SNP locus and KASP primer group for identification or auxiliary identification of clematis maple and application of SNP locus and KASP primer group

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site and a KASP primer group for identifying or assisting in identifying clematis maple and application of the SNP site and the KASP primer group. The SNP site is located at the 2688th site of SEQ ID No.1 (sequence identifier number 1). The KASP primer group is composed of single-stranded DNA (deoxyribonucleic acid) as shown in SEQ ID No. 2, SEQ ID No. 3 and SEQ ID No. 4. The method comprises the following steps: carrying out next-generation sequencing and assembling on clematis maple for the first time, taking formed ultra-long scaffold as a reference genome ultra-long fragment, carrying out simplified genome sequencing on 15 clematis plants, and comparing the simplified genome sequencing with the reference genome ultra-long fragment to obtain difference sites, finally, the KASP molecular marker CA24547 is developed on the basis of the difference sites, and the KASP molecular marker CA24547 is verified. The KASP molecular marker developed by the invention can realize accurate identification of the clematis nepalensis in the seedling stage, and has important significance for protecting the clematis nepalensis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a SNP site for identifying or assisting in identifying Clematis glabra, a KASP primer set and an application thereof. Background Art

[0002] There are many plants in the genus Clematis, among which Clematis acerifolia Maxim. is a very distinctive one. It is a small plant with elegant flowers. It blooms on the cliffs of Fangshan and Mentougou in Beijing every April, creating a unique and beautiful landscape. As a unique germplasm resource in my country, Clematis acerifolia has high ornamental value, a narrow distribution area, and a small population. It has been listed as a national second-level key protected plant and is also an extremely rare ornamental plant in early spring.

[0003] KASP (competitive allele-specific PCR) is an allele typing technology with the characteristics of high accuracy, low cost and convenient operation. As a SNP (single nucleotide polymorphism) typing method, KASP-SNP markers are widely used in species identification and classification with good application effects. There are many plants in the genus Clematis. The development of universal KASP-SNP molecular markers for Clematis plants is of great significance for studying the evolutionary laws and species classification of different species in the genus. However, there are currently no reports on the whole genome sequencing of related species in the genus Clematis. Due to the lack of a reference genome, the efficiency of molecular marker development is not high. Summary of the invention

[0004] One object of the present invention is to provide a new use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a plant to be tested.

[0005] The present invention provides application of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a tested plant in identifying or assisting in identifying Clematis chinensis.

[0006] The present invention also provides the use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a plant to be tested in preparing a product for identifying or assisting in identifying Clematis chinensis.

[0007] The present invention also provides the use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a tested plant in distinguishing or assisting in distinguishing Clematis truncatula from other Clematis plants.

[0008] The present invention also provides the use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a tested plant in the preparation of a product for distinguishing or assisting in distinguishing Clematis truncatula from other Clematis plants.

[0009] Another object of the present invention is to provide a method for distinguishing or assisting in distinguishing Clematis from other Clematis plants.

[0010] The method for distinguishing or assisting in distinguishing Clematis chinensis from other Clematis plants provided by the present invention is to detect whether the genotype of the deoxyribonucleotide at position 2688 of SEQ ID No. 1 of the tested plant is CC or TT, and determine whether the tested plant is Clematis chinensis or other Clematis plants according to the genotype of the tested plant: if the genotype of the tested plant is CC, the tested plant is or is a candidate for Clematis chinensis; if the genotype of the tested plant is TT, the tested plant is or is a candidate for other Clematis plants;

[0011] The CC genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is C;

[0012] The TT genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is T.

[0013] In the above method, the method for detecting whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the plant to be tested is CC or TT comprises the following steps: using the genomic DNA of the plant to be tested as a template, using the KASP primer set to perform PCR amplification, scanning the obtained amplification product for fluorescence signals, and judging whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the plant to be tested is CC or TT according to the fluorescence signals.

[0014] In some embodiments, the KASP primer set consists of a forward primer F1, a forward primer F2, and a reverse primer R.

[0015] In some embodiments, the PCR amplification system is as follows: DNA 1uL, PCRmix 2.5uL, primer mixture solution 0.025uL, and ddH2O is used to make up the system volume to 5uL. The primers in the primer mixture solution are composed of forward primer F1, forward primer F2 and reverse primer R, and the molar ratio of the forward primer F1, the forward primer F2 and the reverse primer R is 1:1:2.

[0016] Furthermore, the final concentration of the forward primer F1 in the PCR amplification system is 1.25×10 -7mol / L, the final concentration of the forward primer F2 in the PCR amplification system is 1.25×10 -7 mol / L, the final concentration of the reverse primer R in the PCR amplification system is 2.5×10 -7 mol / L.

[0017] In some embodiments, the PCR amplification program is as follows: the first stage is denaturation at 96°C for 10 min; the second stage is denaturation at 96°C for 20 s, annealing at 65°C for 10 s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.5°C each cycle); the third stage is denaturation at 96°C for 20 s, 56°C for 10 s, for a total of 30 cycles.

[0018] In some embodiments, the PCR amplification is performed in an Eppendorf PCR instrument, and an Omega fluorescence scanner is used to read the fluorescence signal after the reaction is completed.

[0019] In some embodiments, the method for determining whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the plant to be tested is CC or TT according to the fluorescent signal is as follows: if the fluorescent signal is blue, the genotype of the plant to be tested is CC; if the fluorescent signal is red, the genotype of the plant to be tested is TT.

[0020] Still another object of the present invention is to provide a KASP primer set for identifying Clematis chinensis or distinguishing Clematis chinensis from other Clematis plants.

[0021] The KASP primer set provided by the invention for identifying maple leaf clematis or distinguishing maple leaf clematis from other Clematis plants consists of a forward primer F1, a forward primer F2 and a reverse primer R.

[0022] Any of the above forward primers F1 is as follows a1) or a2):

[0023] a1) a single-stranded DNA molecule shown in SEQ ID No.2;

[0024] a2) a single-stranded DNA molecule having the same function as SEQ ID No. 2 after one or more nucleotides are substituted and / or deleted and / or added;

[0025] Any of the above forward primers F2 is as follows a3) or a4):

[0026] a3) a single-stranded DNA molecule shown in SEQ ID No.3;

[0027] a4) a single-stranded DNA molecule having the same function as SEQ ID No. 3 after one or more nucleotides are substituted and / or deleted and / or added;

[0028] Any of the above reverse primers R is as follows a5) or a6):

[0029] a5) a single-stranded DNA molecule shown in SEQ ID No.4;

[0030] a6) A single-stranded DNA molecule having the same function as SEQ ID No. 4 after one or more nucleotides are substituted and / or deleted and / or added.

[0031] The final object of the present invention is to provide a kit for identifying Clematis chinensis or distinguishing Clematis chinensis from other Clematis plants.

[0032] The kit for identifying Clematis chinensis or distinguishing Clematis chinensis from other Clematis plants provided by the present invention contains the KASP primer set.

[0033] In some embodiments, the kit further comprises other reagents for PCR amplification, such as PCRmix.

[0034] In some embodiments, the kit further includes a negative control (eg, sterile ultrapure water) and a positive control (eg, genomic DNA of Clematis chinensis).

[0035] The use of the above KASP primer set or the above kit in identifying or assisting in identifying Clematis chinensis also falls within the protection scope of the present invention.

[0036] The use of the above KASP primer set or the above kit in the preparation of products for identifying or assisting in the identification of Clematis chinensis also falls within the protection scope of the present invention.

[0037] The use of the above KASP primer set or the above kit in distinguishing or assisting in distinguishing Clematis truncatula from other Clematis plants also falls within the protection scope of the present invention.

[0038] The use of the above KASP primer set or the above kit in the preparation of a product for distinguishing or assisting in distinguishing Clematis from other Clematis plants also falls within the protection scope of the present invention.

[0039] Any of the other Clematis plants described above is Clematis sympetala and / or Clematis wuxingensis and / or Clematis cottonii and / or Clematis zekyonii and / or Clematis chinensis and / or Clematis calyx and / or Clematis scaly-toothed and / or Clematis stubby and / or Clematis stubby-tailed and / or Clematis scaly-leafed and / or Clematis seminale and / or Clematis celery-leafed and / or Clematis shrubby and / or Clematis yupovata and / or Clematis quinceadensis.

[0040] The present invention performs second-generation sequencing and assembly on the maple-leaf Clematis plant for the first time, and the resulting ultra-long scaffolds are used as ultra-long fragments of the reference genome. Then, by performing simplified genome sequencing on 15 species of the Clematis plant and comparing them with the ultra-long fragments of the reference genome, differential sites are obtained. Finally, based on the differential sites, a KASP molecular marker CA24547 that can be used to distinguish the maple-leaf Clematis from the other 14 species of the Clematis plant is developed and verified. The KASP molecular marker CA24547 developed by the present invention can realize the accurate identification of the maple-leaf Clematis at the seedling stage, which is of great significance for the protection of the maple-leaf Clematis. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The results of KASP marker detection of 15 Clematis species. The yellow box indicates C. cerevisiae, the blue box indicates CC (C. cerevisiae), the green box indicates the other 14 Clematis species, and the red box indicates TT (other Clematis species). Control No. 2, Control No. 7, and Control No. 24 are samples of Wuxing Clematis, Ranunculus Clematis, and C. cerevisiae for simplified genome sequencing, respectively, as positive controls. From the control results, it can be seen that the KASP detection results are consistent with the simplified genome sequencing results; the primers can distinguish C. cerevisiae from the other 14 Clematis species.

[0042] Figure 2 This is the query result of the ultra-long fragment sequence in NCBI.

[0043] Figure 3 To simplify the query results of genome sequencing data in NCIB. DETAILED DESCRIPTION

[0044] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0045] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0046] The Clematis sibiricum in the following examples is recorded in the document "Yuan Lin, Huang Wenzhong, Liang Deqiang, et al. Study on the chemical composition of flavonoid glycosides in Clematis sibiricum [J]. Chinese Pharmaceutical Journal, 2015, 50(06): 497-501."

[0047] The Wuxing Clematis in the following embodiments is recorded in the document "Chen Mingjian, Wang Shuan, Wang Peng, et al. Chromosome karyotype analysis of plants in the Clematis group (Clematis genus) [J]. Journal of Plant Resources and Environment, 2024, 33(02): 99-105."

[0048] The Clematis chinensis in the following embodiments is recorded in the document “Na Xiaoting. Cotton Clematis chinensis seedling propagation technology [J]. China Forest By-products and Specialties, 2017, (04): 68-69.”

[0049] The Zhejiang Akebia in the following examples is recorded in the document “Yu Bing, Yao Zhensheng. Clematis medicinal plant resources in Zhejiang Province [J]. Jiangxi Science, 2006, (01): 89-92.”

[0050] The Ranunculus clematis in the following embodiment is recorded in the document "Wang Ruolan, Zhang Dequan. Whole genome analysis and phylogenetic analysis of the chloroplasts of Ranunculus clematis [J]. Journal of Jishou University (Natural Science Edition), 2024, 45(01): 66-76."

[0051] The Clematis chinensis in the following examples is recorded in the document “Zhang Wen, Zhang Hongmei, Song Long. Analysis of chemical components of volatile oil from Clematis chinensis [J]. Medical Information (Mid-monthly), 2011, 24(03): 1211-1212.”

[0052] The Clematis chinensis in the following embodiment is recorded in the document "Zhang Qiang, Zhang Likun, Jiang Lei, et al. Typical community structure and species diversity characteristics of Baihuashan Nature Reserve [J]. Journal of Beijing Normal University (Natural Science Edition), 2020, 56(01): 122-131."

[0053] The short-column Clematis in the following embodiments is recorded in the document "Chen Mingjian, Wang Shuan, Wang Peng, et al. Chromosome karyotype analysis of plants in the Clematis group (Clematis genus) [J]. Journal of Plant Resources and Environment, 2024, 33(02): 99-105."

[0054] The Clematis brevis in the following examples is recorded in the document “Lin Dong, Feng Chaoyang, Lv Shihai, et al. Study on chlorophyll fluorescence characteristics of Clematis brevis [J]. Northwest Botanical Journal, 2008, (11): 2299-2305.”

[0055] The large-leaf Clematis in the following embodiments is recorded in the document "Yang Yi, Wang Na, Wang Kuiling, et al. Microsporogenesis and male and female gametophyte development of large-leaf Clematis [J]. Acta Botanica Sinica, 2019, 54(05): 596-605."

[0056] The Clematis celery leaves in the following embodiments is recorded in the document "Tian Xiaolin. Research on insecticidal active ingredients of Clematis celery leaves [D]. Northwest Agriculture and Forestry University, 2019.".

[0057] The shrub Clematis in the following embodiments is recorded in the document "Li Yongmei, Zhu Zhu, Song Zhanbang. Phenotypic analysis of seeds and fruits of wild Clematis in arid areas [J]. Land and Natural Resources Research, 2024(3):72-78."

[0058] The yellow-flowered Clematis in the following embodiment is recorded in the document "Liu Zhijie, Zheng Yan, Niu Weikan, et al. Polyploid induction and identification of two wild Clematis [J]. Northern Horticulture, 2022."

[0059] The feather-leaved Clematis in the following embodiments is recorded in the document “Shi Jinghua. Preliminary study on the hybridization origin of feather-leaved Clematis [D]. Institute of Botany, Chinese Academy of Sciences [2024-11-05].”

[0060] The maple clematis in the following embodiments is recorded in the document "Pang Jiushuai, Yuan Yangchen, Zhou Miaomiao, et al. Study on the niche of species in the maple clematis (Clematis acerifolia Maxim.) community [J]. Acta Ecologica Sinica, 2022 (042-008)".

[0061] The picking license number of the maple leaf clematis sample in the following examples is 11BJ20230421000063.

[0062] Example 1. Acquisition of SNP sites and development of KASP molecular marker CA24547

[0063] 1. Acquisition of SNP loci

[0064] 1. Assembly of very long fragments of Clematis chinensis

[0065] The leaves of a maple leaf were collected and DNA was extracted using the CTAB method. After the quality inspection was qualified, the DNA sequence was fragmented into random fragments using ultrasound. The fragmented DNA was then end-repaired, 3′-end A was added, and sequencing adapters were connected. Magnetic beads were then used to adsorb and enrich fragments of about 350 bp in length, and a sequencing library was formed after PCR amplification. The constructed library was quality-checked. After the quality inspection was qualified, it was sequenced using the Illumina NovaSeqTM platform. The sequencing method was Illumina PE150, and the total sequencing read length was 300 bp. A total of 398G of second-generation sequencing data was obtained, and the sequence was spliced ​​using SPAdes genome assemblerv3.15.2 software. The spliced ​​sequences were filtered according to length, and scaffolds with a length of more than 1000 bp were retained as the reference genome super-long fragments of this experiment. The accession number of the super-long fragment sequence in NCBI is PRJNA1179677 ( Figure 2 ).

[0066] 2. Simplifying genome sequencing

[0067] GBS sequencing (Genotyping-By-Sequencing) was performed on Clematis sibiricus, Clematis wuxingensis, Clematis truncatula, Clematis zekiensis, Clematis buttercup, Clematis stubby-toothed, Clematis stubby-tailed, Clematis scaly-leafed, Clematis semba-belled, Clematis celery-leafed, Clematis shrubby, Clematis lutea, Clematis sphenops, Clematis sphenops and Clematis sphenops. The ultra-long fragments of the assembled Clematis sphenops reference genome were used as references to perform in silico enzyme digestion evaluation and enzyme digestion effect verification to obtain information including enzyme digestion combination, screening fragment size, tag number, reference genome coverage, etc. The specific steps of GBS sequencing are as follows: Sampling was performed in the Clematis resource garden of Beijing Academy of Landscape Architecture and Greening Sciences, and one plant of each material was selected to extract genomic DNA from 15 types of Clematis. After passing the quality inspection, 0.1-1ug of DNA was taken for double enzyme digestion (MseI+TaqaI) test. That is, the first digestion was performed with MseI restriction endonuclease, and Solexa P1 and P2 adapters (the adapters contain 6bp barcode sequences) were added to both ends of the digested fragments. These adapters can recognize the MseI restriction endonuclease site and complement the digested ends. TaqaI enzyme was used for the second digestion to adjust the number of tags. The sequences containing P1 and P2 adapters at both ends were amplified by PCR, DNA fragment pooling was performed, and the DNA in the required interval was recovered by electrophoresis. Finally, AMPure XP beads were used to purify the PCR product to obtain the GBS library. After the GBS library passed the quality inspection, it was sequenced using the X-plus platform, and the sequencing method was PE150. The accession number of the simplified genome sequencing data in NCIB is PRJNA1184821 ( Figure 3 ).

[0068] 3. Acquisition of SNP loci

[0069] After logging off the machine, Fastp was used to perform quality control on the raw data (Raw_data) to obtain Clean data. BWA-MEME software was used to align Clean Data to the reference genome sequence to obtain the position of the sequence (i.e., BAM file). SNP detection was performed using the Haplotyper method of the Best Practices process of GATK software, with the filtering conditions of SNP and indel filtering conditions: QD<2.0||FS>30.0||SOR>3.0||MQ<40.0||MQRankSum<-3.0||ALT=="*"||ReadPosRankSum<-3.0. The SNP results of the samples were compared with the reference genome and statistically analyzed.

[0070] Finally, a SNP site was found that can distinguish maple-leaved Clematis from the other 14 species of Clematis. It is located at position 2688 of SEQ ID No.1. The polymorphism of this site is C / T, and there are two genotypes, CC and TT.

[0071] Among them, the CC genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is C; the TT genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is T.

[0072] 2. Development of KASP Molecular Markers

[0073] According to the SNP site obtained in step 1, 500 bp of the upstream and downstream sequences were extracted for the design of KASP molecular markers. The primer sequence of the final designed KASP molecular marker CA24547 is as follows (the genotype of the site is [C / T]. When designing kasp primers, [C / T]Tcctccccaaatcatacccc is reverse-complemented to ggggtatgatttggggaggA[G / A]):

[0074] Forward primer F1: 5'- GAAGGTCGGAGTCAACGGATT ggggtatgatttggggaggAA-3'(SEQIDNo.2);

[0075] Forward primer F2: 5'- GAAGGTGACCAAGTTCATGCT ggggtatgatttggggaggAG-3'(SEQIDNo.3);

[0076] Reverse primer R: 5'-AccatccttgttTttctcctcaaC-3' (SEQ ID No. 4).

[0077] Among them, the underlined sequence in the forward primer F1 is the VIC fluorescent sequence, and the underlined sequence in the forward primer F2 is the FAM fluorescent sequence.

[0078] Example 2: Validation of KASP molecular marker CA24547

[0079] 1. Obtaining test samples

[0080] Fifteen Clematis materials in Table 1 were selected, with 2-4 plants of each material, and genomic DNA was extracted and quality tested.

[0081] Table 1

[0082] Material Name Sampling quantity Sampling location (the number behind indicates the quantity) Clematis 3 Laojun Mountain in Lijiang, Yunnan 1, Dali, Yunnan 1, Kunming, Yunnan 1 Wuxing Clematis 4 Zhejiang Hangzhou 2, Zhejiang Jinhua 1, control No. 2 Clematis 3 Daheishi Village, Dalian, Liaoning 1, Haidian District, Beijing 2 Akebia zeylanicum 3 Zhejiang Ningbo Fenghua Xikou 2, Anhui Huangshan 1 Ranunculus Clematis 4 Yulong Snow Mountain, Lijiang, Yunnan 1, Guiyang, Guizhou 2, comparison No. 7 Clematis scabra 4 Laojun Mountain in Lijiang, Yunnan: 2, Wuan in Hebei: 1, Taiyuan in Shanxi: 1 Half Bell Clematis 3 Beijing Mentougou 1, Beijing Miyun 1, Beijing Yanqing 1 Clematis 3 Zhejiang Wuhu 2, Beijing Changping 1 Clematis brevis 4 No. 2 Nanshiyang, Yanchi Town, Mentougou District, Beijing, No. 2 Xishan Forest Farm, Beijing Clematis macrophylla 4 Beijing Mentougou 1, Beijing Xishan Forest Farm 3 Clematis 2 Beijing Mentougou 1, Beijing Songshan 1 Clematis shrub 3 Yungang 1 in Datong, Shanxi, Chicheng 2 in Hebei Clematis chinensis 3 Beijing Yanqing Dazhuang Section 2, Hebei Chongli Tunnel 1 Clematis 4 No. 2 Huyu North, Changping District, Beijing, No. 2 Shenyang, Liaoning Clematis 5 Beijing Mentougou 4, compared with No. 24

[0083] Note: Control No. 1, Control No. 7 and Control No. 24 are all samples sequenced in Example 1 and serve as positive controls.

[0084] 2. KASP reaction

[0085] The KASP molecular marker CA24547 designed in Example 1 was used to perform a KASP reaction on the test sample obtained in step 1 to obtain the genotype of the test sample.

[0086] KASP reaction system (5uL): 1uL of DNA with a concentration of 30ng / uL, 2.5uL of (2X) PCRmix (LGC, catalog number KBS-1050-112), 0.025uL of primer mixture solution with a concentration of 100umol / L, and ddH2O to make up the system volume to 5uL. The primers in the primer mixture solution consist of forward primer F1, forward primer F2 and reverse primer R, and the molar ratio of forward primer F1, forward primer F2 and reverse primer R is 1:1:2. Among them, the final concentration of forward primer F1 in the KASP reaction system is 1.25×10- 7 mo l / L, the final concentration of forward primer F2 in the KASP reaction system was 1.25×10- 7 mo l / L, the final concentration of reverse primer R in the KASP reaction system was 2.5×10- 7 mo l / L.

[0087] KASP reaction procedure: first stage denaturation at 96°C for 10 m i n; The second stage was denaturation at 96°C for 20 s and annealing at 65°C for 10 s, for a total of 10 cycles (starting from the second cycle, the temperature was reduced by 0.5°C each cycle); the third stage was denaturation at 96°C for 20 s and 56°C for 10 s, for a total of 30 cycles.

[0088] The KASP reaction was carried out in an Eppendorf PCR instrument (Eppendorf, model: Mastercycler X50). After the reaction, the fluorescence signal was read using an Omega fluorescence scanner (LGC, model: Omega F).

[0089] 3. Results Analysis

[0090] The results are as follows Figure 1 As shown, the results show that: it can be seen from the figure that the genotypes of Clematis sibiricus, Clematis wuxingensis, Clematis truncatula, Clematis zekiensis, Clematis calyx, Clematis stubby, Clematis stubby, Clematis larvae, Clematis sibiricus, Clematis sibiricus, Clematis sibiricus, Clematis sibiricus, Clematis sibiricus, Clematis sibiricus, Clematis sibiricus and Clematis sibiricus are all TT, and the genotype of Clematis sibiricus is all CC. And the KASP detection results of control No. 2, control No. 7 and control No. 24 are consistent with the simplified genome sequencing results. It shows that the KASP molecular marker CA24547 of the present invention can effectively distinguish Clematis sibiricus from other 14 species of Clematis.

[0091] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a plant to be tested in identifying or assisting in identifying Clematis chinensis; Or, use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a plant to be tested in the preparation of a product for identifying or assisting in identifying Clematis chinensis.

2. Use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a plant to be tested in distinguishing or assisting in distinguishing Clematis truncatula from other Clematis plants; Or, use of a substance for detecting the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of a tested plant in the preparation of a product for distinguishing or assisting in distinguishing Clematis truncatula from other Clematis plants.

3. A method for distinguishing or assisting in distinguishing Clematis chinensis from other Clematis plants, comprising: detecting whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the tested plant is CC or TT, and determining whether the tested plant is Clematis chinensis or other Clematis plants according to the genotype of the tested plant: if the genotype of the tested plant is CC genotype, the tested plant is or is a candidate for Clematis chinensis; if the genotype of the tested plant is TT genotype, the tested plant is or is a candidate for other Clematis plants; The CC genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is C; The TT genotype is a homozygous body in which the 2688th deoxyribonucleotide of SEQ ID No.1 is T.

4. The method according to claim 3, characterized in that: The method for detecting whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the tested plant is CC or TT comprises the following steps: using the genomic DNA of the tested plant as a template, using a KASP primer set to perform PCR amplification, performing fluorescence signal scanning on the obtained amplification product, and judging whether the genotype of the 2688th deoxyribonucleotide of SEQ ID No. 1 of the tested plant is CC or TT according to the fluorescence signal.

5. The method according to claim 4, characterized in that: The KASP primer set consists of a forward primer F1, a forward primer F2 and a reverse primer R; The forward primer F1 is as follows a1) or a2): a1) a single-stranded DNA molecule shown in SEQ ID No.2; a2) a single-stranded DNA molecule having the same function as SEQ ID No. 2 after one or more nucleotides are substituted and / or deleted and / or added; The forward primer F2 is as follows a3) or a4): a3) a single-stranded DNA molecule shown in SEQ ID No.3; a4) a single-stranded DNA molecule having the same function as SEQ ID No. 3 after one or more nucleotides are substituted and / or deleted and / or added; The reverse primer R is as follows a5) or a6): a5) a single-stranded DNA molecule shown in SEQ ID No.4; a6) A single-stranded DNA molecule having the same function as SEQ ID No. 4 after one or more nucleotides are substituted and / or deleted and / or added.

6. The use according to claim 1 or 2 or the method according to any one of claims 3 to 5, characterized in that: The other Clematis plants are Clematis sympetala and / or Clematis wuxingensis and / or Clematis tatarica and / or Clematis zekyon and / or Clematis ranunculata and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra.

7. A KASP primer set for identifying Clematis chinensis or distinguishing Clematis chinensis from other Clematis plants, the KASP primer set consisting of a forward primer F1, a forward primer F2 and a reverse primer R; The forward primer F1 is as follows a1) or a2): a1) a single-stranded DNA molecule shown in SEQ ID No.2; a2) a single-stranded DNA molecule having the same function as SEQ ID No. 2 after one or more nucleotides are substituted and / or deleted and / or added; The forward primer F2 is as follows a3) or a4): a3) a single-stranded DNA molecule shown in SEQ ID No.3; a4) a single-stranded DNA molecule having the same function as SEQ ID No. 3 after one or more nucleotides are substituted and / or deleted and / or added; The reverse primer R is as follows a5) or a6): a5) a single-stranded DNA molecule shown in SEQ ID No.4; a6) A single-stranded DNA molecule having the same function as SEQ ID No. 4 after one or more nucleotides are substituted and / or deleted and / or added.

8. A kit for identifying Clematis chinensis or distinguishing Clematis chinensis from other Clematis plants, comprising the KASP primer set according to claim 7.

9. Use of the KASP primer set according to claim 7 or the kit according to claim 8 in identifying or assisting in identifying Clematis chinensis or in preparing a product for identifying or assisting in identifying Clematis chinensis; Or, use of the KASP primer set of claim 7 or the kit of claim 8 in distinguishing or assisting in distinguishing Clematis edulis from other Clematis plants or in preparing a product for distinguishing or assisting in distinguishing Clematis edulis from other Clematis plants.

10. The KASP primer set according to claim 7, the kit according to claim 8, or the use according to claim 9, characterized in that: The other Clematis plants are Clematis sympetala and / or Clematis wuxingensis and / or Clematis tatarica and / or Clematis zekyon and / or Clematis ranunculata and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra and / or Clematis scabra.

Images