequence of the probe M-Probe is: 5′-TGGCTGCTATTGGGCGAAGTGC-3′ (SEQ ID NO. 6); The sequence of probe M-Probe2 is: 5'-TATGACGCCCTTTGCCACCTGAT-3' (SEQ ID NO. 20).

[0047] The 5' ends of the probes M-Probe and M-Probe2 are labeled with a HEX reporter fluorescent group, and the 3' ends are labeled with a BHQ1 quencher fluorescent group.

[0048] 2.5 Optimal reaction conditions The optimal amplification system is 50μL: 2μL hot start Taq enzyme, 25μL 2×Probe qPCR Buffer, 13μL Oligo Mix, and the amount of extracted nucleic acid is 10μL.

[0049] Optimal reaction program: After placing the eight-tube strip into the real-time fluorescence quantitative PCR instrument, set the following program for the reaction: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, 40 cycles, and collect HEX channel fluorescence signal data after each cycle.

[0050] 2.6 Results If the Ct value of the HEX channel is ≤35 and the amplification curve is a typical S-type, it is determined to be positive for the M5-90△26 vaccine strain; If 35<HEX channel Ct value≤40 or does not show a typical S-shape, retest is required; If, during retesting, 35 < HEX channel Ct value ≤ 40, then the corresponding M5-90△26 vaccine strain should be determined to be positive; If there is no Ct value, it should be judged as negative.

[0051] 2.7 Specificity test of fluorescence PCR detection method for M5-90△26 vaccine strain The upstream primer, downstream primer and probe described above are used in combination, and the usage schemes are: Scheme 1: upstream primer MF, downstream primer MR, probe M-Probe; Scheme 2: upstream primer M-F2, downstream primer M-R2, probe M-Probe2.

[0052] The extracted nucleic acids of BA0711 vaccine strain, M5-90△26 vaccine strain, and Rev.1 vaccine strain were added to the reaction system. Each nucleic acid sample was repeated in triplicate and tested under the above optimal reaction conditions. The results are as follows: Figure 3 .

[0053] Based on the results, the most preferred option is scheme 1: upstream primer MF, downstream primer MR, and probe M-Probe.

[0054] 2.8 Repeatability and gradient test of fluorescence PCR detection method for M5-90△26 vaccine strain The extracted nucleic acid was diluted in a gradient manner, and each gradient sample was repeated three times. The test was performed according to the above optimal reaction conditions. The results are as follows: Figure 4 and Table 2; the coefficient of variation CV of each gradient was about 1%, and the repeatability and gradient were good.

[0055] Table 2 Repeatability and gradient test results of fluorescence PCR detection method for M5-90△26 vaccine strain

[0056] Example 3: Establishment of a fluorescent quantitative PCR method for identifying and detecting Rev.1 vaccine strains 3. Materials and Methods 3.1 Materials Brucellosis live vaccine (Rev.1 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd. 3.2 Instruments (same as in Example 1) 3.3 Extraction of nucleic acid from strains (same as in Example 1) 3.4 Selection of primers and probes The Rev.1 vaccine strain was compared and analyzed with other strains using DNAMAN software to find the deletion / addition fragments unique to the Rev.1 vaccine strain. The specific fragments were then compared with other strains in NCBI to determine the deletion / addition sequences unique to the Rev.1 vaccine strain, and specific primer pairs and probes were designed accordingly.

[0057] By comparing the gene sequence of the Rev.1 vaccine strain, it was found that it contained a specific repeating sequence: CCGGTGGCGGGG CTGGTGGTTCTGGCGGGGCTGGTGGTTCTGGTG (SEQ ID NO. 23).

[0058] The primers include an upstream primer, a downstream primer and a probe, and their sequences are as follows: The upstream primer RF sequence was: 5′-ACTTGTCCAGTACATCGTCCTTT-3′ (SEQ ID NO. 7); The sequence of the downstream primer RR was: 5′-CCGATGCGAACTTTCAAGCT-3′ (SEQ ID NO. 8); The sequence of the probe R-Probe is: 5′-CTGGTGGTTCTGGCGGGGCT-3′ (SEQ ID NO. 9); The sequence of probe R-Probe2 is: 5'-AGCCCCGCCAGAACCACCA-3' (SEQ ID NO. 21).

[0059] The 5' ends of the probes R-Probe and R-Probe2 are labeled with a CY5 reporter fluorescent group, and the 3' ends are labeled with a BHQ2 quencher fluorescent group.

[0060] 3.5 Optimal reaction conditions The optimal amplification system is 50μL: 2μL hot start Taq enzyme, 25μL 2×Probe qPCR Buffer, 13μL Oligo Mix, and the amount of extracted nucleic acid is 10μL.

[0061] Optimal reaction program: After placing the eight-tube strip into the real-time fluorescence quantitative PCR instrument, set the following program for the reaction: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, 40 cycles, and collect the Cy5 channel fluorescence signal data after each cycle.

[0062] 3.6 Results If the Ct value of the Cy5 channel is ≤35 and the amplification curve is a typical S-type, it is determined to be positive for the Rev.1 vaccine strain; If 35<Cy5 channel Ct value≤40 or does not show a typical S-shape, retest is required; If, during retesting, 35 < Cy5 channel Ct value ≤ 40, then the corresponding Rev.1 vaccine strain should be determined to be positive; If there is no Ct value, it should be judged as negative.

[0063] 3.7 Sensitivity test, repeatability and gradient test of the fluorescent PCR detection method for Rev.1 vaccine strain The upstream primer, downstream primer and probe described above are used in combination, and the usage schemes are: Scheme 1: upstream primer RF, downstream primer RR, probe R-Probe; Scheme 2: upstream primer RF, downstream primer RR, probe R-Probe2.

[0064] The extracted nucleic acid was diluted in a gradient manner, and each gradient sample was repeated three times. The test was performed according to the above optimal reaction conditions. The results are as follows: Figure 5 Compared with Table 3, from the results, the most preferred scheme is scheme 1: upstream primer RF, downstream primer RR, probe R-Probe, and the coefficient of variation CV of each gradient is about 1%, and the repeatability and gradient are good.

[0065] Table 3 Repeatability of the fluorescent PCR detection method for Rev.1 vaccine strain and the test results of the gradient test

[0066] Example 4: Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal four-joint detection fluorescence quantitative PCR method establishment 4. Materials and Methods 4.1 Materials Brucellosis live vaccine (BA0711 strain), Jinhe Youben Biological Products Co., Ltd. Brucella gene-deficient live vaccine (M5-90△26 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd. Brucellosis live vaccine (Rev.1 strain), Jinyu Baoling Biological Pharmaceutical Co., Ltd. 4.2 Instruments (same as in Example 1) 4.3 Extraction of nucleic acid from strains (same as in Example 1) 4.4 Selection of primers and probes DNAMAN software was used to compare and analyze Brucella 16M with BA0711 vaccine strain, M5-90△26 vaccine strain, and Rev.1 vaccine strain to find highly conserved gene sequences. The fragment was then compared with other strains in NCBI to determine that the gene sequence was unique to Brucella strains, and a universal Brucella primer pair and probe were designed based on this.

[0067] The primers include an upstream primer WF and a downstream primer WR, and the probe is W-Probe. The sequence of the upstream primer WF is: 5'-GGTTGCCAATATCAATGCGA-3' (SEQ ID NO.10); the sequence of the downstream primer WR is: 5'-GTCTGCGACCGATTTGATGTTT-3' (SEQ ID NO.11), and the sequence of the probe W-Probe is: 5'-AGTCCGGCTTTACGCAGTCAGACGTT-3' (SEQ ID NO.12). Preferably, the 5' end of the probe W-Probe is labeled with a ROX reporter fluorescent group, and the 3' end is labeled with a BHQ2 quencher fluorescent group.

[0068] 4.5 Optimal reaction conditions The optimal amplification system is 50μL: 2μL hot start Taq enzyme, 25μL 2×Probe qPCR Buffer, 13μL Oligo Mix, and the amount of extracted nucleic acid is 10μL.

[0069] Optimal reaction program: After placing the eight-tube strip into the real-time fluorescence quantitative PCR instrument, set the following program for the reaction: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and 40 cycles. After each cycle, collect the fluorescence signal data of the FAM, HEX, ROX, and Cy5 channels.

[0070] 4.6 Results 4.6.1 If the Ct value of the ROX channel is ≤35 and the amplification curve is a typical S-type, it is judged as Brucella positive; if the Ct value of the ROX channel is 35<ROX channel≤40, it is judged as suspicious; if there is no Ct value displayed in the ROX channel, it is judged as Brucella negative.

[0071] 4.6.2 On the premise of being judged as Brucella positive, if the Ct value of the FAM channel is ≤35 and the amplification curve is a typical S-type, it is judged as BA0711 vaccine strain positive; 35<FAM channel Ct value≤40, it is judged as suspicious; if there is no Ct value displayed in the FAM channel, it is judged as BA0711 vaccine strain negative.

[0072] 4.6.3 On the premise of being judged as Brucella positive, if the HEX channel Ct value ≤35 and the amplification curve is a typical S-type, it is judged as M5-90△26 vaccine strain positive; 35<HEX channel Ct value ≤40, it is judged as suspicious; if no Ct value is displayed on the HEX channel, it is judged as M5-90△26 vaccine strain negative.

[0073] 4.6.4 On the premise of being judged as Brucella positive, if the Cy5 channel Ct value is ≤35 and the amplification curve is a typical S-type, it is judged as Rev.1 vaccine strain positive; if 35<Cy5 channel Ct value≤40, it is judged as suspicious; if there is no Ct value displayed in the Cy5 channel, it is judged as Rev.1 vaccine strain negative.

[0074] 4.6.5 If the initial test result is judged as suspicious, a repeated test should be performed. If no Ct value is displayed, the pathogen nucleic acid corresponding to the channel is judged to be negative, otherwise it is judged to be positive.

[0075] 4.7 Repeatability and gradient test of Brucella fluorescence PCR quadruple detection method The extracted nucleic acid was diluted in a gradient manner, and each gradient sample was repeated three times. The test was performed according to the above optimal reaction conditions. The results are as follows: Figure 6-9Compared with Table 4-7, the coefficient of variation (CV) of each gradient was about 1%, and the repeatability and gradient were good.

[0076] Table 4 Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple detection fluorescence PCR detection FAM channel detection results

[0077] Table 5 Results of the HEX channel of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple fluorescence PCR detection

[0078] Table 6 Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple test fluorescence PCR detection Cy5 channel detection results

[0079] Table 7 Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and universal quadruple test fluorescence PCR detection ROX channel detection results

[0080] A person skilled in the art should understand that the discussion of any of the above embodiments is merely illustrative and is not intended to imply that the scope of protection of the present application is limited to these examples. In line with the concept of the present application, the technical features in the above embodiments or different embodiments may be combined, the steps may be implemented in any order, and there are many other variations of different aspects of one or more embodiments of the present application as described above, which are not provided in detail for the sake of simplicity.

[0081] One or more embodiments of the present application are intended to cover all such substitutions, modifications and variations that fall within the broad scope of the present application. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of one or more embodiments of the present application should be included in the protection scope of the present application.

Claims

1. A PCR kit for identifying Brucella pathogens, characterized in that: Includes primer pairs and probes for simultaneously detecting Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain and wild strain; The primer pair for detecting Brucella BA0711 vaccine strain is SEQ ID NO.1-2, and the probe is SEQ ID NO.3; The primer pair for detecting Brucella M5-90△26 vaccine strain is SEQ ID NO.4-5, and the probe is SEQ ID NO.6; The primer pair for detecting Brucella Rev.1 vaccine strain is SEQ ID NO.7-8, and the probe is SEQ ID NO.9; The primer pair for detecting Brucella positive is SEQ ID NO.10-11, and the probe is SEQ ID NO.

12.

2. The PCR test kit for identifying the Brucella pathogen as claimed in claim 1, characterized in that, The 5' end of the probe for detecting Brucella BA0711 vaccine strain is labeled with a FAM reporter fluorescent group.

3. The PCR test kit for identifying the Brucella pathogen as claimed in claim 1, characterized in that, The 5' end of the probe for detecting Brucella M5-90△26 vaccine strain is labeled with a HEX reporter fluorescent group.

4. The PCR test kit for identifying the Brucella pathogen as claimed in claim 1, characterized in that, The 5' end of the probe for detecting Brucella Rev.1 vaccine strain is labeled with a Cy5 reporter fluorescent group.

5. The PCR test kit for identifying the Brucella pathogen as claimed in claim 1, characterized in that, The 5' end of the probe for detecting Brucella positivity is labeled with a ROX reporter fluorescent group.

6. The PCR test kit for identifying the Brucella pathogen as claimed in claim 1, characterized in that, The method also includes an amplification solution, which includes 2 μL of hot start Taq enzyme, 25 μL of 2×Probe qPCR Buffer, and 13 μL of Oligo Mix.

7. A method for identifying the pathogen of Brucella, characterized in that: Extract nucleic acid from the sample to be detected, use the PCR kit for identifying Brucella pathogens as described in any one of claims 1-6, perform real-time fluorescence quantitative PCR detection, collect fluorescence signal data, and determine whether the sample to be detected contains Brucella pathogens according to the fluorescence signal data. If the sample contains Brucella pathogens, determine whether it is one or more of Brucella BA0711 vaccine strain, M5-90△26 vaccine strain, Rev.1 vaccine strain, and wild strain.

8. The method for differentiating the Brucella pathogen as claimed in claim 7, wherein: The detection procedure of real-time fluorescence quantitative PCR detection was as follows: pre-denaturation at 95°C for 2 min, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, 40 cycles, and fluorescence signal data were collected after each cycle.

9. An application of a PCR kit for identifying Brucella pathogens as described in any one of claims 1-6, characterized in that, The PCR kit for identifying Brucella pathogens is used for identifying Brucella pathogens.

Images