Identification method of Brucella BA0711 vaccine strain and wild strain and application of Brucella BA0711 vaccine strain and wild strain

Abstract

The invention provides a method for identifying a Brucella BA0711 vaccine strain and a wild strain, and in the method, a specific detection target gene for identifying the Brucella BA0711 vaccine strain is located in a 400 bp sequence as shown in SEQ ID NO. 7, and specific detection target genes for identifying other Brucella strains are located in a 606 bp sequence as shown in SEQ ID NO. 8. The invention also provides an application of the identification method, and a kit for detecting a vaccine strain and a wild strain of Brucella BA0711. The research aims at a Brucella BA0711 vaccine strain, and a specific molecular marker gene capable of regionally distributing the Brucella BA0711 vaccine strain and a wild strain is screened out. A specific primer and a probe are designed based on the marker gene. The method is a qPCR detection method capable of accurately identifying the brucella BA0711 vaccine strain, the brucella wild strain and mixed infection of the brucella BA0711 vaccine strain and the brucella wild strain. The method can solve the problem of lack of a rapid identification tool in production practice, and provides technical support for infection monitoring and precise purification of vaccine-immunized livestock groups.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a quantitative detection method for Brucella BA0711 vaccine strain and wild-type strain. Background Technology

[0002] Brucellosis is a disease caused by bacteria of the genus Brucella (Brucella). Brucella Brucellosis is a zoonotic infectious disease caused by Brucella bacteria. This disease not only seriously affects the quality and safety of livestock products but also causes significant economic losses and poses a continuous threat to public health. Brucella is mainly transmitted through the respiratory tract, digestive tract, reproductive tract, skin, and mucous membranes. Humans can become infected with brucellosis through direct contact with the blood and tissues of infected animals, consumption of uncooked or unpasteurized dairy products, and inhalation of aerosols. Livestock infected with Brucella experience a significant decline in reproductive capacity and production performance. Common symptoms in female animals include abortion, infertility, retained placenta, weak pups, or stillbirths. Male animals often exhibit reproductive system lesions such as orchitis and epididymitis. The typical symptom of brucellosis in humans is intermittent fever. Chronic brucellosis can cause multi-system damage, manifesting as arthritis, orchitis, and hepatitis.

[0003] The primary source of human brucellosis infection is infected animals. Currently, my country adopts a regional and categorized strategy for the prevention and control of brucellosis in livestock, implementing a combination of mandatory immunization and quarantine measures in severely affected areas. However, this strategy has significant limitations: existing serological diagnostic methods for brucellosis cannot distinguish between vaccine-immunized antibodies and wild-type virus infection antibodies, making it difficult to accurately identify and eliminate wild-type Brucella-infected animals in immunized herds. Infected individuals can persist for a long time, continuously threatening human and animal health.

[0004] To address the lack of diagnostic methods for Brucella, several domestic teams have dedicated themselves to the research and development of Brucella gene-marker vaccines and supporting diagnostic methods. However, due to the lengthy development, validation, and approval process for new vaccines, traditional Brucella vaccines remain the mainstream product in China. In 2023, the Ministry of Agriculture and Rural Affairs approved Brucella live vaccines (strain BA0711) and (Rev.1) as new veterinary drugs. Strain BA0711 was developed from Brucella ovis biotype 3. Among all currently registered Brucella live vaccines, only strains BA0711 and S2 are suitable for use in pregnant animals. Therefore, developing efficient diagnostic methods for current mainstream vaccines in my country, especially strain BA0711 which is suitable for pregnant animals and cattle / sheep, is of great significance. Summary of the Invention

[0005] In view of the shortcomings of the existing technology, the first objective of this invention is to propose a method for distinguishing Brucella BA0711 vaccine strain from wild-type strain, which can accurately and quantitatively identify Brucella BA0711 vaccine strain.

[0006] A second objective of this invention is to propose the application of the aforementioned identification method.

[0007] A third objective of this invention is to provide a kit for detecting Brucella BA0711 vaccine strain.

[0008] The technical solution for achieving the above-mentioned objective of this invention is as follows: A method for differentiating Brucella BA0711 vaccine strain from wild-type strain, wherein the target gene used to identify Brucella BA0711 vaccine strain is located in a 400 bp sequence as shown in SEQ ID NO. 7.

[0009] The nucleotide sequence of SEQ.ID.NO.7 is as follows: AACGGCGTGCCGGAGCCGCTATAAGTTCCGGGCCAGAGAGTAATCACTGGCAATGATCAGTTCCTTCCCAATGTCGAGAACTGCCTGCATGACCCTCTGTCGGGTGTGTGGTGCGCTCGACAGGAGATGTAATTCCGCCGATTTCTCATGAAGCGGCGGCGCCAAGGAAAAGGAACGGATCCCATGGCACAGACCGGACA AGCTTCGTAAGAAATGCAGATTTCGCCCCCGGCTTCTGCCGGGGTTTTTTATCGCCCGGCATTCAGCCTCGTTTCGCGCACGGATTGTTACATAGGCTGCATGAGAGCGCATCCCGAAAAGTGTGAAACGGTTTTCGGAAAAGATGCGCGTCAAAACAAAGGATCGGAGCTTCAGACTTTCGCCCCCGCCCTTTTCCATT.

[0010] In the identification method, the target gene used to identify Brucella wild-type strains is located in a 606 bp sequence as shown in SEQ ID NO. 8.

[0011] The nucleotide sequence of SEQ.ID.NO.8 is as follows: AACGGCGTGCCGGAGCCGCTATAAGTTCCGGGCCAGAGAGTAATCACTGGCAATGATCAGTTCCTTCCCAATGTCGAGAACTGCCTGCATGACCCTCTGTCGGGTGTGTGGTGCGCTCGACAGGAGATGTAATTCCGCCGATTTCTCATGAAGCGGCGGCGCCAAGGAAAAGGAACGGATCCCATGGCACAGACCGGACAGGTCAAATTCTTCAACACCGAAAAAGGTTTCGGTTTCATCAAGCCCGATGATGGCGGCGCGGACATCTTCGTGCATATTTCTGCAGTTCAGGCTTCTGGCCTGCCAGGCCTTGCTGACAATCAGAAGGTTTCCTATGAAACGGAACCAGATCGTCGTGGAAAAGGCCCCAAGGCCGTGAACATCACCATTACCGGCTGATCGTTTACGTAAGAAATGCAGATTTCGCCCCCGGCTTCTGCCGGGGTTTTTTATCGCCCGGCATTCAGCCTCGTTTCGCGCACGGATTGTTACATAGGCTGCATGAGAGCGCATCCCGAAAAGTGTGAAACGGTTTTCGGAAAAGATGCGCGTCAAAACAAAGGATCGGAGCTTCAGACTTTCGCCCCCGCCCTTTTCCATTGTTCA。

[0012] By comparing SEQ ID NO.7 with SEQ ID NO.8, the 206bp sequence SEQ ID NO.9 specifically deleted in Brucella BA0711 vaccine strain was obtained:

[0013] TAAACGATCAGCCGGTAATGGTGATGTTCACGGCCTTGGGGCCTTTTCCACGACGATCTGGTTCCGTTTCATAGGAAACCTTCTGATTGTCAGCAAGGCCTGGCAGGCCAGAAGCCTGAACTGCAGAAATATGCACGAAGATGTCCGCGCCGCCATCATCGGGCTTGATGAAACCGAAACCTTTTTCGGTGTTGAAGAATTTGACC。

[0014] The nucleotide sequences of the primer combinations used to amplify the molecular markers are SEQ ID NO.1 + SEQ ID NO.2 and / or SEQ ID NO.3 + SEQ ID NO.4.

[0015] The probe in question is a Taq Man probe.

[0016] The probe used in conjunction with the primer combination is 711 and / or N711; The 711 and N711 nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0017] Furthermore, the 5' end of the probe is labeled with a fluorescent group, wherein 711 is labeled with FAM and N711 is labeled with ROX.

[0018] A preferred embodiment of the present invention is that the detection method is a qPCR detection method, and the operation for detecting Brucella BA0711 vaccine strain includes the following steps: Using the genomic DNA of the sample to be tested as a template, qPCR amplification was performed using the primer sets shown in SEQ ID NO.1 + SEQ ID NO.2 and / or SEQ ID NO.3 + SEQ ID NO.4 and the probes shown in 711 and / or N711; The amplification curve, or the amplification curve and Ct value, are used to determine whether the sample to be tested is Brucella BA0711 vaccine strain, Brucella wild-type strain, or a mixed infection of the two.

[0019] More preferably, in the qPCR reaction system, only 711 is used as a probe, then the concentration of the primer shown in SEQ ID NO.1 is 10-20 μM, the concentration of the primer shown in SEQ ID NO.2 is 10-20 μM, and the concentration of the probe shown in 711 is 10-20 μM; Alternatively, in the PCR reaction system, only N711 is used as the probe, the concentration of the primer shown in SEQ ID NO.3 is 10-20 μM, the concentration of the primer shown in SEQ ID NO.4 is 10-20 μM, and the concentration of the probe shown in N711 is 10-20 μM; Alternatively, in the qPCR reaction system, 711 and N711 are used simultaneously as probes, with the concentrations of the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 being 10-20 μM, and the concentrations of the probes shown in SEQ ID NO.4, 711, and N711 being 10-20 μM.

[0020] In the qPCR reaction system, only 711 is used as a probe. If an amplification curve appears, the sample to be tested is Brucella BA0711 vaccine strain. Alternatively, in the qPCR reaction system, only N711 is used as a probe. If an amplification curve appears, the sample to be tested is a wild-type Brucella virus. Alternatively, in the qPCR reaction system, if 711 and N711 are used as probes simultaneously, and only a blue 711 amplification curve appears, the sample to be tested is Brucella BA0711 vaccine strain; if only an orange N711 amplification curve appears, the sample to be tested is Brucella wild-type strain; if both blue 711 and orange N711 amplification curves appear, the sample to be tested contains both Brucella BA0711 vaccine strain and Brucella wild-type strain.

[0021] Among them, Brucella wild-type strains other than Brucella BA0711 vaccine strain include one or more of Brucella mesenteroides 16M, Brucella mesenteroides M28, Brucella bovis 2308, Brucella bovis 9-941, and Brucella suis 1330 (including but not limited to the above strains).

[0022] More preferably, the qPCR reaction program is 95 ℃ for 30 s, 95 ℃ for 5 s, 60 ℃ for 30 s, with the number of cycles set to 40.

[0023] A kit for detecting Brucella BA0711 vaccine strain, comprising a primer combination with nucleotide sequences SEQ ID NO.1 + SEQ ID NO.2 and SEQ ID NO.3 + SEQ ID NO.4, and probes 711 and N711 with nucleotide sequences SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0024] The beneficial effects of this invention are as follows: This study, targeting the domestically developed Brucella BA0711 vaccine strain, used comparative genomics to screen for specific molecular marker genes that can distinguish the Brucella BA0711 vaccine strain from Brucella wild-type strains. Based on these marker genes, specific primers and probes were designed to propose a method for differentiating the Brucella BA0711 vaccine strain from the wild-type strain. This method is a qPCR detection method that can accurately identify the Brucella BA0711 vaccine strain from the wild-type strain and mixed infections of the two. This method can effectively solve the problem of lacking rapid identification tools in production practice and provide technical support for infection monitoring and precise eradication in vaccine-immunized populations.

[0025] This invention provides a novel detection method for the differential diagnosis of Brucella BA0711 vaccine strain, which can accurately distinguish between Brucella BA0711 vaccine strain and Brucella wild-type strain, and can also identify mixed infections of the two. This detection method has high specificity, high sensitivity, and good repeatability, effectively overcoming the shortcomings of existing technologies.

[0026] The qPCR detection method for Brucella BA0711 vaccine strain, established based on the screened deleted gene, offers higher sensitivity. The detection results of this invention are clearly displayed through amplification curves of different colors, effectively improving detection sensitivity. The lowest detection limit of dual qPCR can reach 1×10⁻⁶. 1 copies / μL.

[0027] The method of this invention can intuitively determine positive or negative results through amplification curves and Ct values, making it simpler and more convenient. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in this invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0029] Figure 1 This is a PCR amplification electrophoresis image of the Brucella BA0711 vaccine strain-specific deletion gene in Example 1 of the present invention, where M is DL 2000 DNA Marker, N is negative control, 711-1 is BA0711-1, 711-2 is BA0711-2, N711-1 is Rev.1-1, and N711-2 is Rev.1-2.

[0030] Figure 2 These are PCR amplification electrophoresis images of two recombinant plasmids in Example 1 of this invention, where M is DL 2000 DNA Marker, N is negative control, 1 is pMD 711-1, 2 is pMD 711-2, 3 is pMD N711-1, and 4 is pMD N711-2.

[0031] Figure 3 This is a verification diagram of the identification effect of 711-FAM and N711-ROX in Embodiment 2 of the present invention.

[0032] Figure 4 This is the result of establishing the 711-FAM singlet qPCR standard curve in Example 2 of this invention.

[0033] Figure 5 This is the result of establishing the N711-ROX singlet qPCR standard curve in Example 2 of this invention.

[0034] Figure 6This is the result of the 711-FAM singlet qPCR specificity experiment in Example 2 of this invention. Among them, 1-2 are Brucella BA0711 vaccine strain DNA, 3-5 are negative controls, and 6-12 are experimental groups of Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis.

[0035] Figure 7 This is the result of the N711-ROX singlet qPCR specificity experiment in Example 2 of this invention. Among them, 1-2 are Brucella Rev.1 vaccine strain DNA, 3-5 are negative controls, and 6-12 are experimental groups of Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis DNA.

[0036] Figure 8 This is the result of the 711-FAM singlet qPCR sensitivity experiment in Example 2 of this invention.

[0037] Figure 9 This is the result of the N711-ROX singlet qPCR sensitivity experiment in Example 2 of this invention.

[0038] Figure 10 This is the result of the 711-FAM singlet qPCR repeatability experiment in Example 2 of this invention.

[0039] Figure 11 This is the result of the N711-ROX single qPCR repeatability experiment in Example 2 of this invention.

[0040] Figure 12 This is the result of establishing the dual qPCR standard curve in Example 3 of the present invention. The standard curve on the right is 711-FAM, representing the Brucella BA0711 vaccine strain, and the standard curve on the left is N711-ROX, representing other Brucella strains.

[0041] Figure 13 These are the experimental results of the specificity and identification effect of the dual qPCR in Example 3 of this invention.

[0042] Figure 14 These are the results of the dual qPCR sensitivity experiment in Example 3 of this invention, with concentrations from left to right being 1×10⁻⁶. 5 1×10 4 1×10 3 1×10 2 1×10 1 copies / μL. The blue curve represents the Brucella BA0711 vaccine strain, and the orange curve represents N711-ROX, which represents other Brucella strains.

[0043] Figure 15These are the results of the duplex qPCR repeatability experiment in Example 3 of this invention, with concentrations from left to right being 1×10⁻⁶. 6 1×10 5 1×10 4 copies / μL. The blue curve represents the Brucella BA0711 vaccine strain, and the orange curve represents N711-ROX, which represents other Brucella strains. Detailed Implementation

[0044] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0045] Unless otherwise specified, all technical means used in this instruction manual are known in the art. All raw materials used are commercially available.

[0046] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0047] The genomic DNA of Brucella BA0711 vaccine strain, Brucella Rev.1 vaccine strain, Brucella S2 vaccine strain, Brucella M5-90 vaccine strain, Brucella A19 vaccine strain, as well as the genomic DNA of Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella multocida, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis mentioned in this invention were preserved by the Preventive Veterinary Laboratory of Inner Mongolia Agricultural University.

[0048] Example 1 The whole genome sequences of Brucella BA0711 vaccine strain and Brucella meliogene wild-type strain M28 were compared and analyzed using gene alignment software. Specific deletion sites of Brucella BA0711 vaccine strain were screened out. Primers and probes were designed and optimized based on these sites. After PCR of the target gene, standard positive recombinant plasmids were prepared.

[0049] Specifically, the steps to identify the Brucella BA0711 vaccine strain-specific deletion site are as follows: The complete sequences of chromosomes I and II of the Brucella BA0711 vaccine strain and the complete sequences of chromosomes I and II of the Brucella M28 strain are compared using software, and differentially expressed fragments are screened. These differentially expressed fragments are then subjected to BLAST alignment on the NCBI website. The results show that the Brucella BA0711 vaccine strain has a 206 bp specific deletion compared to the Brucella wild-type strain (this 206 bp is contained within the 606 bp sequence shown in SEQ ID NO. 8). This 206 bp sequence can be obtained by comparing SEQ ID NO. 7 and SEQ ID NO. 8, and this specific deletion fragment covers common Brucella wild-type strains. Because the deletion sequence of the Brucella BA0711 vaccine strain can cover Brucella A19, Brucella Rev.1, Brucella S2, and Brucella M5-90 vaccine strains, the genomic DNA of Brucella A19, Rev.1, S2, and M5-90 vaccine strains is used instead of the genomic DNA of the Brucella wild-type strain in this embodiment of the invention. This specific deletion site can be used as a specific marker sequence for the Brucella BA0711 vaccine strain for subsequent primer and probe design and the establishment of differential diagnostic methods.

[0050] Experimental methods S1 Primer and Probe Design and Screening Based on the specific deletion site of the Brucella BA0711 vaccine strain, primers and probes were designed using Primer Express 3.0 and Oligo 7.0 to effectively distinguish the Brucella BA0711 vaccine strain from the wild-type strain. The synthesis of primers and probes was completed by Shanghai Sangon Biotech Co., Ltd. Three pairs of primers were designed, with product lengths of 180 bp and 145 bp, respectively. The second and third primer pairs showed heterogeneous peaks and low specificity; therefore, the first primer pair was preferred, and its nucleotide sequence is shown below.

[0051] 711 Primer F: 5′-GCTCGACAGGAGATGTAATTCCG-3′ (SEQ ID NO.1); 711 Primer R: 5′-CAGCCTATGTAACAATCCGTGC-3′ (SEQ ID NO.2); N711 primer F: 5′-AACGATCAGCCGGTAATGGT-3′ (SEQ ID NO.3); N711 primer R: 5′-CGCGGACATCTTCGTGCATAT-3′ (SEQ ID NO.4); 711 probe: 5′-FAM-TGGCACAGACCGGACAAGCTTCGT-BHQ1-3′ (SEQ ID NO.5); N711 probe: 5′-ROX-CCTTGGGGCCTTTCCACGACGA-BHQ2-3′-BHQ2 (SEQ ID NO. 6); PCR amplification of the target gene S2 Using genomic DNA from Brucella BA0711 vaccine strain and Brucella Rev.1 vaccine strain as templates, the target gene fragment was amplified using the aforementioned designed specific primers, and its specificity was verified. The PCR amplification conditions were: pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 50 s, annealing at 65 °C for 50 s, extension at 72 °C for 30 s, for 35 cycles, followed by 72 °C for 10 min. Bands of 185 bp and 147 bp were amplified, respectively. After PCR amplification, agarose gel electrophoresis was performed for detection.

[0052] S3 PCR product recovery and ligation of pMD19-T Simple vector The target gene was recovered according to the instructions of the Tiangen Gel Recovery Kit. 4 μL of the recovered gel product and 1 μL of pMD19-T vector were mixed in a 200 μL PCR tube, and 5 μL of Solution I was added. Ligation was performed at 16℃ for 12 h.

[0053] Transformation of S4 recombinant plasmid Twelve hours later, 50 μL of Trans1-T1 competent cells thawed from ice were added to a new 1.5 mL sterile, enzyme-free centrifuge tube. The ligation product was added to the system and incubated on ice for 30 minutes, followed by a 30-second water bath at 42°C, and then an ice bath for 2 minutes. 500 μL of antibiotic-free liquid LB medium was added to the 1.5 mL centrifuge tube, and the cells were incubated at 37°C and 200 rpm for 8 hours. Finally, 100 μL of the culture was evenly spread onto solid LB medium containing Amp in a clean bench and incubated at 37°C and humidified for 16 hours.

[0054] S5 recombinant plasmid PCR identification Single colonies were picked from LB solid medium and inoculated into liquid medium containing 1‰ Amp. The culture was incubated at 37 °C and 200 rpm for 12–16 h. PCR amplification was performed using 3 μL of the bacterial culture as a template, with a negative control included. The length of the PCR product was detected by 1.0% agarose gel electrophoresis.

[0055] S6 recombinant plasmid sequencing Take 2 mL of bacterial culture and extract plasmids according to the instructions of the Axygen plasmid extraction kit. After extraction, take an appropriate amount of recombinant plasmid and send it to BGI for sequencing.

[0056] S7 Determination of plasmid concentration For plasmids with correct sequencing results, the plasmid concentration was measured using a NanoDrop nucleic acid concentration analyzer. The formula is: Copy number = (6.02 × 10⁻⁶) / (6.02 × 10⁻⁶) 23 ×concentration×10 -9 The unit is converted to copies / μL, and the initial concentrations of the two plasmids are adjusted to 1×10⁻⁶. 9 copies / μL.

[0057] Experimental results Detection of Brucella BA0711 vaccine strain-specific gene: The genome sequence of Brucella BA0711 vaccine strain was compared with that of Brucella M28 strain. The comparison results showed that Brucella BA0711 vaccine strain has a specific deletion site of 206 bp. Primers were designed based on this site for PCR amplification, and the results were detected by 1% agarose gel electrophoresis. The results are shown in the figure below. Figure 1 Then, gel recovery and sequencing were performed.

[0058] The results showed that two target bands of 185 bp and 147 bp were successfully amplified using Brucella BA0711 vaccine strain DNA and Brucella Rev.1 vaccine strain DNA as templates, respectively. The PCR amplification products were then sent to BGI for sequencing, and the sequencing results showed that the amplified product sequence was consistent with the target sequence.

[0059] Recombinant plasmid PCR identification: After the target fragment was ligated into the pMD19-T vector, it was transformed into competent cells and cultured on solid medium for 12–16 h. Two single colonies were picked and inoculated into LB liquid medium, cultured for 12–16 h, and then PCR amplified using the bacterial culture as a template. The results were then analyzed by 1% agarose gel electrophoresis and product sequencing. The pMD-711 and pMD-N711 bands amplified 185 bp and 147 bp bands, respectively, which were consistent with the size of the target band. (See attached figures). Figure 2 Sequencing results showed that the amplified product sequence was consistent with the target sequence.

[0060] Recombinant plasmid concentration: The plasmid concentration was measured using a NanoDrop nucleic acid concentration analyzer, according to the formula: Copy number = (6.02 × 10⁻⁶) / (6.02 × 10⁻⁶) 23 ×concentration×10 -9 The units were converted to copies / μL by converting ((cloning vector length + product size)×660】. The results are shown in Table 1.

[0061] Table 1. DNA concentration and copy number of the two recombinant plasmids

[0062] Example 2 The recombinant plasmid prepared in Example 1 was used as a standard positive template for subsequent experiments. To establish two Brucella single-tube qPCR detection methods, the qPCR reaction system needs to be optimized to reduce the mutual interference between primers and probes, so as to obtain a stable and reliable qPCR differential diagnosis method. This lays the foundation for the subsequent realization of single-tube qPCR differential diagnosis of Brucella BA0711 vaccine strain and Brucella wild-type strain.

[0063] Experimental methods Optimization of S1 singlet qPCR reaction conditions The checkerboard method was used to optimize the reaction system. With qPCR reaction conditions and two primer / probe concentrations of 10 μmol / L as fixed conditions, the amounts of probes and upstream / downstream primers added were adjusted for both 711-FAM and N711-ROX qPCR reaction systems. Finally, the Ct values ​​and amplification curves under the same positive template concentration were comprehensively evaluated to determine the most sensitive primer / probe addition amounts, which were then considered the optimal reaction amounts.

[0064] S2 Establishment of two singlet qPCR standard curves The concentrations of recombinant plasmids constructed from the nucleic acid marker sequences of Brucella BA0711 vaccine strain and Brucella Rev.1 vaccine strain were adjusted to 1×10⁻⁶. 9 Copies / μL, diluted proportionally to 1×10 using DNA Dilution Buffer. 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 The sample was prepared in qPCR at a concentration of copies / μL, using the recombinant plasmid as a template. Each dilution was performed in triplicate. The sample type was set to Standard, and the initial dilution concentration was set to 1.00E+04 (corresponding to the template concentration). The optimized reaction system was used for qPCR amplification, resulting in two qPCR amplification curves targeting the 711 and N711 sequences, respectively.

[0065] S3 Single qPCR Specificity Assay Two optimized qPCR reaction conditions were used, with Brucella BA0711 vaccine strain DNA as a positive control, and genomic DNA extracted from Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis as templates for the reaction group, and dd H2O as a negative control group. Each group was set up with 3 replicates to observe whether an amplification curve was generated in the qPCR reaction and to evaluate whether the detection method has specificity.

[0066] S4 Single qPCR Sensitivity Assay The two recombinant plasmids were respectively from 10 5 copies / μL to 10 1 10-fold serial dilutions were performed using copies / μL of the recombinant plasmid. Using the diluted plasmid as a template, three replicates were set up for each concentration gradient in both qPCR reactions. dd H2O was used as a negative control to evaluate the sensitivity of the two qPCR reactions. Conventional PCR was then performed using qPCR primers with the same copy number of the recombinant plasmid as a template to compare the sensitivity of qPCR and conventional PCR.

[0067] S5 Single qPCR Repeatability Experiment The concentration of each recombinant plasmid was selected as 1×10⁻⁶. 6 copies / μL, 1×10 5 copies / μL, 1×10 4 Using copies / μL as the positive template, and with optimized singleton reaction conditions, six replicates were performed for each template concentration. The experiment was repeated after changing to different batches of Premix Ex Taq (Probe qPCR). The coefficient of variation of Ct values ​​within and between groups was calculated to evaluate the repeatability of singleton qPCR.

[0068] Experimental results Optimization results of singlet qPCR reaction conditions: With primer and probe concentrations fixed at 10 μmol / L, the probe addition amount was optimized (1 μL, 0.8 μL, 0.6 μL, 0.4 μL, and 0.2 μL), yielding an optimal probe addition amount of 1.0 μL (i.e., probe concentration of 10 μM) for both 711-FAM and N711-ROX. With the probe addition amount fixed at 1.0 μL, the primer addition amount was optimized (1 μL, 0.8 μL, 0.6 μL, 0.4 μL, and 0.2 μL). Amplification curves showed that the optimal primer addition amount for both 711-FAM and N711-ROX was 1.0 μL (i.e., primer concentration of 10 μM). The final reaction systems for 711-FAM and N711-ROX qPCR experiments are shown in Tables 2 and 3, respectively.

[0069] Table 2. Optimized reaction system for qPCR experiments (711-FAM)

[0070] Table 3. Optimized reaction system for qPCR experiment (N711-ROX)

[0071] Establishment of the standard curve: using 1×10 9 copies / μL, 1×10 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 Using recombinant plasmids pMD-711 and pMD-N711 (copies / μL) as templates, a qPCR standard curve was constructed under optimized reaction conditions. The amplification efficiency of the 711-FAM standard curve was 98.98%. 2 The value was 0.999; the amplification efficiency of the N711-ROX standard curve was 95.14%, and R... 2 The value is 0.998. All values ​​are within the valid range and can be used for subsequent quantitative detection. The standard curve is as follows: Figure 4 , Figure 5 As shown in the figure. The regression equation is shown in Table 4.

[0072] Table 4 Results of the singlet qPCR standard curve

[0073] Specificity test results: qPCR amplification was performed using Rev.1 vaccine strain DNA and DNA from common bacteria such as Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis as templates to verify the specificity of the experiment. The results showed that the 711-FAM group only showed a positive amplification curve when Brucella BA0711 vaccine strain DNA was used as the amplification template; the N711-ROX group showed a positive amplification curve when Brucella Rev.1 vaccine strain was used as the amplification template. Negative controls using both primers and probes did not produce amplification curves, and cross-reactivity was observed with Escherichia coli, Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis. Specificity results are as follows: Figure 6 , Figure 7 As shown.

[0074] Sensitivity test results: Amplification curves of the 711-FAM and N711-ROX groups showed a 1×10⁻⁶ amplification curve. 5 ~1×10 1At copies / μL, each replicate well produced an amplification curve, with 711-FAM at 1×10⁻⁶. 2 All three parallel wells at a template concentration of copies / μL produced valid results. N711-ROX at a concentration of 1×10⁻⁶... 2 Three parallel wells with a template concentration of copies / μL all produced valid results, and the detection limit for both singlet qPCR methods was 1×10⁻⁶. 2 copies / μL. Sensitivity test results are as follows: Figure 8 , Figure 9 As shown.

[0075] Repeatability test results: 711-FAM and N711-ROX primers and probes were used at 1×10⁻⁶ ppm. 6 copies / μL, 1×10 5 copies / μL, 1×10 4 Using recombinant plasmid copies / μL as templates, and repeating experiments with different batches of Premix Ex Taq (Probe qPCR), see [link to relevant documentation]. Figure 10 and Figure 11 The results showed that the coefficient of variation (CV) within both singlet qPCR groups was around 0.5%, and the coefficient of variation between groups was less than 0.5%, indicating good repeatability.

[0076] Table 5. Repeatability test data for two singleton qPCR methods

[0077] Example 3 Both singleton qPCR methods in Example 2 can be used for Brucella detection, and the reaction performance of the two primers and probes used alone has been verified to be good. To achieve differential diagnosis, both probes from Example 2 need to be added to the reaction system simultaneously: 711 probe: 5′-FAM-TGGCACAGACCGGACAAGCTTCGT-BHQ1-3′, and N711 probe: 5′-FAM-CCTTGGGGCCTTTTCCACGACGA-BHQ2-3′. This optimizes the dual qPCR reaction system, reduces interference between primers and probes, and obtains a stable and reliable dual qPCR differential diagnostic method. This allows for the differential diagnosis of Brucella BA0711 vaccine strain and other Brucella strains using single-tube qPCR.

[0078] Experimental methods Optimization of S1 dual qPCR reaction conditions The checkerboard method was used to optimize the reaction system. The qPCR reaction conditions and the concentration of the two primers and probes of 10 μmol / L were fixed. The amounts of upstream and downstream primers and probes added to the two dual qPCR reaction systems, 711-FAM and N711-ROX, were adjusted respectively.

[0079] Establishment of the S2 standard curve The concentrations of both recombinant plasmids were adjusted to 1×10⁻⁶. 9 After mixing in equal proportions (copies / μL), perform serial dilutions of 10-fold each, yielding 1×10⁻⁶ copies / μL. 8 copies / μL, 1×10 7 copies / μL, 1×10 6 copies / μL, 1×10 5 Mixed standard recombinant plasmids of two copies / μL were used as templates. 2 μL of the mixed plasmids were added to each well. dd H2O was used as a negative control. Three replicates were performed for each concentration. The instrument reaction well sample type was set to Standard. The target fragment was amplified and fluorescence signal was detected using the optimized reaction system and reaction program to obtain a double qPCR amplification standard curve.

[0080] S3 Dual qPCR Specificity Assay Two standard positive mixed plasmids were used as the positive control group, and dd H2O was used as the negative control group. Genomic DNA extracted from Brucella Rev.1 vaccine strain, Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis were used as templates. Each template was used in triplicate wells to evaluate the specificity and discrimination effect of the established dual qPCR detection method.

[0081] S4 Dual qPCR Sensitivity Assay Two 1×10 9 Standard positive recombinant plasmids of copies / μL were mixed in equal proportions and serially diluted 10-fold to obtain 1×10⁻⁶ copies / μL. 9 ~1×10 1 Nine concentrations of dual-mixed standard positive plasmids at various concentrations (copies / μL) were used, with 1×10⁻⁶ copies / μL selected from 10-fold serial dilutions. 5 ~1×10 1 Five different concentrations of mixed recombinant plasmids (copies / μL) were used as templates, with three replicate wells for each gradient. A negative control group using dd H2O as a template was added to test the sensitivity of this method.

[0082] S5 Dual qPCR Repeatability Experiment Select 1×10 6copies / μL, 1×10 5 copies / μL, 1×10 4 Two equal-proportion plasmids (copies / μL) were used as templates, and three replicates were performed for each concentration. The experiment was repeated after 7 days, and after 21 days, the experiment was repeated with different batches of PremixEx Taq (Probe qPCR) to evaluate the reproducibility of this method.

[0083] S6 Clinical blood sample dual qPCR differential diagnostic test Prepare 2 mL centrifuge tubes. Take 300 μL of whole sheep blood from 100 samples and lyse the red blood cells according to the instructions of the blood DNA extraction kit using the lysis method. Extract the DNA and finally elute the DNA with 50 μL of elution buffer TE. Use 2 μL as a template for duplex qPCR detection.

[0084] Experimental results Optimization results of dual qPCR reaction conditions: The reaction system was optimized using the checkerboard method. With qPCR reaction conditions and a primer and probe concentration of 10 μmol / L as fixed conditions, the upstream and downstream primers and probe amounts for both 711-FAM and N711-ROX dual qPCR reaction systems were adjusted. The qPCR reaction program was 95 ℃ for 30 s, 95 ℃ for 5 s, and 60 ℃ for 30 s, with a cycle number of 40. The results are shown in Table 6.

[0085] Table 6 Optimization results of the dual qPCR reaction system

[0086] Results of establishing the duplex qPCR standard curve: Using optimized reaction conditions and two different concentrations of mixed plasmids as DNA templates, repeatable experiments were performed to obtain the duplex qPCR standard curve, as shown below. Figure 12 As shown. The standard curve results show that the amplification efficiency E of the 711-FAM standard curve is 97.69%, R... 2 The amplification efficiency E of the N711-ROX standard curve was 95.41%, and the R value was 0.999. 2 The value was 0.999. The duplicate qPCR assay showed high reproducibility and good linearity, making it suitable for subsequent sample identification and analysis. Results are shown in Table 7.

[0087] Table 7 Results of the dual qPCR standard curve

[0088] Results of the duplex qPCR specificity and differential detection experiment: Using a mixed plasmid of two standard positive strains as the positive control and dd H2O as the negative control, duplex qPCR was performed using genomic DNA extracted from Brucella BA0711 vaccine strain, Brucella Rev.1 vaccine strain, Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis as templates. The results showed that Brucella BA0711 vaccine strain DNA... Figure 13 The blue curve shows an amplification curve, indicating that the Brucella Rev.1 vaccine strain is... Figure 13 The orange curve indicates an amplification curve; however, the genomic DNA of Bifidobacterium, Clostridium perfringens, Corynebacterium pyogenes, Pasteurella multocida, Escherichia coli, Salmonella, and Corynebacterium pseudotuberculosis did not show an amplification curve, indicating a negative result. Figure 13 As shown in the figure. The results indicate that this method has good specificity and can distinguish between Brucella BA0711 vaccine strain and Brucella wild-type strain.

[0089] Results of dual qPCR sensitivity assay: The optimized reaction conditions were used to detect a template concentration of 1×10⁻⁶. 5 copies / μL, 1×10 4 copies / μL, 1×10 3 copies / μL, 1×10 2 copies / μL, 1×10 1 The sensitivity of dual qPCR was evaluated using a mixture of copies / μL of recombinant plasmid, and the amplification curves are shown below. Figure 14 As shown in the figure. Experimental results show that the detection limit of 711-FAM and N711-ROX dual qPCR can reach as low as 1×10⁻⁶. 1 The high sensitivity (copies / μL) demonstrates that the established dual qPCR differential diagnostic method meets the requirements for clinical sample testing.

[0090] Results of duplex qPCR repeatability experiments: at a concentration of 1×10⁻⁶... 6 copies / μL, 1×10 5 copies / μL, 1×10 4 Using copies / μL of the recombinant plasmid as a template, repeatable within-group and between-group experiments were performed, with different batches of the reaction enzyme used. See also Figure 15 The experimental results showed that the coefficient of variation (CV) of Ct values ​​within each group was less than 0.5%, and the coefficient of variation (CV) of Ct values ​​between groups was also less than 0.5%, indicating that the dual qPCR detection method established in this study had good repeatability. The results are shown in Table 8.

[0091] Table 8 Results of intra- and inter-group repeatability tests of dual qPCR

[0092] Example 4: Duplex qPCR Differential Diagnostic Experiment of Clinical Blood Samples One hundred clinical sheep blood samples were tested using the dual qPCR detection method established in Example 3. In the qPCR reaction system, 711 and N711 were used as probes simultaneously. If only a blue 711 amplification curve appeared, the sample to be tested was Brucella BA0711 vaccine strain. If only an orange N711 amplification curve appeared, the sample to be tested was Brucella wild-type strain. If both blue 711 and orange N711 amplification curves appeared, the sample to be tested contained both Brucella BA0711 vaccine strain and Brucella wild-type strain.

[0093] This method can effectively distinguish between Brucella BA0711 vaccine strain and Brucella wild-type strain, as well as mixed infections of the two.

[0094] Using the above methods, a total of 2 Brucella-negative samples and 98 Brucella-positive samples were detected out of 100 clinical blood samples. Among them, 17 Brucella BA0711 vaccine-positive samples, 60 wild-type virus-positive samples, and 21 mixed infection samples were detected.

[0095] This invention discovered a specific 206 bp deletion site in the Brucella BA0711 vaccine strain, a site that has not been previously studied or reported. Based on this gene site, specific primers and probes were designed, and by utilizing the more specific TaqMan probe, the identification of Brucella BA0711 vaccine strain, Brucella wild-type strain, and mixed infections of the two was achieved.

[0096] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for differentiating Brucella BA0711 vaccine strain from wild-type strain, characterized in that, In the identification method, the target gene used to identify the Brucella BA0711 vaccine strain is located in the 400 bp sequence shown in SEQ ID NO. 7, and the target gene used to identify the Brucella wild-type strain is located in the 606 bp sequence shown in SEQ ID NO.

8. By comparing SEQ ID NO. 7 and SEQ ID NO. 8, the 206 bp sequence specifically deleted from the Brucella BA0711 vaccine strain, SEQ ID NO. 9, is obtained. In the method for distinguishing Brucella BA0711 vaccine strain from wild-type strain, the nucleotide sequence of the primer combination used to amplify the molecular marker is SEQ ID NO.1 + SEQ ID NO.2 and SEQ ID NO.3 + SEQ ID NO.4, or SEQ ID NO.3 + SEQ ID NO.4, and the probe used in conjunction with the primer combination is 711 and N711, or N711; The 711 and N711 nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively. The 5' end of the probe is labeled with a fluorescent group, wherein 711 is labeled with FAM and N711 is labeled with ROX.

2. The method for identifying Brucella BA0711 vaccine strain and wild-type strain according to claim 1, characterized in that, The identification method is a qPCR detection method, and the operation for detecting and / or identifying Brucella BA0711 vaccine strain and / or wild-type strain includes the following steps: Using the genomic DNA of the sample to be tested as a template, qPCR amplification was performed using the primer set shown in SEQ ID NO.1 + SEQ ID NO.2 and SEQ ID NO.3 + SEQ ID NO.4 and the probes shown in 711 and N711, or using the primer set shown in SEQ ID NO.3 + SEQ ID NO.4 and the probe shown in N711. The amplification curve, or the amplification curve and Ct value, are used to determine whether the sample to be tested is Brucella BA0711 vaccine strain, Brucella wild-type strain, or a mixed infection of the two.

3. The method for identifying Brucella BA0711 vaccine strain and wild-type strain according to claim 2, characterized in that, In the PCR reaction system, only N711 is used as a probe, the concentration of the primer shown in SEQ ID NO.3 is 10-20 μM, the concentration of the primer shown in SEQ ID NO.4 is 10-20 μM, and the concentration of the probe shown in N711 is 10-20 μM. Alternatively, in the qPCR reaction system, 711 and N711 are used simultaneously as probes, with the concentrations of the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 being 10-20 μM, and the concentrations of the probes shown in SEQ ID NO.4, 711, and N711 being 10-20 μM.

4. The method for identifying Brucella BA0711 vaccine strain and wild-type strain according to claim 2, characterized in that, In the qPCR reaction system, only N711 is used as a probe. If an amplification curve appears, the sample to be tested is a wild-type Brucella virus. Alternatively, in the qPCR reaction system, if 711 and N711 are used as probes simultaneously, and only a blue 711 amplification curve appears, the sample to be tested is Brucella BA0711 vaccine strain; if only an orange N711 amplification curve appears, the sample to be tested is Brucella wild-type strain; if both blue 711 and orange N711 amplification curves appear, the sample to be tested contains both Brucella BA0711 vaccine strain and Brucella wild-type strain.

5. The method for identifying Brucella BA0711 vaccine strain and wild-type strain according to any one of claims 2 to 4, wherein the qPCR reaction program is 95 ℃ for 30 s, 95 ℃ for 5 s, 60 ℃ for 30 s, with a cycle number of 40.

6. The application of the identification method according to any one of claims 1 to 5 in the detection of Brucella BA0711 vaccine strain and wild-type strain.

7. A kit for identifying and detecting Brucella BA0711 vaccine strain and wild-type strain, characterized in that, It contains primer combinations with nucleotide sequences SEQ ID NO.1 + SEQ ID NO.2 and SEQ ID NO.3 + SEQ ID NO.4, and probes 711 and N711 with nucleotide sequences SEQ ID NO.5 and SEQ ID NO.6, respectively.

Images