Method for constructing pear variety DNA fingerprint spectrum based on KASP primer combination and application thereof

Abstract

The invention discloses a method for constructing a pear variety DNA fingerprint spectrum based on a KASP primer combination and application of the method, and belongs to the technical field of molecular marker development. Whole genome re-sequencing is carried out based on 495 parts of different pear germplasm resources of Institute of Fruit Research, Chinese Academy of Agricultural Sciences, hundreds of thousands of SNP variation site data are obtained, and 25 SNP markers and matched KASP primer combinations are further analyzed, identified and screened by using a KASP technology platform. The invention provides a complete set of SNP site detection primers for pear variety research, and can be used for pear variety SNP detection kit development, pear variety DNA fingerprint construction, pear variety genetic typing, pear variety authenticity detection and the like.

Description

Technical Field

[0001] The invention relates to the technical field of molecular marker development, and in particular to a method for constructing a DNA fingerprint of pear varieties based on a KASP primer combination and an application thereof. Background Art

[0002] China is the native place of pear and the differentiation center of Oriental pear, and is one of the diversity centers of cultivated pear. Pyrus plants are rich in genetic resources and have a long history of cultivation. Pyrus plants have the characteristics of self-incompatibility, no reproductive isolation between species, common interspecific hybridization, and complex genetic background. Identification and utilization of pear germplasm resources can give full play to the quantitative advantages of my country's pear germplasm resources and lay a material foundation for pear variety improvement and breeding.

[0003] DNA molecular markers have the advantages of short cycle, no environmental influence, and high-throughput detection, providing new technical means for pear variety identification, such as SSR molecular markers and KASP molecular markers. However, due to the limited number of SSR markers and detection throughput, high detection costs, and time-consuming and labor-intensive data reading, their application in identifying pear varieties is limited. KASP molecular markers have the advantages of being more efficient, flexible, accurate, and low-cost, and have been widely used at home and abroad. However, the identification of pear varieties is currently limited to a few specific varieties, and it cannot effectively distinguish many varieties, which leads to the common situation of different similar varieties being indistinguishable from the real ones in the market, and is also not conducive to the development and utilization of excellent germplasm resources. Therefore, it is very necessary to develop new molecular markers for pear variety identification. Summary of the invention

[0004] The purpose of the present invention is to provide a method for constructing a DNA fingerprint of pear varieties based on a KASP primer combination and its application, so as to solve the problems existing in the above-mentioned prior art, realize the genotyping and authenticity identification of pear varieties, and construct a DNA fingerprint of pear varieties.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a reagent for detecting the genotypes of 25 SNP sites in the pear genome, for use in any of the following:

[0007] (1) Application in the preparation of a kit for detecting the genotype of a pear SNP site;

[0008] (2) Application in genotyping of pear varieties;

[0009] (3) Application in constructing DNA fingerprint of pear varieties;

[0010] (4) Application in detecting authentic pear varieties;

[0011] The physical positions of the 25 SNP sites are determined based on the alignment of the whole genome sequence of pear. The gene accession number of the whole genome of pear on NCBI is GCA_007844245.1. The 25 SNP sites are SNP1-SNP25:

[0012] SNP1 is located at position 16868304 on chromosome 1, and its base is C or T;

[0013] SNP2 is located at position 3483609 on chromosome 2, and its base is G or C;

[0014] SNP3 is located at position 26191031 on chromosome 2, and its base is A or G;

[0015] SNP4 is located at position 4991610 on chromosome 3, and its base is G or C;

[0016] SNP5 is located at position 17841568 on chromosome 4, and its base is A or G;

[0017] SNP6 is located at position 23947857 on chromosome 4, and its base is T or C;

[0018] SNP7 is located at position 3714662 on chromosome 5, and its base is T or C;

[0019] SNP8 is located at position 12064959 on chromosome 6, and its base is C or T;

[0020] SNP9 is located at position 18415632 on chromosome 6, and its base is A or T;

[0021] SNP10 is located at position 5417364 on chromosome 7, and its base is G or T;

[0022] SNP11 is located at position 6167915 on chromosome 8, and its base is G or A;

[0023] SNP12 is located at position 22160552 on chromosome 8, and its base is T or A;

[0024] SNP13 is located at position 508439 on chromosome 9, and its base is A or T;

[0025] SNP14 is located at position 8663266 on chromosome 9, and its base is C or T;

[0026] SNP15 is located at position 5690624 on chromosome 11, and its base is C or T;

[0027] SNP16 is located at position 16140350 on chromosome 11, and its base is T or C;

[0028] SNP17 is located at position 33330733 on chromosome 11, and its base is C or T;

[0029] SNP18 is located at position 3512965 on chromosome 12, and its base is C or A;

[0030] SNP19 is located at position 17378039 on chromosome 12, and its base is C or G;

[0031] SNP20 is located at position 21953151 on chromosome 13, and its base is A or C;

[0032] SNP21 is located at position 26179272 on chromosome 13, and its base is T or C;

[0033] SNP22 is located at position 2476344 on chromosome 14, and its base is A or G;

[0034] SNP23 is located at position 38652743 on chromosome 15, and its base is either A or G;

[0035] SNP24 is located at position 1017338 on chromosome 17, and its base is A or G;

[0036] SNP25 is located at position 8230144 on chromosome 17, and its base is T or G.

[0037] The present invention also provides a KASP primer combination for detecting the 25 SNP sites, wherein the KASP primer corresponding to each SNP site to be detected includes two forward primers and one reverse primer;

[0038] The KASP primers used to detect SNP1 are two forward primers shown in SEQ ID NO.1-2 and a reverse primer shown in SEQ ID NO.3;

[0039] The KASP primers used to detect SNP2 are two forward primers shown in SEQ ID NO.4-5 and a reverse primer shown in SEQ ID NO.6;

[0040] The KASP primers used to detect SNP3 are two forward primers as shown in SEQ ID NO.7-8 and a reverse primer as shown in SEQ ID NO.9;

[0041] The KASP primers used to detect SNP4 are two forward primers as shown in SEQ ID NO.10-11 and a reverse primer as shown in SEQ ID NO.12;

[0042] The KASP primers used to detect SNP5 are two forward primers shown in SEQ ID NO.13-14 and a reverse primer shown in SEQ ID NO.15;

[0043] The KASP primers used to detect SNP6 are two forward primers shown in SEQ ID NO.16-17 and a reverse primer shown in SEQ ID NO.18;

[0044] The KASP primers used to detect SNP7 are two forward primers as shown in SEQ ID NO.19-20 and a reverse primer as shown in SEQ ID NO.21;

[0045] The KASP primers used to detect SNP8 are two forward primers as shown in SEQ ID NO.22-23 and a reverse primer as shown in SEQ ID NO.24;

[0046] The KASP primers used to detect SNP9 are two forward primers as shown in SEQ ID NO.25-26 and a reverse primer as shown in SEQ ID NO.27;

[0047] The KASP primers used to detect SNP10 are two forward primers as shown in SEQ ID NO.28-29 and a reverse primer as shown in SEQ ID NO.30;

[0048] The KASP primers used to detect SNP11 are two forward primers shown in SEQ ID NO.31-32 and a reverse primer shown in SEQ ID NO.33;

[0049] The KASP primers used to detect SNP12 are two forward primers as shown in SEQ ID NO.34-35 and a reverse primer as shown in SEQ ID NO.36;

[0050] The KASP primers used to detect SNP13 are two forward primers as shown in SEQ ID NO.37-38 and a reverse primer as shown in SEQ ID NO.39;

[0051] The KASP primers used to detect SNP14 are two forward primers as shown in SEQ ID NO.40-41 and a reverse primer as shown in SEQ ID NO.42;

[0052] The KASP primers used to detect SNP15 are two forward primers shown in SEQ ID NO.43-44 and a reverse primer shown in SEQ ID NO.45;

[0053] The KASP primers used to detect SNP16 are two forward primers as shown in SEQ ID NO.46-47 and a reverse primer as shown in SEQ ID NO.48;

[0054] The KASP primers used to detect SNP17 are two forward primers as shown in SEQ ID NO.49-50 and a reverse primer as shown in SEQ ID NO.51;

[0055] The KASP primers used to detect SNP18 are two forward primers as shown in SEQ ID NO.52-53 and a reverse primer as shown in SEQ ID NO.54;

[0056] The KASP primers used to detect SNP19 are two forward primers as shown in SEQ ID NO.55-56 and a reverse primer as shown in SEQ ID NO.57;

[0057] The KASP primers used to detect SNP20 are two forward primers as shown in SEQ ID NO.58-59 and a reverse primer as shown in SEQ ID NO.60;

[0058] The KASP primers used to detect SNP21 are two forward primers as shown in SEQ ID NO.61-62 and a reverse primer as shown in SEQ ID NO.63;

[0059] The KASP primers used to detect SNP22 are two forward primers as shown in SEQ ID NO.64-65 and a reverse primer as shown in SEQ ID NO.66;

[0060] The KASP primers used to detect SNP23 are two forward primers as shown in SEQ ID NO.67-68 and a reverse primer as shown in SEQ ID NO.69;

[0061] The KASP primers used to detect SNP24 are two forward primers as shown in SEQ ID NO.70-71 and a reverse primer as shown in SEQ ID NO.72;

[0062] The KASP primers used to detect SNP25 are two forward primers shown as SEQ ID NOs. 73-74 and a reverse primer shown as SEQ ID NO. 75.

[0063] Optionally, the 5' ends of the two forward primers are connected to different fluorescent groups, including FAM fluorescent group and HEX fluorescent group.

[0064] The present invention also provides a kit comprising the KASP primer combination.

[0065] The present invention also provides the use of the KASP primer combination or the kit in any of the following:

[0066] (1) Application in genotyping of pear varieties;

[0067] (2) Application in constructing DNA fingerprint of pear varieties;

[0068] (3) Application in detecting authentic pear varieties.

[0069] The present invention also provides a method for genotyping pear varieties, comprising the following steps:

[0070] Extracting genomic DNA of the pear varieties to be tested;

[0071] Using the genomic DNA as a template, preparing a reaction system according to the 25 SNP sites, and using the corresponding primers in the KASP primer combination to perform PCR amplification respectively;

[0072] The fluorescence signal of the PCR amplification product is detected, and the genotype of the pear variety to be tested at the corresponding SNP site is obtained according to the value of the fluorescence signal.

[0073] The present invention also provides a method for constructing a DNA fingerprint of pear varieties, comprising the following steps:

[0074] Extracting genomic DNA of the pear varieties to be tested;

[0075] Using the genomic DNA as a template, preparing a reaction system according to the 25 SNP sites, and using the corresponding primers in the KASP primer combination to perform PCR amplification respectively;

[0076] The fluorescence signal of the PCR amplification product is detected, and the genotype of the pear variety to be tested at the corresponding SNP site is obtained according to the value of the fluorescence signal, thereby constructing a DNA fingerprint of the pear variety.

[0077] The present invention discloses the following technical effects:

[0078] The present invention is based on whole genome resequencing of 269 different pear germplasm resources from the Fruit Research Institute of the Chinese Academy of Agricultural Sciences, obtaining hundreds of thousands of SNP variant site data, further analyzing using the KASP technology platform, identifying and screening 25 SNP markers and matching KASP primer combinations. The present invention provides a set of SNP site detection primers for pear variety research, which can be used for the development of pear variety SNP detection kits, the construction of pear variety DNA fingerprints, pear variety genotyping, and pear variety authenticity detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0080] Figure 1 is the identification efficiency of 25 pairs of KASP primers. DETAILED DESCRIPTION

[0081] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0082] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0083] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0084] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0085] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0086] Example 1

[0087] 1. Experimental Materials

[0088] The present invention uses 269 different pear varieties for experiments, and the specific information is shown in Table 1.

[0089] Table 1269 Material Name

[0090]

[0091]

[0092]

[0093]

[0094] 2. Screening of candidate SNP sites

[0095] The 495 resequencing data of pears were compared with the reference genome of Pyrus betulus (GCA_007844245.1), and a data set containing all variant sites was obtained, including 453,801 sites that met dimorphism and had no other mutations within 100 bp before and after the polymorphic site, 34,282 sites with maf>0.4, and 27,274 sites with an average sequencing depth of 10; there were 11,015 sites with a missing rate of 0. The optimal primer combination was tested using Perl scripts (Winfield et al., 2020). Considering the failure rate of primer design, redundant SNP sites were selected to develop KASP markers, including a total of 34 SNP sites in four optimal combinations. Nine primer pairs with poor typing results were discarded, and 25 primer pairs with good typing results were used to perform genotyping on 269 samples. The 269 samples came from five major cultivated pear systems and bred varieties. The 269 pear germplasm resources came from the national pear and apple germplasm resource nurseries. Details are shown in Table 1. The DNA of young leaves of pear samples was extracted using the TIANGEN plant genomic DNA extraction kit, and the DNA quality was tested on a 1% agarose gel. The concentration was diluted to 40 ng·μL using a DS-11 (Denovix, USA) ultra-micro spectrophotometer. -1 spare.

[0096] 3. KASP primer design and synthesis

[0097] A pair of KASP primers consists of two forward competitive primers (recognizing different SNPs) and one common reverse primer. The primer sequences are shown in Table 2. The primer design parameters are (1) GC content <60%; (2) annealing temperature Tm between 55-62°C; (3) PCR amplification product <120bp. Synthesized by Shanghai Bioengineering Co., Ltd. FAM was added to the 5' end of forward primer X, and the sequence was: GAAGGTGACCAAGTTCATGCT, and HEX was added to the 5' end of forward primer Y, and the sequence was GAAGGTCGGAGTCAACGGATT.

[0098] Table 2 Core KASP marker primer sequences

[0099]

[0100]

[0101]

[0102]

[0103] To further clarify the characteristics of the above markers, the base type of each SNP marker site plus the downstream 100 bp sequence are shown in Table 3.

[0104] Table 3 100 bp sequences before and after the variant site

[0105]

[0106]

[0107]

[0108] 4. PCR amplification and genotyping

[0109] KASP reaction system: KASP primer system was prepared, 12 μL of each specific primer (100 μL), 30 μL of universal primer (100 μL), 46 μL ddH2O. PCR was performed in a 96-well plate, with 10 μL of reaction system in each well, and 5 μL of concentration was 40 ng.μL -1 DNA, 5 μL 2×Probe Mix, and 0.14 μL Primer Mix.

[0110] The KASP genotyping instrument was a Bio-Rad CFX-96 fluorescence quantitative PCR instrument. The PCR cycle reaction program was as follows: 94°C pre-denaturation for 15 minutes; 94°C denaturation for 20 seconds, 61°C annealing for 60 seconds (0.6°C decrease per cycle, 10 cycles, reaching the final annealing temperature of 55°C); 94°C denaturation for 20 seconds, 55°C annealing for 60 seconds, 26 cycles. Read at 37°C for 1 minute. The amplification program for primers with low GC% content was: 94°C pre-denaturation for 15 minutes; 94°C denaturation for 20 seconds, 57°C annealing for 60 seconds, 36 cycles. Read at 37°C for 1 minute.

[0111] If after 36 cycles, the fluorescence signal is low and the clusters are dispersed, affecting data analysis, you can choose to add cycles, with the program of 94℃ denaturation for 20 seconds, 57℃ annealing for 60 seconds, and 3 cycles. If NTC is not amplified, up to 4 additional cycles can be performed.

[0112] 5. Data statistics and analysis

[0113] The SNPs were filtered and analyzed using vcftools and Excel software according to the KASP primer design rules, and the genotypes were read using the Bio-Rad CFX Manager3.1 software that comes with the fluorescence quantitative PCR instrument using the allele recognition mode.

[0114] 6. Identification efficiency of different primer combinations

[0115] In order to demonstrate the identification ability of the KASP markers used in the fingerprint library provided in the present invention, in this example, the identification efficiency was analyzed by detecting the genotype data of 269 germplasms using 25 KASP markers. Through genotype data comparison, it was found that 24 of the 269 germplasms were divided into 12 groups, and the corresponding genotypes were consistent, among which Qiuzi and Tianqiuzi (bud mutation varieties of Qiuzi), Nanguo and Dananguo (bud mutation varieties of Nanguo) had the same genotype; the other 10 groups were Zhengzhou Eli and Yinbai (suspected synonyms), Hongtangli and Hongtangli 2 (suspected synonyms), Shuixiang and Xiali (suspected synonyms), Mili and Dandanguan (suspected synonyms), Shimen Shuidonggua and Fojianxi (suspected synonyms), Fengxian Jitui and Puchengxue (suspected synonyms), Hanyuanbai and Jinbabai (suspected synonyms), Banjinsu and Kuixingma Ke (suspected synonyms), Sajin and Shengxian Qiubai (suspected synonyms), Fuyuanhuang and Huangpishuibudmutation (suspected synonyms). After removing the germplasm with the same genotype, the observed heterozygosity values ​​of the 25 primer pairs were 0.3296-0.5556. The observed heterozygosity values ​​of each primer were arranged in descending order using the sorting function of the table. The order of the 25 primer pairs from large to small was Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, Chr4_17 8, Chr11_333, Chr3_499, Chr11_569, Chr13_219, Chr17_101, Chr8_616, Chr6-184, Chr2_348, Chr7_541, Chr11_161, Chr14_247, Chr4_239, Chr6_120, Chr5_371, Chr12_351, Chr12_173, Chr15_386. After the arrangement is completed, the former KASP primer site is used as the keyword, and the column is sorted and arranged in ascending order; then the data with only genotype is displayed. Three pairs of primers, Chr9_866, Chr8_221, Chr2_261, yielded five unique genotypes; four pairs of primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, yielded 20 unique genotypes; five pairs of primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, yielded 57 unique genotypes; six pairs of primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, yielded 118 unique genotypes;A total of 7 primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, and Chr9_5089, yielded 168 unique genotypes; a total of 8 primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, and Chr4_178, yielded 203 unique genotypes; r9_508, Chr4_178, Chr11_333, a total of 9 primers obtained 225 unique genotypes; Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, Chr4_178, Chr11_333, Chr3_499, a total of 10 primers obtained 236 unique genotypes; 11 primers, Chr1_333, Chr3_499, Chr11_569, obtained 239 unique genotypes; 12 primers, Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, Chr4_178, Chr11_333, Chr3_499, Chr11_569, Chr13_219, obtained 241 unique genotypes; Chr9_508, Chr4_178, Chr11_333, Chr3_499, Chr11_569, Chr13_219, Chr17_101, a total of 13 primers obtained 249 unique genotypes; Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, Chr4_178, Chr11_333, Chr3_499, Chr11_569, Chr13_219, Chr17_101, Chr8_616, a total of 14 primers obtained 253 unique genotypes;Chr9_866, Chr8_221, Chr2_261, Chr1_168, Chr13_261, Chr17_823, Chr9_508, Chr4_178, Chr11_333, Chr3_499, Chr11_569, Chr13_219, Chr17_101, Chr8_616, Chr6-184, a total of 15 primers, obtained 257 unique genotypes. In the end, only 15 markers were used to completely distinguish 257 germplasms, and the identification efficiency reached 95.54%. The identification efficiency is as follows; Figure 1 shown.

[0116] 7. Fingerprint construction

[0117] According to the KASP genotyping results of 257 pear germplasm resources, see Tables 4 and 5, the SNP genotype information was converted into an Excel-readable format to construct a fingerprint map (for example, the wild type (consistent with the pear genome) was represented as 0, the mutant was represented as 2, the heterozygous genotype was represented as 1, and the missing site was marked as "-").

[0118] Table 4

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127] Table 5

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135] Note: In the above Tables 4 to 7, A: Chr1_16868304; B: Chr2_3483609; C: Chr2_26191031; D: Chr3_4991610; E: Chr4_17841568; F: Chr4_23947857; G: Chr5_3714662; H: Chr6_12064959; I: Chr6_18415632; J: Chr7_5417364; K: Chr8_6167915; L: Chr8_22160552; M: Chr9 _508439; N: Chr9_8663266; O: Chr11_5690624; P: Chr11_16140350; Q: Chr11_33330733; R: Chr12_3512965; S: Chr12_17378 039; T: Chr13_21953151; U: Chr13_26179272; V: Chr14_2476344; W: Chr15_38652743;

[0136] This set of markers was used to type 269 pear germplasm test materials, develop a pear DNA fingerprint, and identify pear germplasm resources, which is conducive to the preservation, collection and utilization of pear germplasm resources as well as the protection and protection of bred varieties.

[0137] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of a reagent for detecting the genotype of 25 SNP loci in the pear genome in any of the following: (1) Application in the preparation of a kit for detecting the genotype of a pear SNP site; (2) Application in genotyping of pear germplasm resources; (3) Application in constructing DNA fingerprint of pear varieties; (4) Application in detecting authentic pear varieties; The physical positions of the 25 SNP sites are determined based on the alignment of the whole genome sequence of pear. The gene accession number of the whole genome of pear on NCBI is GCA_007844245.

1. The 25 SNP sites are SNP1-SNP25: SNP1 is located at position 16868304 on chromosome 1, and its base is C or T; SNP2 is located at position 3483609 on chromosome 2, and its base is G or C; SNP3 is located at position 26191031 on chromosome 2, and its base is A or G; SNP4 is located at position 4991610 on chromosome 3, and its base is G or C; SNP5 is located at position 17841568 on chromosome 4, and its base is A or G; SNP6 is located at position 23947857 on chromosome 4, and its base is T or C; SNP7 is located at position 3714662 on chromosome 5, and its base is T or C; SNP8 is located at position 12064959 on chromosome 6, and its base is C or T; SNP9 is located at position 18415632 on chromosome 6, and its base is either A or T; SNP10 is located at position 5417364 on chromosome 7, and its base is G or T; SNP11 is located at position 6167915 on chromosome 8, and its base is G or A; SNP12 is located at position 22160552 on chromosome 8, and its base is T or A; SNP13 is located at position 508439 on chromosome 9, and its base is A or T; SNP14 is located at position 8663266 on chromosome 9, and its base is C or T; SNP15 is located at position 5690624 on chromosome 11, and its base is C or T; SNP16 is located at position 16140350 on chromosome 11, and its base is T or C; SNP17 is located at position 33330733 on chromosome 11, and its base is C or T; SNP18 is located at position 3512965 on chromosome 12, and its base is C or A; SNP19 is located at position 17378039 on chromosome 12, and its base is C or G; SNP20 is located at position 21953151 on chromosome 13, and its base is A or C; SNP21 is located at position 26179272 on chromosome 13, and its base is T or C; SNP22 is located at position 2476344 on chromosome 14, and its base is A or G; SNP23 is located at position 38652743 on chromosome 15, and its base is either A or G; SNP24 is located at position 1017338 on chromosome 17, and its base is A or G; SNP25 is located at position 8230144 on chromosome 17, and its base is T or G.

2. A KASP primer combination for detecting the 25 SNP sites described in claim 1, characterized in that: The KASP primers corresponding to each SNP site to be tested include two forward primers and one reverse primer; The KASP primers used to detect SNP1 are two forward primers shown in SEQ ID NO.1-2 and a reverse primer shown in SEQ ID NO.3; The KASP primers used to detect SNP2 are two forward primers shown in SEQ ID NO.4-5 and a reverse primer shown in SEQ ID NO.6; The KASP primers used to detect SNP3 are two forward primers as shown in SEQ ID NO.7-8 and a reverse primer as shown in SEQ ID NO.9; The KASP primers used to detect SNP4 are two forward primers as shown in SEQ ID NO.10-11 and a reverse primer as shown in SEQ ID NO.12; The KASP primers used to detect SNP5 are two forward primers as shown in SEQ ID NO.13-14 and a reverse primer as shown in SEQ ID NO.15; The KASP primers used to detect SNP6 are two forward primers as shown in SEQ ID NO.16-17 and a reverse primer as shown in SEQ ID NO.18; The KASP primers used to detect SNP7 are two forward primers as shown in SEQ ID NO.19-20 and a reverse primer as shown in SEQ ID NO.21; The KASP primers used to detect SNP8 are two forward primers as shown in SEQ ID NO.22-23 and a reverse primer as shown in SEQ ID NO.24; The KASP primers used to detect SNP9 are two forward primers as shown in SEQ ID NO.25-26 and a reverse primer as shown in SEQ ID NO.27; The KASP primers used to detect SNP10 are two forward primers as shown in SEQ ID NO.28-29 and a reverse primer as shown in SEQ ID NO.30; The KASP primers used to detect SNP11 are two forward primers shown in SEQ ID NO.31-32 and a reverse primer shown in SEQ ID NO.33; The KASP primers used to detect SNP12 are two forward primers as shown in SEQ ID NO.34-35 and a reverse primer as shown in SEQ ID NO.36; The KASP primers used to detect SNP13 are two forward primers as shown in SEQ ID NO.37-38 and a reverse primer as shown in SEQ ID NO.39; The KASP primers used to detect SNP14 are two forward primers as shown in SEQ ID NO.40-41 and a reverse primer as shown in SEQ ID NO.42; The KASP primers used to detect SNP15 are two forward primers shown in SEQ ID NO.43-44 and a reverse primer shown in SEQ ID NO.45; The KASP primers used to detect SNP16 are two forward primers as shown in SEQ ID NO.46-47 and a reverse primer as shown in SEQ ID NO.48; The KASP primers used to detect SNP17 are two forward primers as shown in SEQ ID NO.49-50 and a reverse primer as shown in SEQ ID NO.51; The KASP primers used to detect SNP18 are two forward primers as shown in SEQ ID NO.52-53 and a reverse primer as shown in SEQ ID NO.54; The KASP primers used to detect SNP19 are two forward primers as shown in SEQ ID NO.55-56 and a reverse primer as shown in SEQ ID NO.57; The KASP primers used to detect SNP20 are two forward primers as shown in SEQ ID NO.58-59 and a reverse primer as shown in SEQ ID NO.60; The KASP primers used to detect SNP21 are two forward primers as shown in SEQ ID NO.61-62 and a reverse primer as shown in SEQ ID NO.63; The KASP primers used to detect SNP22 are two forward primers as shown in SEQ ID NO.64-65 and a reverse primer as shown in SEQ ID NO.66; The KASP primers used to detect SNP23 are two forward primers as shown in SEQ ID NO.67-68 and a reverse primer as shown in SEQ ID NO.69; The KASP primers used to detect SNP24 are two forward primers as shown in SEQ ID NO.70-71 and a reverse primer as shown in SEQ ID NO.72; The KASP primers used to detect SNP25 are two forward primers shown as SEQ ID NOs. 73-74 and a reverse primer shown as SEQ ID NO.

75.

3. The KASP primer combination according to claim 2, characterized in that The 5' ends of the two forward primers are connected to different fluorescent groups, including a FAM fluorescent group and a HEX fluorescent group.

4. A kit comprising the KASP primer combination according to claim 2 or 3.

5. Use of the KASP primer combination according to claim 2 or 3 or the kit according to claim 4 in any of the following: (1) Application in genotyping of pear varieties; (2) Application in constructing DNA fingerprint of pear varieties; (3) Application in detecting authentic pear varieties.

6. A method for genotyping pear varieties, characterized in that: The following steps are involved: Extracting genomic DNA of the pear varieties to be tested; Using the genomic DNA as a template, preparing a reaction system according to the 25 SNP sites described in claim 1, and using the corresponding primers in the KASP primer combination described in claim 2 or 3 to perform PCR amplification respectively; The fluorescence signal of the PCR amplification product is detected, and the genotype of the pear variety to be tested at the corresponding SNP site is obtained according to the value of the fluorescence signal.

7. A method for constructing a DNA fingerprint of pear varieties, characterized in that: The following steps are involved: Extracting genomic DNA of the pear varieties to be tested; Using the genomic DNA as a template, preparing a reaction system according to the 25 SNP sites described in claim 1, and using the corresponding primers in the KASP primer combination described in claim 2 or 3 to perform PCR amplification respectively; The fluorescence signal of the PCR amplification product is detected, and the genotype of the pear variety to be tested at the corresponding SNP site is obtained according to the value of the fluorescence signal, thereby constructing a DNA fingerprint of the pear variety.

Images