Application of Serpin1 gene as target spot in preparation of medicine for preventing or treating myocardial fibrosis

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of Serpin1 gene as a target spot in preparation of medicine for preventing or treating myocardial fibrosis. In order to screen key molecules for intervening and regulating extracellular matrix balance and provide a basis for developing drugs for preventing or treating myocardial fibrosis, the important function of Serpin1 in myocardial fibrosis is defined through experiments, and the application of Serpin1 gene as a target in preparation of drugs for preventing or treating myocardial fibrosis is provided. Experiments prove that knocking down Serpin1 expression can improve cardiac systolic function damage caused by constriction of the thoracic aortic arch for four weeks, relieve myocardial fibrosis and inhibit activation of myocardial fibroblasts, can be used for preparing the medicine for preventing or treating myocardial fibrosis, and has important practical significance.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to the use of Serpine1 gene as a target in the preparation of a drug for preventing or treating myocardial fibrosis. Background Art

[0002] Myocardial fibrosis remains an unsolved problem in heart disease and is one of the main causes of heart failure. When the heart is damaged, myofibroblasts are activated and then differentiated into myofibroblasts, which are the main mediators of myocardial fibrosis and cardiac pathological remodeling. Myofibroblasts mainly show the characteristics of proliferation and secretion. As the damage continues to develop, myofibroblasts overproliferate and secrete extracellular matrix, resulting in an imbalance in the original proportion of extracellular matrix components, disorder, and pathological cardiac remodeling, ultimately leading to heart failure and death. Inhibiting or reversing myocardial fibrosis has become one of the goals of clinical treatment of heart disease. However, the mechanism of myocardial fibrosis has not been fully elucidated, and anti-fibrotic treatment lacks specific targets. At present, clinical anti-fibrotic treatment is mainly RAAS inhibitors, including angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, aldosterone receptor antagonists spironolactone and eplerenone, etc., but they are still in the clinical research stage. Therefore, screening the key targets for regulating myocardial fibrosis, especially the key molecules in myofibroblasts, and intervening in them in a cell-specific manner are of great significance for the targeted treatment of myocardial fibrosis and early intervention of heart failure.

[0003] The myocardial extracellular matrix is ​​a complex three-dimensional network structure, mainly composed of a variety of proteins and carbohydrates including collagen and elastin. The increased proliferation and secretion of myofibroblasts leads to the disorder of the extracellular matrix, which is the main cause of myocardial fibrosis and pathological cardiac remodeling. Therefore, targeting myofibroblasts to intervene in the key molecules that regulate the balance of the extracellular matrix may be an important way and strategy for anti-fibrosis treatment.

[0004] However, there are many key molecules that intervene and regulate the balance of the extracellular matrix. How to target myofibroblasts and screen out effective key molecules that intervene and regulate the balance of the extracellular matrix has become a key issue in the study of anti-myocardial fibrosis.

[0005] Currently, the role of Serpine1 in cardiac fibrosis, especially the role of Serpine1 in myofibroblasts, remains to be elucidated. Summary of the invention

[0006] The technical problem to be solved by the present invention is to screen key molecules that intervene and regulate the balance of the extracellular matrix, and provide a basis for developing drugs to prevent or treat myocardial fibrosis.

[0007] The technical solution of the present invention to solve the above technical problem is: to provide a use of Serpine1 gene as a target in the preparation of a drug for preventing or treating myocardial fibrosis.

[0008] The second aspect of the present invention also provides a use of the Serpine1 gene as a target for screening drugs for preventing or treating myocardial fibrosis.

[0009] In a third aspect, the present invention further provides an expression vector for reducing the expression of Serpine1.

[0010] Furthermore, the expression vector is a viral vector, preferably an adeno-associated viral vector.

[0011] Furthermore, the target gene knockdown sequence nucleotide of the expression vector is SEQ ID NO: 1.

[0012] SEQ ID NO:1 Target gene knockdown sequence sh-Serpine1: GCTATGGGATTCAAAGTCAAT.

[0013] Wherein, the above expression vector also includes Periostin promoter.

[0014] The present invention also provides a host cell comprising the above expression vector.

[0015] Furthermore, the present invention also provides a use of the above-mentioned expression vector and host cell for reducing Serpine1 expression in the preparation of a drug for preventing or treating myocardial fibrosis.

[0016] Wherein, in the above use, the myocardial fibrosis is myocardial fibrosis induced by pressure overload.

[0017] Wherein, in the above use, the myocardial fibrosis includes impaired cardiac contractile function or inhibition of myocardial fibroblast activation.

[0018] The beneficial effects of the present invention are:

[0019] The present invention has determined for the first time the important function of Serpine1 in myocardial fibrosis, and provides a use of the Serpine1 gene as a target in the preparation of drugs for preventing or treating myocardial fibrosis, thereby providing a drug for treating myocardial fibrosis. The present invention has found through experimental studies that knocking down Serpine1 can reduce myocardial fibrosis, especially has a good effect on myocardial fibrosis induced by pressure overload, can improve the impaired cardiac contractile function caused by thoracic aortic arch stenosis for 4 weeks, and reduce the effect of myocardial fibrosis. Knocking down Serpine1 in myocardial fibroblasts can inhibit the activation of myocardial fibroblasts. Based on this, the present invention also provides a method for preparing a drug for treating myocardial fibrosis, which provides a new idea for the treatment of heart failure-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 To analyze the correlation between the expression of SERPINE1 and fibrosis marker genes POSTN, CTGF and FIBRONECTIN in patients with myocardial fibrosis.

[0021] Figure 2 Knockdown of Serpine1 reduces TGF-β1-induced cardiac fibroblast activation. A is the knockdown efficiency of Serpine1 detected by real-time quantitative PCR (RT-qPCR) after transfection of si-Serpine1 in cardiac fibroblasts; B is the knockdown efficiency of its encoded protein PAI-1 detected by Western blot after transfection of si-Serpine1; C is the protein expression of CTGF, a marker of fibroblast activation, detected by Western blot; D is the representative immunofluorescence image and statistical results of α-SMA in fibroblasts detected after knockdown of Serpine1 in cardiac fibroblasts. n=3, **, p<0.01, ***, p<0.001.

[0022] Figure 3 This is a map of the adeno-associated virus vector used in the present invention.

[0023] Figure 4Knockdown of Serpine1 alleviates myocardial fibrosis and improves TAC-induced deterioration of cardiac function. A is the knockdown efficiency of AAV9-sh-Serpine1 in mice; B is the representative echocardiogram of each treatment group; C is the statistical results of ejection fraction (EF) and fraction shortening (FS) of each treatment group; D is the representative Masson staining of each treatment group and the statistical results of fibrosis area, the blue area is the obvious collagen deposition area, and E is the results of RT-qPCR detection of the expression of cardiac fibrosis marker genes Ccn2, Postn and Fibronectin in each treatment group; n=5-10, *, p<0.05, ***, p<0.001. DETAILED DESCRIPTION

[0024] PAI-1 encoded by Serpine1 is a member of the serine protease inhibitor family. It mainly regulates the hydrolysis of extracellular matrix proteins by inhibiting the activity of urokinase / tissue-type plasminogen activator (uPA / tPA), thereby promoting the accumulation of collagen and fibrosis. In organs such as the skin, lungs, kidneys, and liver, Serpine1 stimulates the accumulation of collagen through the SMAD-dependent TGF-β1 signaling pathway, thereby promoting the fibrotic process. However, the role of Serpine1 in myocardial fibrosis, especially the role of Serpine1 in myofibroblasts, remains to be elucidated.

[0025] The present invention first clarified through experiments that Serpine1 has an important function in myocardial fibrosis, and then provided a recombinant vector for knocking down Serpine1, which can target myofibroblasts in vivo and then treat myocardial fibrosis. The present invention first conducted a correlation analysis on the expression of SERPINE1 and fibrosis markers POSTN, CTGF and FIBRONECTIN in patients with myocardial fibrosis. It was found that there was a significant positive correlation between SERPINE1 and these markers. Then, the present invention conducted a cell function experiment. By synthesizing small interfering RNA (siRNA) and transfecting si-Serpine1 into myocardial fibroblasts, the activation level of myocardial fibroblasts was detected. The results showed that knocking down Serpine1 can reduce the activation of fibroblasts in mice, suggesting that Serpine1 may be related to myocardial fibrosis and can be used as a target for preparing drugs for the treatment of myocardial fibrosis.

[0026] After that, the present invention conducted animal experiments, constructed an adeno-associated virus (AAV) carrying the Periostin promoter (targeting myofibroblasts) to knock down Serpine1, injected and delivered the virus 1 week after thoracic aortic arch constriction surgery, and used echocardiography and pathological staining 4 weeks after thoracic aortic arch constriction surgery to evaluate the effect of knocking down Serpine1 on myocardial fibrosis and cardiac function in mice. The results showed that compared with mice in which Serpine1 was not knocked down, knocking down Serpine1 using an adeno-associated virus significantly reduced myocardial fibrosis caused by pressure overload and improved cardiac contractile function. The above study further confirmed that Serpine1 can be used as a target for the preparation of myocardial fibrosis drugs.

[0027] Based on this, the present application provides the use of the above-mentioned vector for reducing Serpine1 expression and the host cell containing the above-mentioned vector in the preparation of a drug for treating myocardial fibrosis.

[0028] The specific implementation modes of the present invention will be further explained below through examples, but it does not mean that the protection scope of the present invention is limited to the scope described in the examples.

[0029] Example 1 Correlation analysis between SERPINE1 and fibrosis markers in patients with myocardial fibrosis

[0030] Patient data were obtained from the dataset GSE141910 (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE141910) of the NCBI public database. Spearman correlation analysis was performed on the expression of SERPINE1 in fibrosis patients and the fibrosis markers POSTN, CTGF, and FIBRONECTIN. The analysis results are shown in Figure 1 As shown, the results showed that in the myocardial tissue of patients with fibrosis, the expression of SERPINE1 increased with the increase of POSTN, CTGF and FIBRONECTIN, indicating that SERPINE1 was significantly associated with myocardial fibrosis.

[0031] Example 2 In vitro experiments to verify the function of Serpine1

[0032] The present invention designs and synthesizes small interfering RNA (siRNA), and transfects si-Serpine1 in cardiac fibroblasts to study the effect of knocking down Serpine1 on fibroblast activation. The sequence of the synthesized small interfering RNA is as follows: GGCAGATCCAAGATGCTAT (SEQ ID NO: 2).

[0033] (1) Transfection of cardiac fibroblasts with si-Serpine1: When the cell density reaches about 60%, transfection of cardiac fibroblasts with si-NC and si-Serpine1 is performed using the transfection reagent RNAiMAX. The siRNA transfection concentration used is 50nM. Before transfecting siRNA and conducting functional experiments on cells, RT-qPCR and Western blot are used to detect the knockdown efficiency of si-si-Serpine1. The specific groups are ① negative control (si-NC) group: transfection with negative control siRNA; ② specific knockdown of Serpine1 (si-Serpine1) group: transfection with si-Serpine1 target sequence. Liposome transfection is used for transfection, using RNAiMAX is used as a transfection reagent for transfection. Before transfection, replace the culture medium in the cell culture plate with fresh culture medium. The volume is the regular volume minus the volume of transfection medium. The specific steps for adding transfection medium are as follows: Dilute RNAiMAX and siRNA in culture medium respectively; mix RNAiMAX dilution and siRNA in a ratio of 1:1 and incubate at room temperature for 5 minutes; add the mixture dropwise to the cell culture medium and shake gently to mix. Continue to culture cells, and detect knockdown efficiency after 24 hours or proceed to the next step of cell treatment.

[0034] (2) Detection of Serpine1 mRNA expression: RNA was extracted according to the instructions of the kit (Accurate Biotechnology, AG21024), and then reverse transcription and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4μL), Primer Mix (1μL), RT Enzyme Mix (1μL), RNA and RNAase free Water (14μL). The PCR amplification reaction system consists of the following components: SYBR Green Real time PCR Master Mix (10μL), upstream primer (10μM, 1μL); downstream primer (10μM, 1μL), cDNA and RNAase free Water (8μL); PCR reaction procedure is: pre-denaturation (95℃, 2min); amplification reaction (95℃, 10s; 59℃, 10s; 72℃, 15s), 40 cycles; melting curve analysis (65-95℃). The upstream primer of mouse Serpine1 is: AGATGCTATGGGATTCAAAGTCAA (SEQ ID NO: 3); the downstream primer of Serpine1 is: AGGTCCCGCTGGACAAAGA (SEQ ID NO: 4). The upstream primer of internal reference Gapdh is: CCTCGTCCCGTAGACAAAATG (SEQ ID NO: 5); the downstream primer of Gapdh is: AGGTCCCGCTGGACAAAGA (SEQ ID NO: 6). The results are shown in Figure 2 As shown in A, the results show that the siRNA sequence of SEQ ID NO: 2 has a high knockdown efficiency on Serpine1 mRNA expression.

[0035] (3) Detection of PAI-1 protein expression: Western blot was used to detect the protein expression of PAI-1 in cardiac fibroblasts: Cells were collected to extract proteins, and the proteins were quantified according to the instructions of the Bio-Tech BCA protein concentration kit (P0012). The loading buffer was added to the extracted proteins, and the proteins were denatured by heating at 95°C for 10 min. Then SDS-PAGE electrophoresis, transfer, blocking, and primary and secondary antibody incubation were performed. Finally, the PVDF membrane was developed and images were obtained, and the images were analyzed using Image J. The results are shown in Figure 2. Figure 2 B, the results show that the siRNA sequence of SEQ ID NO: 2 has a high knockdown efficiency on PAI-1 protein expression.

[0036] After confirming the knockdown efficiency of the target sequence, the cell function experiment of si-Serpine1 was carried out and the cells were divided into: ① negative control (si-NC) group; ② si-NC + TGF-β1 stimulation (si-NC + T) group; ③ knockdown Serpine1 (si-Serpine1) group; ④ si-Serpine1 + TGF-β1 stimulation (si-Serpine1 + T) group.

[0037] (4) Detection of fibroblast activation marker expression. After the cells were transfected with siRNA and stimulated with TGF-β1, the cells were collected and protein was extracted for western blot to detect the expression of fibroblast activation marker CTGF protein. The results are as follows: Figure 2 As shown in C, knockdown of Serpine1 significantly reduced the expression of CTGF protein increased by TGF-β1 stimulation, indicating that knockdown of Serpine1 can reduce the expression of cardiac fibroblast activation marker genes to a certain extent.

[0038] (5) Immunofluorescence staining: After the cells were transfected with siRNA and stimulated with TGF-β1, immunofluorescence staining of fibroblasts was performed according to the following steps to observe the activation of cells: discard the cell culture medium, gently rinse the cells twice with PBS buffer, add 4% paraformaldehyde to fix the cells, and fix them at room temperature for 15 minutes. Rinse with PBS on a shaker at low speed for 3 times, each time for 5 minutes. Permeabilize the cells with 0.5% Triton X-100 cell permeabilization solution at room temperature for 10 minutes. Rinse with PBS on a shaker at low speed for 3 times, each time for 5 minutes. Block the cells with 0.1% BSA blocking solution at room temperature for 30 minutes. After blocking, start incubation with primary antibody, add primary antibody diluted with antibody diluent (α-actinin ratio is 1:200), and incubate at 4°C overnight. The next day, rinse with PBS buffer 3 times and incubate with secondary antibody, and incubate at room temperature for 2 hours. Rinse with PBS buffer 3 times, each time for 5 minutes. Add DAPI staining solution to counterstain the cell nucleus, and incubate at room temperature for 10 minutes. Image acquisition: Observe and collect images using a confocal microscope and analyze them using Image J. Figure 2 As shown in D, knockdown of Serpine1 significantly reduced the increase in α-SMA fluorescence intensity caused by TGF-β1 stimulation, indicating that knockdown of Serpine1 can reduce the expression of marker proteins of cardiac fibroblast activation.

[0039] Example 3 In vivo experiments in mice to verify the function of Serpine1

[0040] (1) Thoracic aorta constriction (TAC) was used to construct a pressure overload-induced myocardial fibrosis mouse model. The specific operation steps are as follows: SPF-grade healthy C57BL / 6 mice (male, 6-8 weeks, 20-22g) were enrolled and randomly divided into a sham operation (Sham) group and a TAC group. The mice were anesthetized by isoflurane inhalation before surgery. The mice were fixed in a supine position, the chest hair of the mice was removed to expose the thorax, the mice were intubated, and the small animal ventilator was connected to maintain the breathing of the mice. The muscles were bluntly separated and the chest cavity was opened, the thymus was separated, and the aortic arch and the first, second, and third branches were exposed. A 5-0 silk thread was passed through the blood vessels between the first and second branches, and a 27G needle was used to ligate the aortic arch with silk thread, and then the needle was removed. After the thorax was opened, only the blood vessels were exposed and the thread was passed through the sham group mice, but the blood vessels were not ligated. The chest cavity was closed and the muscle layer and skin were sutured, and the surgical wound was disinfected with iodine. The vital signs of the mice were closely observed after surgery and they were kept in a conventional manner until the end of the experiment.

[0041] (2) An adeno-associated virus carrying the Periostin promoter targeting fibroblasts to knock down Serpine1 was constructed and commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd. The map of the Serpine1 knockdown vector is shown in the figure. Figure 3 As shown. Among them, the target gene knockdown sequence is shown in SEQ ID NO: 1, the upstream primer designed to obtain the target fragment is GCTTTCCGGTCGCCACCTAAAAGGTATATTGCTGTTGACAGTGAGCGGCTAT (SEQ ID NO: 7), and the downstream primer is ATCTGTGGCTTCACTAATTGACTTTGAATCCCATAGCCGCTCACTGTCAACA (SEQ ID NO: 8). The animal experiment timeline is shown in Figure 4 As shown in A, a myocardial fibrosis model was first established according to the method in step (1). At the first week after TAC surgery, the mice in the sham group and the TAC group were randomly divided into two groups and injected with negative control adeno-associated virus and adeno-associated virus knocking down Serpine1 through the tail vein, respectively. The virus injection titer for each mouse was 5×10 11 vg. The mice were kept as usual until the fourth week, when they were examined by ultrasound and samples were collected.

[0042] (3) Observation of cardiac structure and evaluation of cardiac function after TAC surgery in mice: Before ultrasound examination, mice were anesthetized by inhalation of isoflurane, and the anesthetized mice were fixed in a supine position on the monitoring platform. The chest hair of the mice was removed to expose the thorax, and the heart rate of the mice was maintained at 400-500 beats / min. The 3100 small animal high-frequency ultrasound imaging system was used, and the MX400 probe (30MHz) was selected. After continuous observation of several cardiac cycles in the long-axis section and short-axis section, the echocardiographic images were acquired using the grayscale mode (B mode) and the motion mode (M mode). After obtaining the echocardiogram, the Vevo LAB 5.5.1 software was used to analyze the images and calculate the ejection fraction and short-axis shortening rate to evaluate the cardiac function of the mice. The results are shown in Figure 4 As shown in CD, the results show that knocking down Serpine1 in animals significantly increased the ejection fraction and short-axis shortening rate. This result indicates that knocking down Sepine1 significantly improved the deterioration of cardiac function caused by TAC.

[0043] (4) Knockdown efficiency detection: The steps are the same as step (2) of Example 2, extract RNA from mouse heart, perform reverse transcription reaction and RT-qPCR, and detect the knockdown efficiency of Serpine1 in mouse myocardial tissue mediated by adeno-associated virus. The upstream and downstream primer sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively. The test results are shown in Figure 4 As shown in B, the results show that the efficiency of AAV-sh-Serpine1 for Serpine1 in mice is about 60%.

[0044] (5) Masson staining of cardiac tissue to assess the degree of cardiac fibrosis. After the ultrasound examination, the mice were euthanized, the chest cavity was opened and the heart was removed. The heart was placed on ice and washed with PBS buffer. After the heart tissue was fixed for 24 hours, it was routinely dehydrated, transparent, paraffin-embedded, and sliced. The slices were routinely dewaxed to water, stained with the prepared Weigert iron hematoxylin stain, differentiated with acid ethanol differentiation solution, reblued with Masson bluing solution, and stained with Ponceau fuchsin staining solution. Water washing was required between each staining. After Ponceau fuchsin staining, it was rinsed with weak acid working solution, then rinsed with phosphomolybdic acid solution, and then directly placed in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, it was quickly dehydrated with 95% ethanol, and then dehydrated with anhydrous ethanol for 3 times. Finally, it was transparentized with xylene for 3 times and sealed with neutral gum. After staining, the slices were scanned. After obtaining the scanned images, Image J software was used to analyze the myocardial collagen deposition. The results are shown in Figure 4 As shown in E, the results show that knocking down Serpine1 in animals significantly reduced the area of ​​cardiac fibrosis, which indicates that knocking down Serpine1 significantly reduced TAC-induced cardiac fibrosis.

Claims

1. Use of Serpine1 gene as a target in the preparation of drugs for preventing or treating myocardial fibrosis.

2. Application of Serpine1 gene as a target for screening drugs for preventing or treating myocardial fibrosis.

3. An expression vector for reducing Serpine1 expression.

4. The expression vector according to claim 3, characterized in that: The expression vector is a viral vector; preferably an adeno-associated viral vector.

5. The expression vector according to claim 4, characterized in that: The target gene nucleotide sequence of the vector is SEQ ID NO:

1.

6. The expression vector according to claim 3, characterized in that: The Periostin promoter is also included.

7. A host cell comprising the expression vector according to any one of claims 3 to 6.

8. Use of the expression vector according to any one of claims 3 to 6 and the host cell according to claim 7 in the preparation of a drug for preventing or treating myocardial fibrosis.

9. The use according to claim 1 or 8, characterized in that: The myocardial fibrosis is myocardial fibrosis induced by pressure overload.

10. The use according to claim 1 or 8, characterized in that: The myocardial fibrosis includes impaired cardiac contractile function or inhibition of myocardial fibroblast activation.

Images