An SNP molecular marker related to the pericarp color of pear fruits and its application

Abstract

The present invention belongs to the technical field of molecular biology, and discloses an SNP molecular marker related to the pericarp color of pear fruits and its application. The locus of the SNP molecular marker is located at the position of 23.789257 Mb on chromosome 8 of the Pyrus pyrifolia cv. Nijisseiki PPY_r1.0 genome. The nucleotide at the SNP locus is T in green-skinned pears and C in brown-skinned pears. The molecular marker of the present invention is closely related to the pericarp color trait of pear fruits; by detecting this SNP marker, early prediction and rapid screening of the pericarp color of pear fruits can be realized, and the breeding process of pear variety improvement can be accelerated, which has important scientific value and economic value.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a molecular marker related to the pericarp color of pear fruits and its application. Background Art

[0002] Pear (Pyrus L.) belongs to the genus Pyrus of the Rosaceae family and is one of the most important deciduous fruit trees in the world, widely cultivated worldwide. The cultivation types of pears are rich and diverse, and according to their native distribution, they can be divided into two major categories: Western pears and Eastern pears. The pear industry has become an important industry in the agricultural economic structure of our country, and an important factor affecting the industrial efficiency is the fruit quality. Fruit quality includes fruit appearance quality, internal quality, storage quality, and processing quality. And the appearance quality is an important condition for the commercial value of fruits, among which the fruit surface smoothness and pericarp color are important factors affecting the appearance quality.

[0003] The pericarp traits of pears are mainly composed of factors such as epidermal color, lenticel size and density, fruit surface wax, and epidermal rust. Consistent pericarp color and no fruit rust are important indicators of high-quality commercial pears. Among them, green-skinned fruits have a beautiful appearance and are very popular in the international market. The fruit color is mainly determined by the content and ratio of three major types of plant pigments: chlorophyll, carotenoid, and phenolic pigment. Among many pear cultivars, brown pericarp is the unique fruit pericarp color of sand pears. The brown pericarp not only affects the appearance quality of the fruit but also affects the internal quality. Many sand pear cultivars, although most of the fruit surface is yellowish-green (or green), often have irregularly distributed brown rust spots. Research shows that the formation of brown skin in pears is not the result of pigment accumulation. Essentially, it is caused by the accumulation of the pericarp cork layer after the damage of the cutin layer and epidermal cells. This makes the formation of brown color in pears different from other pears not only in terms of fruit color but also in terms of the formation mechanism from other fruit color formations. However, the genetic law of pericarp brown color is not yet fully understood.

[0004] During the breeding process, the fruit color mostly still depends on the appearance determination at the time of fruit maturity, which takes a long time. Conducting in-depth research on the pericarp color traits of pear fruits and developing molecular markers tightly linked to the pericarp color traits of pear fruits can greatly shorten the breeding process and improve the accuracy of selection. Summary of the Invention

[0005] One of the purposes of the present invention is to provide an SNP locus related to the pericarp color of pear fruits and an SNP molecular marker developed based on this locus.

[0006] The second purpose of the present invention is to provide the application of the above SNP locus and the SNP molecular marker based on this locus in pear molecular breeding.

[0007] The third purpose of the present invention is to provide a determination method for identifying brown or green cultivars / genotypes of pear fruit pericarp color.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] An SNP molecular marker related to the pericarp color of pear fruits, wherein the SNP locus of the SNP molecular marker is located at the 23,789,257th base of chromosome No. 8 of the genome of 'Nijisseiki' Pyrus pyrifolia r1.0; the polymorphism at the SNP locus is T / C. Materials with the T genotype show the trait of green pericarp of fruits, and materials with the C genotype show the trait of brown pericarp of fruits. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1. The polymorphic site of the SNP molecular marker is located at the 150th position of the sequence shown in SEQ ID NO.1, and the polymorphism is a base mutation of T→C.

[0010] The present invention also provides a primer pair for detecting the above-mentioned SNP molecular marker, including a forward primer F with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer R with a nucleotide sequence as shown in SEQ ID NO.3.

[0011] SEQ ID NO.2: CAAGCTTGGCCAGCACGAT;

[0012] SEQ ID NO.3: ACATTGTACGTGGTCTCTTTAGCA.

[0013] Furthermore, the genomic DNA of pears is subjected to PCR amplification using the above primer pair and the amplification product is subjected to Sanger sequencing. If the 150th base of the cloned product is T, the pericarp color of the tested pear fruit material is green; if the 150th base of the amplification product is C, the pericarp color of the tested pear fruit material is brown.

[0014] The present invention also provides the use of the above primer pair in pear breeding. More specifically, it is used to identify or assist in identifying the pericarp color trait / genotype / variety of pear fruits.

[0015] The present invention also provides a kit for detecting the above molecular marker, and the kit contains the above primer pair.

[0016] The present invention also provides the use of the above kit in pear breeding, mainly for identifying or assisting in identifying the pericarp color trait / genotype / variety of pear fruits.

[0017] The present invention also provides a method for detecting the pericarp color trait of pear fruits by using the above molecular marker, and the method includes the following steps:

[0018] (1) Extract the DNA of pear tissues;

[0019] (2) PCR amplification: Using the primer pair with the upstream primer sequence of the SNP molecular marker shown in SEQ ID NO.2 and the downstream primer sequence shown in SEQ ID NO.3, perform PCR amplification on the sample extracted in step (1) to obtain an amplification product;

[0020] The reaction system for the PCR amplification is as follows: 0.5 μL of DNA template, 0.5 μL of forward primer F, 0.5 μL of reverse primer R, 5 μL of 2× Es Taq Mastermix, 3.5 μL of RNase Free water, with a total volume of 10 μL. The PCR amplification conditions are: 95.0 °C for 5 min; 95.0 °C for 30 s, 56.0 °C for 30 s, 72.0 °C for 30 s, for 35 cycles; 72.0 °C for 5 min; store at 12.0 °C.

[0021] (3) Perform Sanger sequencing on the amplification product;

[0022] (4) Make a determination according to the results of step (3). The specific criteria are as follows:

[0023] If the 150th base of the cloned product is T, the pericarp color of the pear fruit material to be tested is green; if the 150th base of the amplification product is C, the pericarp color of the pear fruit material to be tested is brown.

[0024] Therefore, according to the Sanger sequencing results, the genotype corresponding to this locus can be quickly obtained, and then the pericarp color of the pear fruit material to be tested can be quickly judged. Among them, the genotype of the polymorphic locus of the SNP molecular marker is TT, corresponding to the green trait, and the genotype is CC or CT, corresponding to the brown trait.

[0025] More specifically, when the genotype is TT, the pear material is a homozygous green pericarp material; when the genotype is CC, the pear material is a homozygous brown pericarp material; when the genotype is TC, the pear material is a heterozygous brown pericarp material.

[0026] Compared with the prior art, a SNP molecular marker related to the pericarp color of pear fruits provided by the present invention has the following advantages:

[0027] The present invention uses the method of genome-wide association study to screen a SNP locus related to the pericarp color of pear fruits on chromosome 8 of pear. The genotype T of the SNP locus corresponds to green pericarp, and the genotype C corresponds to brown pericarp. This can be used as an auxiliary selection marker for the pericarp color trait in the pear breeding process, enabling the identification of desired plants at the juvenile stage, reducing not only the floor area during the breeding process but also the human and material resources required for identification after the plants grow up, greatly improving the breeding efficiency and shortening the selection period. Therefore, the SNP molecular marker provided by the present invention has good application value in the cultivation of new varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 FIG. is a phenotypic diagram of 108 pear materials used for genome-wide association study;

[0029] Figure 2 FIG. is a Manhattan plot of genome-wide association study for the pericarp color trait of pear fruits;

[0030] Figure 3 FIG. is a bar chart A and a pie chart B showing the correspondence between the genotypes of significantly associated SNP loci and the pericarp color of pear fruits;

[0031] Figure 4 FIG. is a partial sequence alignment result of green pericarp pear materials and brown pericarp pear materials in the pericarp color association region of pear fruits. DETAILED DESCRIPTION OF THE INVENTION

[0032] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0033] Example 1 Identification of SNP Loci for the Pericarp Color of Pear Fruits

[0034] The phenotypes of 108 pear materials (all the materials are from the germplasm resource bank, and the germplasm bank numbers of each material are shown in the figure) are as Figure 1 shown. Among them, two phenotypes are exhibited in the pericarp color of the fruits. One is the green phenotype, and the other is the brown phenotype. Their leaf tissues are collected and sent to Biomarker Technologies Corporation for whole-genome resequencing. By using the general linear model GLM+PCA of TASSEL 5.0 software to conduct association analysis on the SNP locus genotype data, SNP loci related to the pericarp color of pear fruits are mined. When the P value of the detected variant locus is less than 5.46×10 -12 , it is considered a significantly associated locus. In this study, a locus located on chromosome 8 of Nijisseiki pear PPY The SNP locus at the 23,789,257th base on chromosome 8 of the r1.0 genome, the difference between T / C at this SNP locus ( Figure 2 ).

[0035] As Figure 3 shown, when the genotype of this SNP locus is T, the fruit peel shows a green trait; when the genotype of this SNP locus mutates from T to C, the fruit peel shows a brown trait.

[0036] Example 2 Verification of the SNP Locus for the Fruit Peel Color of Pears

[0037] (1) Test Materials

[0038] Randomly select 10 germplasm materials, and the fruit peel colors and genotypes corresponding to the SNP loci are shown in Table 1.

[0039] Table 1 Fruit Peel Colors of 10 Germplasm Materials and Genotypes Corresponding to the SNP Loci

[0040] Germplasm name Pericarp color Genotype W084 Green T / T W122 Green T / T W145 Green T / T W152 Green T / T W189 Green T / T W067 Brown T / C W127 Brown T / C W134 Brown C / C W244 Brown T / C W255 Brown T / C

[0041] SEQ ID NO.1: CAAGCTTGGCCAGCACGATGGCCCTTGGCCATGTTTTGCCTTTGTGTGCTCCAATGATTATTAGCCCACCTTTCAGCTGAAGAGGAGTTTTGTCTAAATCAGGCCATATTTTGGCACTTTAATCTTTTGGCTCTCTTTACTGGAGATGGTCTTAGTAACACCCCGTGACTTAAGAAACAAATTTTTCTTACGGAAAATCACGATTGTGATAACATAACTTCGAGTGTTTCGTTGGTTTAACTTCCAAGCATGCATTTTGGTTTCATTAAAAAAATGCTAAAGAGACCACGTACAATGT

[0042] Use the molecular marker shown in the above SEQ ID NO.1 to detect the above 10 pear materials, and the specific detection steps are as follows:

[0043] 1. Extract the genomic DNA of the above 10 samples of pears;

[0044] 2. Design a forward primer F and a reverse primer R;

[0045] The nucleotide sequence of the forward primer F is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO.3;

[0046] SEQ ID NO.2: CAAGCTTGGCCAGCACGAT;

[0047] SEQ ID NO.3: ACATTGTACGTGGTCTCTTTAGCA;

[0048] 3. PCR Amplification

[0049] Using the primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3, perform PCR amplification on all tested pear genomic DNA samples.

[0050] The amplification system is: 0.5 μL of DNA template, 0.5 μL of forward primer F, 0.5 μL of reverse primer R, 5 μL of 2×Es TaqMastermix, and 0.5 μL of RNase Free water;

[0051] The amplification program is: 95.0 °C for 5 min; 95.0 °C for 30 s, 56.0 °C for 30 s, 72.0 °C for 30 s, 35 cycles; 72.0 °C for 5 min; store at 12.0 °C.

[0052] 4. Result Judgment

[0053] After the reaction is completed, send the reaction product to Sangon Biotech Co., Ltd. for first-generation sequencing and perform genotyping identification. The sanger sequencing results of the SNP locus genotypes related to the pericarp color of pear fruit materials are as Figure 4 shown. Combining Table 1 and Figure 4 , it can be seen that the detected genotype results are completely consistent with the actual phenotypes.

[0054] It can be seen that the SNP loci obtained by GWAS can accurately identify the pericarp color of pear fruit materials in another independent verification. The results show that the molecular markers screened by the present invention can be applied to the molecular marker-assisted selection of the pericarp color trait of pear fruit materials to improve the selection accuracy and shorten the breeding period.

[0055] It should be noted that, to prevent redundancy, the present invention describes preferred embodiments. However, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be interpreted to include the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0056] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. An SNP molecular marker related to the pericarp color of pear fruits, characterized in that, The polymorphic site of the SNP molecular marker is located at the position of 23.789257 Mb on chromosome 8 of the Pyrus pyrifolia cv. Nijisseiki PPY_r1.0 genome; the nucleotide at this site is T or C; the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO. 1, and the polymorphic site is located at the 150th position of the SEQ ID NO. 1 sequence.

2. The SNP molecular marker according to claim 1, wherein The nucleotide sequence of the forward primer F of the primer pair for amplifying the SNP molecular marker is as shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO.

3.

3. Use of the SNP molecular marker according to claim 1 or 2 in molecular marker-assisted breeding related to the pericarp color of pear fruits.

4. The application according to claim 3, characterized in that, The SNP molecular marker is used for identifying or assisting in identifying the pericarp color trait / genotype / variety of pear fruits.

5. A method for determining the fruit peel color trait of pears, characterized in that, The method includes the following steps: (1) Extract genomic DNA of the pear sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, and using the primer pair of the SNP molecular marker described in claim 2, perform PCR amplification on the sample extracted in step (1) to obtain an amplification product; (3) Perform Sanger sequencing on the amplification product; (4) Make a determination according to the sequencing result of step (3), and the specific criteria are: If the 150th base of the cloned product is T, then the pericarp color of the pear fruit material to be tested is the green trait; if the 150th base of the amplification product is C, then the pericarp color of the pear fruit material to be tested is the brown trait.

6. The method according to claim 5, wherein The reaction system of the PCR amplification is: 0.5 μL of DNA template, 0.5 μL of forward primer F, 0.5 μL of reverse primer R, 5 μL of 2 × Es Taq Mastermix, 3.5 μL of RNase Free water, with a total volume of 10 μL; the PCR amplification conditions are: 95.0 °C, 5 min; 95.0 °C, 30 s, 56.0 °C, 30 s, 72.0 °C, 30 s, 35 cycles; 72.0 °C, 5 min; store at 12.0 °C.

7. A kit for detecting the molecular marker according to claim 1, characterized in that, The kit contains the primer pair of the SNP molecular marker described in claim 2.

8. Use of the kit according to claim 7 in identifying the pericarp color trait / genotype of pear fruits.

9. The application according to claim 8, wherein The genotype of the polymorphic site of the SNP molecular marker is T / T, corresponding to the green trait, and the genotype is C / C or C / T, corresponding to the brown trait.

Images