A method for distinguishing Clematis macrantha from other Clematis species and the KASP primer set used therein.
By developing a KASP primer set and detecting the genotype of the deoxyribonucleotide at position 7761 of sequence 1 in the target plant, the problem of distinguishing *Clematis acerifolia* from other *Clematis* species was solved, enabling rapid and accurate seedling identification and supporting the protection and utilization of *Clematis acerifolia*.
Patent Information
- Application Number
- CN202411923518.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2044-12-25
AI Technical Summary
Current technology lacks a rapid and accurate method to distinguish Clematis acerifolia from other Clematis species, which affects their protection and utilization.
A KASP primer set, including primers F1, F2, and R, was developed to detect the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 in the test plant. The genotype of Clematis acerifolia was distinguished from other Clematis species by PCR amplification and fluorescence signal scanning.
This method enables rapid and accurate identification of Clematis macrantha during the seedling stage, effectively distinguishing it from 14 other Clematis species and supporting their protection and utilization.
Smart Images

Figure HDA0005208639150000011 
Figure HDA0005208639150000012 
Figure HDA0005208639150000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a method for distinguishing Clematis acerifolia from other Clematis species and the KASP primer set used therein. Background Technology
[0002] Clematis acerifolia Maxim., a plant belonging to the genus Clematis in the family Ranunculaceae, blooms in April with elegant flowers, making it highly valued for its ornamental qualities. Clematis acerifolia has a unique habitat, distributed on cliffs in the Taihang Mountains. As a plant that highlights the regional characteristics of Beijing, Clematis acerifolia possesses extremely high ornamental value, a unique habitat, and a fragmented distribution. In 2021, it was listed as a national second-class protected plant. The protection, propagation, and utilization of this species are essential for protecting Beijing's ecological environment and biodiversity, and can also provide new native plants and vertical greening materials for landscaping.
[0003] Identification of *Clematis acerifolia* is a crucial prerequisite for its conservation. Plant identification can utilize morphological and molecular markers. Compared to morphological markers, molecular markers are more accurate and stable, and can be completed at the seedling stage, significantly reducing the identification cycle and cost. SNP genotyping based on KASP (competitive allele-specific PCR) technology is a high-throughput, rapid, and accurate genotyping method. However, currently, there are no KASP molecular markers available for identifying *Clematis acerifolia*. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to quickly and accurately distinguish Clematis acerifolia from other Clematis species.
[0005] Firstly, this invention claims protection for primer sets.
[0006] The primer set consists of primer F1, primer F2 and primer R;
[0007] The primer F1 is either 1) or 2) as follows:
[0008] 1) The single-stranded DNA molecule shown in sequence 2;
[0009] 2) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of sequence 2 and has the same function as sequence 2;
[0010] The primer F2 is either 3) or 4) as follows:
[0011] 3) The single-stranded DNA molecule shown in sequence 3;
[0012] 4) A single-stranded DNA molecule with one or more nucleotides substituted and / or deleted and / or added to sequence 3 and having the same function as sequence 3;
[0013] The primer R is either 5) or 6) as follows:
[0014] 5) The single-stranded DNA molecule shown in sequence 4;
[0015] 6) A single-stranded DNA molecule that has undergone substitution and / or deletion and / or addition of one or more nucleotides of sequence 4 and has the same function as sequence 4.
[0016] In the above primer set, the molar ratio of primer F1, primer F2 and primer R is 1:1:2.
[0017] Secondly, the present invention claims protection for new uses of the above-mentioned primer set.
[0018] This invention claims protection for the use of the above primer set in any of the following b1)-b4):
[0019] b1) Identification or auxiliary identification of Clematis macrantha;
[0020] b2) Prepare products for identification or auxiliary identification of Clematis macrantha;
[0021] b3) To distinguish or help distinguish Clematis macrantha from other Clematis species;
[0022] b4) Prepare products that can distinguish or help distinguish Clematis acerifolia from other Clematis species.
[0023] Thirdly, this invention claims protection for a kit containing the above-described primer set; the kit functions as either c1) or c2) below:
[0024] c1) Identification or auxiliary identification of Clematis macrantha;
[0025] c2) To distinguish or help distinguish Clematis acerifolia from other Clematis species.
[0026] In some implementations, the kit also includes other reagents for PCR amplification, such as PCRmix.
[0027] In some implementations, the kit also includes a negative control (such as sterile ultrapure water) and a positive control (such as genomic DNA from Clematis macrantha).
[0028] Fourthly, the present invention claims protection for the method of preparing the above-mentioned reagent kit.
[0029] The preparation method of the above-mentioned reagent kit claimed in this invention is as follows (d1) or (d2):
[0030] d1) Package each primer in the above primer set separately;
[0031] d2) Mix the primers in the above primer set together in the specified proportions.
[0032] Fifthly, the present invention claims protection for novel uses of a substance for detecting the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of a plant to be tested.
[0033] This invention claims protection for the use of a substance for detecting the genotype of the deoxyribonucleotide at position 7761 of sequence 1 in a plant under test in any of the following b1)-b4):
[0034] b1) Identification or auxiliary identification of Clematis macrantha;
[0035] b2) Prepare products for identification or auxiliary identification of Clematis macrantha;
[0036] b3) To distinguish or help distinguish Clematis macrantha from other Clematis species;
[0037] b4) Prepare products that can distinguish or help distinguish Clematis acerifolia from other Clematis species.
[0038] In the above applications, the substance used to detect the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested is the above-mentioned primer set or the above-mentioned kit.
[0039] Sixthly, the present invention claims a method for distinguishing or assisting in distinguishing Clematis acerifolia from other Clematis species.
[0040] The method claimed in this invention for distinguishing or assisting in distinguishing *Clematis acerifolia* from other *Clematis* species is to detect the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested, which is AA, AG, or GG. Based on the genotype of the plant to be tested, it is determined whether it is *Clematis acerifolia* or another *Clematis* species: if the genotype of the plant to be tested is AA or AG, then the plant to be tested is or is a candidate for *Clematis acerifolia*; if the genotype of the plant to be tested is GG, then the plant to be tested is or is a candidate for another *Clematis* species.
[0041] The AA genotype is a homozygous individual whose deoxyribonucleotide at position 7761 of sequence 1 is A.
[0042] The AG genotype is a hybrid of A and G at the 7761st deoxyribonucleotide position of sequence 1;
[0043] The GG genotype is a homozygous form where the deoxyribonucleotide at position 7761 of sequence 1 is G.
[0044] The method described above for detecting whether the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG includes the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification using the above primer set, scanning the obtained amplification product for fluorescence signals, and determining whether the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG based on the fluorescence signals.
[0045] In some embodiments, the PCR amplification system is as follows: 1 μL DNA, 2.5 μL PCR mix, 0.025 μL primer mixture solution, and ddH2O to bring the total volume to 5 μL. The primer mixture solution contains forward primer F1, forward primer F2, and reverse primer R, wherein the final concentration of forward primer F1 in the PCR amplification system is 1.25 × 10⁻⁶. -7 The final concentration of the forward primer F2 in the PCR amplification system was 1.25 × 10⁻⁶ mol / L. -7 The final concentration of the reverse primer R in the PCR amplification system was 2.5 × 10⁻⁶ mol / L. -7 mol / L.
[0046] In some implementations, the PCR amplification procedure is as follows: the first stage is denaturation at 96°C for 10 min; the second stage is denaturation at 96°C for 20 s, followed by annealing at 65°C for 10 s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.5°C for each cycle); the third stage is denaturation at 96°C for 20 s, followed by annealing at 56°C for 10 s, for a total of 30 cycles.
[0047] In some implementations, the PCR amplification is performed in an Eppendorf PCR instrument, and the fluorescence signal is read using an Omega fluorescence scanner after the reaction is complete.
[0048] In some implementations, the method for determining whether the genotype of the deoxyribonucleotide at position 7761 of SEQ ID No. 1 of the plant to be tested is AA, AG, or GG based on the fluorescence signal is as follows: if the fluorescence signal is red, the genotype of the plant to be tested is AA or AG; if the fluorescence signal is blue, the genotype of the plant to be tested is GG.
[0049] In any of the primer sets, kits, applications, or methods described above, the other Clematis species are Clematis stalkae and / or Clematis wuxingensis and / or Clematis pubescens and / or Clematis zebrina and / or Clematis zebrina zebrina and / or Clematis chamaejasme and / or Clematis davidii and / or Clematis spurae and / or Clematis spurae and / or Clematis davidii and / or Clematis davidii and / or Clematis davidii and / or Clematis celeryensis and / or Clematis shrubby and / or Clematis chrysantha and / or Clematis pinnata.
[0050] This invention provides a method for distinguishing *Clematis macrantha* from other *Clematis* species and the KASP primer set used therein. The method for distinguishing *Clematis macrantha* from other *Clematis* species includes the following steps: detecting the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested (AA, AG, or GG); and determining whether the plant is *Clematis macrantha* or another *Clematis* species based on the genotype: if the genotype is AA or AG, the plant is *Clematis macrantha*; if the genotype is GG, the plant is another *Clematis* species. The KASP primer set consists of single-stranded DNA sequences 2-4. Using this method and KASP primer set, accurate identification of *Clematis macrantha* can be achieved at the seedling stage, which is of great significance for the protection of *Clematis macrantha*. This invention is the first to develop a KASP molecular marker CA24435 that can distinguish *Clematis acerifolia* from 14 other species of the *Clematis* genus. Experiments have shown that this KASP molecular marker CA24435 can effectively distinguish *Clematis acerifolia* from 14 other species of the *Clematis* genus, providing an important tool for the rapid and accurate identification of *Clematis acerifolia* in the seedling stage, which is of great significance for the protection of *Clematis acerifolia*. Attached Figure Description
[0051] Figure 1 The results of KASP marker detection for 15 species of Clematis are shown. The red box indicates *Clematis acerifolia*, with red indicating AA or AG (*Clematis acerifolia*). The yellow box indicates the other 14 species of Clematis, and blue indicates GG (other *Clematis* species). Controls 2, 7, 21, and 24 are positive controls, representing *Clematis wuxingensis*, *Clematis ranunculus*, *Clematis pinnata*, and *Clematis acerifolia* samples that underwent simplified genome sequencing. The control results show that the KASP detection results are consistent with the simplified genome sequencing results; this primer can distinguish *Clematis acerifolia* from the other 14 species of Clematis.
[0052] Figure 2 This is the query result for very long sequence fragments in NCBI.
[0053] Figure 3 To simplify the query results for genome sequencing data in NCIB. Detailed Implementation
[0054] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0055] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0056] The Clematis stalk described in the following examples is described in the literature “Wang Kuang. Study on the ecological adaptability of four Clematis species in Tibet [D]. Tibet University, 2019.”
[0057] The Clematis wuxingensis in the following examples is described in the literature “Chen Mingjian, Wang Shuan, Wang Peng, et al. Chromosome karyotype analysis of Clematis section (Clematis genus) plants [J]. Journal of Plant Resources and Environment, 2024, 33(02):99-105.”
[0058] The Clematis pubescens in the following examples is described in the literature "Muqier. Identification of 14 Clematis species by DNA barcoding and fingerprinting of Clematis pubescens [D]. Inner Mongolia University for Nationalities, 2020."
[0059] The *Clematis chinensis* species used in the following examples are described in the literature “Yu Bing, Yao Zhensheng. Medicinal plant resources of the genus *Clematis* in Zhejiang Province [J]. Jiangxi Science, 2006, (01): 89-92.”
[0060] The Clematis chamaejas in the following examples is described in the literature “Wang Ruolan, Zhang Dequan. Chloroplast genome analysis and phylogenetic analysis of Clematis chamaejas chloroplasts [J]. Journal of Jishou University (Natural Science Edition), 2024, 45(01):66-76.”.
[0061] The *Clematis chinensis* described in the following examples is described in the literature “Zhao Mei, Ma Ning, Hai Wenli, et al. Study on chemical composition of *Clematis chinensis* [J]. Central South Pharmacy, 2011, 9(05):338-342.”
[0062] The Clematis spp. in the following examples is described in the literature “Hao Min. Survey and research on Clematis spp. of Ranunculaceae in Xiaowutaishan National Nature Reserve, Hebei Province [J]. Modern Rural Science and Technology, 2021, (08): 95-96.”
[0063] The short-columnar clematis described in the following examples is described in the literature “Chen Mingjian, Wang Shuan, Wang Peng, et al. Chromosome karyotype analysis of Clematis section (Clematis genus) plants [J]. Journal of Plant Resources and Environment, 2024, 33(02):99-105.”
[0064] The Clematis breviculata in the following examples is described in the literature “Yu Dongli, Guo Shaoxin, Feng Zhibei, et al. Allelopathic effects of water extracts from different parts of Clematis breviculata on root growth and physiological characteristics of Robinia pseudoacacia seedlings [J]. Journal of Henan Agricultural University, 2022, 56(02):228-235+280.”
[0065] The *Clematis macrocarpa* in the following examples is described in the literature “Zhao Jirong, Xu Zhechao. Correction of the distribution of *Sect. Tubulosae* plants in Shaanxi Province [J]. Shaanxi Forestry Science and Technology, 2022, 50(03):63-64+96.” The *Clematis celeryensis* in the following examples is described in the literature “Zhao Ke. Study on chemical constituents of *Clematis celeryensis* and HPLC fingerprint and total saponin extraction process of related clematis species [D]. Inner Mongolia Medical University, 2015.”
[0066] The shrub clematis described in the following examples is described in the literature “Hou Qinzheng, Ren Yulan, Wen Jing, et al. Characteristics of the propagation system of shrub clematis and the adaptive significance of its drooping flower phenomenon [J]. Northwest Botanical Journal, 2016, 36(11):8.”
[0067] The yellow clematis in the following examples is described in the literature “Tian Lin, Wang Xin, Li Mingyang, et al. Study on seed germination characteristics of four wild clematis species [J]. Forestry and Ecological Science, 2021, 36(3):7.”
[0068] The *Clematis pedunculata* in the following examples is described in the literature “Shi Jinghua. A preliminary study on the origin of hybridization of *Clematis pedunculata* [D]. Institute of Botany, Chinese Academy of Sciences [2024-11-05].”
[0069] The *Clematis acerifolia* in the following examples is described in the literature “Huang Chunxiao, Liu Quanru, Du Yuxuan, et al. Population age structure and population dynamics of *Clematis acerifolia*, a rare and endangered plant endemic to the Taihang Mountains [J]. Journal of Ecology, 2023, 42(12):2911-2917.”
[0070] The harvesting license number for the Clematis maple samples in the following examples is 11BJ20230421000063.
[0071] Example 1: Obtaining SNP sites and developing the KASP molecular marker CA24435
[0072] I. Obtaining SNP loci
[0073] 1. Assembly of an extremely long segment of Clematis macrantha.
[0074] Leaves from one *Acer truncatum* plant were collected, and DNA was extracted using the CTAB method. After passing quality testing, the DNA sequence was fragmented into random fragments using ultrasound. The fragmented DNA underwent end repair, 3′ A addition, and sequencing adapter ligation. Fragments approximately 350 bp in length were then enriched using magnetic beads and amplified by PCR to form a sequencing library. The constructed library underwent quality control, and after passing quality control, it was sequenced using the Illumina NovaSeq™ platform with Illumina PE150, achieving a total read length of 300 bp. A total of 398 G of next-generation sequencing data was obtained. Sequence assembly was performed using SPAdes genome assembler v3.15.2 software. The assembled sequences were filtered based on length, retaining scaffolds longer than 1000 bp as the reference genome ultra-long fragment for this experiment. The NCBI accession number for this ultra-long fragment is PRJNA1179677. Figure 2 ).
[0075] 2. Simplified genome sequencing
[0076] GBS sequencing (Genotyping-By-Sequencing) was performed on *Clematis stalkata*, *Clematis wuxingensis*, *Clematis pubescens*, *Clematis zeylanica*, *Clematis davidii*, *Clematis short-columnarii*, *Clematis short-tailedii*, *Clematis macrophylla*, *Clematis semi-bellii*, *Clematis celery-leavedii*, *Clematis shrubbyii*, *Clematis chrysotricha*, *Clematis pinnata*, and *Clematis acerifolia*. The assembled ultra-long reference genome fragment of *Clematis acerifolia* was used as a reference for silicon electronic enzyme digestion evaluation and enzyme digestion effect verification to obtain information including enzyme digestion combination, screening fragment size, tag number, and reference genome coverage. The specific steps of GBS sequencing are as follows: Samples were collected from the *Clematis* resource nursery of the Beijing Academy of Landscape Architecture Sciences. One plant of each material was selected, and genomic DNA of 15 *Clematis* species was extracted. After passing quality testing, 0.1-1 μg of DNA was used for double enzyme digestion (MseI + TaqAI). The first digestion was performed using MseI restriction endonuclease. Solexa P1 and P2 adapters (each adapter containing a 6 bp barcode sequence) were added to both ends of the digested fragments. These adapters recognize the MseI restriction endonuclease site and are complementary to the digestion ends. A second digestion was performed using TaqAI to adjust the number of tags. Sequences containing P1 and P2 adapters at both ends were amplified by PCR, followed by DNA fragment pooling. The desired DNA regions were then recovered by electrophoresis. Finally, the PCR products were purified using AMPure XP beads to obtain the GBS library. After quality control, the GBS library was sequenced using the X-plus platform with the PE150 sequencing mode. The accession number for this simplified genome sequencing data in NCIB is PRJNA1184821. Figure 3 ).
[0077] 3. Obtaining SNP sites
[0078] After processing, Fastp was used to perform quality control on the raw data to obtain clean data. BWA-MEME software was used to align the clean data to the reference genome sequence to obtain the sequence location (i.e., BAM file). SNP detection was performed using the Haplotyper method in the Best Practices workflow of GATK software, with the following SNP and indel filtering conditions: QD < 2.0 || FS > 30.0 || SOR > 3.0 || MQ < 40.0 || MQRankSum < -3.0 || ALT == "*" || ReadPosRankSum < -3.0. The results were compared with the reference genome to statistically analyze the SNPs of the samples.
[0079] Sequence alignment revealed a single SNP locus that distinguishes Clematis acerifolia from 14 other Clematis species. This locus is located at position 7761 of sequence 1 and exhibits polymorphism A / G, with three genotypes: AA, AG, and GG.
[0080] Among them, the AA genotype is a homozygote with deoxyribonucleotide A at position 7761 of sequence 1; the AG genotype is a heterozygote with deoxyribonucleotides A and G at position 7761 of sequence 1; and the GG genotype is a homozygote with deoxyribonucleotide G at position 7761 of sequence 1.
[0081] II. Development of KASP Molecular Markers
[0082] Based on the SNP sites obtained in step one, 500bp sequences were extracted from both upstream and downstream sides for the design of KASP molecular markers. The final primer sequences for the designed KASP molecular marker CA24435 are as follows:
[0083] Forward primer F1: 5'- GAAGGTCGGAGTCAACGGATT cttgagcgtcgacgtccA-3'(Sequence 2);
[0084] Forward primer F2: 5'- GAAGGTGACCAAGTTCATGCT cttgagcgtcgacgtccG-3'(Sequence 3);
[0085] Reverse primer R: 5'-cgtttcccaaacctcatgcg-3' (sequence 4).
[0086] In this context, the underlined sequence in forward primer F1 is the VIC fluorescent sequence, and the underlined sequence in forward primer F2 is the FAM fluorescent sequence.
[0087] Example 2: Validation of the KASP molecular marker CA24435
[0088] 1. Obtaining the test sample
[0089] Fifteen Clematis species from Table 1 were selected, with 2-6 plants of each species. Genomic DNA was extracted and quality testing was performed.
[0090] Table 1
[0091] Material Name Sample size Sampling locations (the numbers following indicate the quantity) Clematis chinensis 3 Laojun Mountain in Lijiang, Yunnan 1, Dali, Yunnan 1, Kunming, Yunnan 1 Wuxing Clematis 4 Hangzhou, Zhejiang 2, Jinhua, Zhejiang 1, Compare with No. 2 Cottonball Clematis 3 1. Daheishi Village, Dalian, Liaoning Province; 2. Haidian District, Beijing Zhejiang Mountain Wood 3 2 from Xikou, Fenghua, Ningbo, Zhejiang; 1 from Huangshan, Anhui. Ranunculus clematis 4 Yulong Snow Mountain, Lijiang, Yunnan 1; Guiyang, Guizhou 2; Comparison No. 7 Coarse-toothed Clematis 4 2 from Laojun Mountain in Lijiang, Yunnan; 1 from Wu'an, Hebei; 1 from Taiyuan, Shanxi. Half-bell Clematis 3 1 in Mentougou District, Beijing; 1 in Miyun District, Beijing; 1 in Yanqing District, Beijing Short-columned clematis 3 Anhui Wuhu 2, Beijing Changping 1 Short-tailed Clematis 4 2 in Mentougou District, Beijing, and 2 in Xishan Forest Farm, Beijing Clematis macrophylla 4 Mentougou District, Beijing 1; Xishan Forest Farm, Beijing 3 Celery Clematis 2 Mentougou District, Beijing 1, Songshan District, Beijing 1 Shrub Clematis 3 Yungang Grottoes 1 in Datong, Shanxi; Chicheng Grottoes 2 in Chicheng, Hebei Yellow Clematis 3 Beijing Yanqing Dazhuangke 2, Hebei Chongli Tunnel 1 Clematis chinensis 4 No. 2, Huyu North Road, Changping District, Beijing; No. 1, Shenyang, Liaoning; Reference No. 21 Maple Clematis 6 Mentougou District, Beijing, 5, compared with 24
[0092] Note: Controls 2, 7, 21 and 24 are all samples sequenced in Example 1 and are used as positive controls.
[0093] 2. KASP reaction
[0094] The KASP molecular marker CA24435 designed in Example 1 was used to perform a KASP reaction on the test sample obtained in step 1 to obtain the genotype of the test sample.
[0095] The KASP reaction system (5 μL) consisted of: 1 μL of 30 ng / μL DNA, 2.5 μL of (2X) PCR mix (LGC, catalog number BS-1050-112), and 0.025 μL of 100 μmol / L primer mixture. The final volume was brought to 5 μL using ddH2O. The primer mixture consisted of forward primer F1, forward primer F2, and reverse primer R, with a molar ratio of 1:1:2. The final concentration of forward primer F1 in the KASP reaction system was 1.25 × 10⁻⁶. -7 The final concentration of the forward primer F2 in the KASP reaction system was 1.25 × 10⁻⁶ mol / L. -7 The final concentration of reverse primer R in the KASP reaction system was 2.5 × 10⁻⁶ mol / L. -7 mol / L.
[0096] KASP reaction procedure: First stage: denaturation at 96℃ for 10 min; Second stage: denaturation at 96℃ for 20 s, annealing at 65℃ for 10 s, for a total of 10 cycles (starting from the second cycle, the temperature is decreased by 0.5℃ in each cycle); Third stage: denaturation at 96℃ for 20 s, annealing at 56℃ for 10 s, for a total of 30 cycles.
[0097] The KASP reaction was performed in an Eppendorf PCR instrument (Eppendorf, model Mastercycler X50), and the fluorescence signal was read using an Omega fluorescence scanner (LGC, model Omega F) after the reaction.
[0098] 3. Results Analysis
[0099] The results are as follows Figure 1 As shown, the results indicate that the following species—*Clematis stalkae*, *Clematis wuxingensis*, *Clematis pubescens*, *Clematis zeylanica*, *Clematis davidii*, *Clematis styracifolia*, *Clematis styracifolia*, *Clematis styracifolia*, *Clematis styracifolia*, *Clematis scutellarioides ...
[0100] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The use of the primer set or a kit containing the primer set in any of the following b1)-b4): b1) Identification or auxiliary identification of Clematis macrantha; b2) Prepare products for identification or auxiliary identification of Clematis macrantha; b3) To distinguish or help distinguish Clematis macrantha from other Clematis species; b4) Prepare products that can distinguish or help distinguish Clematis acerifolia from other Clematis species; The primer set consists of primer F1, primer F2 and primer R; The primer F1 is a single-stranded DNA molecule as shown in sequence 2; The primer F2 is a single-stranded DNA molecule as shown in sequence 3; The primer R is a single-stranded DNA molecule as shown in sequence 4; The primer set detects whether the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG. Based on the genotype of the plant to be tested, it is determined whether it is Clematis macrantha: if the genotype of the plant to be tested is AA or AG, then the plant to be tested is or is a candidate for Clematis macrantha; if the genotype of the plant to be tested is GG, then the plant to be tested is not or is not a candidate for Clematis macrantha. The AA genotype is a homozygous individual whose deoxyribonucleotide at position 7761 of sequence 1 is A. The AG genotype is a hybrid of A and G at the 7761st deoxyribonucleotide position of sequence 1; The GG genotype is a homozygous form where the deoxyribonucleotide at position 7761 of sequence 1 is G.
2. The application according to claim 1, characterized in that: The molar ratio of primer F1, primer F2 and primer R is 1:1:
2.
3. Application of substances that detect the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 in the identification or auxiliary identification of Clematis macrantha or in the preparation of products for the identification or auxiliary identification of Clematis macrantha; The application involves detecting whether the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG, and determining whether the plant is Clematis macrantha based on its genotype: if the genotype is AA or AG, then the plant is or is a candidate for Clematis macrantha; if the genotype is GG, then the plant is not or is not a candidate for Clematis macrantha. The AA genotype is a homozygous individual whose deoxyribonucleotide at position 7761 of sequence 1 is A. The AG genotype is a hybrid of A and G at the 7761st deoxyribonucleotide position of sequence 1; The GG genotype is a homozygous form where the deoxyribonucleotide at position 7761 of sequence 1 is G.
4. The application of substances that detect the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 of the plant to be tested in distinguishing or assisting in distinguishing Clematis acerolae from other Clematis species, or in the preparation of products that distinguish or assist in distinguishing Clematis acerolae from other Clematis species; The application involves detecting the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant under test, whether it is AA, AG, or GG. Based on the genotype of the plant under test, it is determined whether it is Clematis macrantha or another Clematis species: if the genotype of the plant under test is AA or AG, then the plant under test is or is a candidate for Clematis macrantha; if the genotype of the plant under test is GG, then the plant under test is or is a candidate for another Clematis species. The AA genotype is a homozygous individual whose deoxyribonucleotide at position 7761 of sequence 1 is A. The AG genotype is a hybrid of A and G at the 7761st deoxyribonucleotide position of sequence 1; The GG genotype is a homozygous form where the deoxyribonucleotide at position 7761 of sequence 1 is G.
5. The application according to claim 4, characterized in that: The other Clematis species mentioned are Clematis stalkae and / or Clematis wuxingensis and / or Clematis pubescens and / or Clematis zebrina and / or Clematis zebrina zebrina and / or Clematis breviscara and / or Clematis serrulata and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara.
6. A method for distinguishing or assisting in distinguishing *Clematis macrantha* from other *Clematis* species, comprising detecting whether the genotype of the deoxyribonucleotide at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG, and determining whether the plant is *Clematis macrantha* or another *Clematis* species based on the genotype of the plant to be tested: if the genotype of the plant to be tested is AA or AG, then the plant to be tested is or is a candidate for *Clematis macrantha*; if the genotype of the plant to be tested is GG, then the plant to be tested is or is a candidate for another *Clematis* species; The AA genotype is a homozygous individual whose deoxyribonucleotide at position 7761 of sequence 1 is A. The AG genotype is a hybrid of A and G at the 7761st deoxyribonucleotide position of sequence 1; The GG genotype is a homozygous form where the deoxyribonucleotide at position 7761 of sequence 1 is G.
7. The method according to claim 6, characterized in that: The method for detecting whether the genotype of the deoxyribonucleic acid at position 7766 of sequence 1 of the plant to be tested is AA, AG, or GG includes the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification using the primer set described in claim 1 or 2, scanning the obtained amplification product for fluorescence signal, and determining whether the genotype of the deoxyribonucleic acid at position 7761 of sequence 1 of the plant to be tested is AA, AG, or GG based on the fluorescence signal.
8. The method according to claim 6 or 7, characterized in that: The other Clematis species mentioned are Clematis stalkae and / or Clematis wuxingensis and / or Clematis pubescens and / or Clematis zebrina and / or Clematis zebrina zebrina and / or Clematis breviscara and / or Clematis serrulata and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara and / or Clematis breviscara.
Citation Information
Patent Citations
SNP locus and KASP primer group for identification or auxiliary identification of clematis maple and application of SNP locus and KASP primer group
CN119639942A