Use of serpinel gene as a target in preparation of drugs for preventing or treating myocardial fibrosis

Abstract

The application belongs to the technical field of biological medicine, and particularly relates to a use of Serpine1 gene as a target in preparation of a drug for preventing or treating myocardial fibrosis. In order to screen key molecules for intervention and regulation of extracellular matrix balance, and provide a basis for development of a drug for preventing or treating myocardial fibrosis, the application determines important functions of Serpine1 in myocardial fibrosis through experiments, and provides a use of Serpine1 gene as a target in preparation of a drug for preventing or treating myocardial fibrosis. The application verifies through experiments that knocking down expression of Serpine1 can improve impaired cardiac systolic function caused by thoracic aortic arch constriction for 4 weeks, reduce myocardial fibrosis, and inhibit activation of myocardial fibroblasts, and can be used for preparation of a drug for preventing or treating myocardial fibrosis, and has important practical significance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to the use of Serpine1 gene as a target in the preparation of a drug for preventing or treating myocardial fibrosis. BACKGROUND

[0002] Myocardial fibrosis is still an unsolved problem in heart disease and one of the main causes of heart failure. When the heart is damaged, myocardial fibroblasts are activated and then differentiate into myofibroblasts, which are the main mediator cells of myocardial fibrosis and pathological cardiac remodeling. Myofibroblasts mainly exhibit proliferation and secretion characteristics. With the continuous development of injury, myofibroblasts overproliferate and secrete extracellular matrix, leading to a disorder in the proportion of original extracellular matrix components and causing pathological cardiac remodeling, and ultimately leading to heart failure and death. Inhibition or reversal of myocardial fibrosis has become one of the goals of clinical treatment of heart disease. However, the mechanism of myocardial fibrosis has not been fully elucidated, and anti-fibrosis treatment lacks specific targets. Current clinical anti-fibrosis treatments mainly include RAAS inhibitors, including angiotensin-converting enzyme inhibitors, angiotensin receptor antagonists, aldosterone receptor antagonists spironolactone and eplerenone, etc., but they are still in the clinical research stage. Therefore, screening key targets that regulate myocardial fibrosis, especially key molecules in myofibroblasts, and performing cell-specific intervention on them, are of great significance for targeted treatment of myocardial fibrosis and early intervention of heart failure.

[0003] Myocardial extracellular matrix is a complex three-dimensional network structure mainly composed of various proteins and sugars such as collagen and elastin. The increase in proliferation and secretion of myofibroblasts leads to a disorder in the extracellular matrix, which is the main cause of myocardial fibrosis and pathological cardiac remodeling. Therefore, targeting myofibroblasts to intervene in key molecules that regulate extracellular matrix balance may be an important way and strategy for anti-fibrosis treatment.

[0004] However, there are many key molecules that regulate extracellular matrix balance, and how to target myofibroblasts and screen effective key molecules that regulate extracellular matrix balance has become a key problem in the study of anti-myocardial fibrosis.

[0005] At present, the role of Serpine1 in myocardial fibrosis, especially the role of Serpine1 in myofibroblasts, remains to be elucidated. SUMMARY

[0006] The technical problem to be solved by the present application is to screen key molecules that regulate extracellular matrix balance, and to provide a basis for the development of drugs for preventing or treating myocardial fibrosis.

[0007] The application solves the above technical problems by providing a use of a Serpine1 gene as a target in the preparation of a drug for preventing or treating myocardial fibrosis.

[0008] The application also provides a use of a Serpine1 gene as a target in the preparation of a drug for preventing or treating myocardial fibrosis.

[0009] The application also provides an expression vector for reducing the expression of Serpine1.

[0010] Further, the expression vector is a viral vector, preferably an adeno-associated viral vector.

[0011] Further, the nucleotide of the target gene knockdown sequence of the expression vector is SEQ ID NO: 1.

[0012] The target gene knockdown sequence sh-Serpine1 of SEQ ID NO: 1 is GCTATGGGATTCAAAGTCAAT.

[0013] Further, the expression vector also comprises a Periostin promoter.

[0014] The application also provides a host cell comprising the above expression vector.

[0015] Further, the application also provides a use of the above expression vector for reducing the expression of Serpine1 and the host cell in the preparation of a drug for preventing or treating myocardial fibrosis.

[0016] Further, in the use, the myocardial fibrosis is pressure overload-induced myocardial fibrosis.

[0017] Further, in the use, the myocardial fibrosis comprises impaired cardiac contractile function or inhibition of cardiac fibroblast activation.

[0018] The application has the following beneficial effects:

[0019] The application firstly determines the important function of Serpine1 in myocardial fibrosis, provides a use of a Serpine1 gene as a target in preparation of a drug for preventing or treating myocardial fibrosis, and further provides a drug for treating myocardial fibrosis. The application finds through experimental research that knocking down Serpine1 can reduce myocardial fibrosis, especially has a good effect on pressure overload-induced myocardial fibrosis, can improve the impaired cardiac systolic function caused by thoracic aortic arch constriction for 4 weeks, and has an effect of reducing myocardial fibrosis, and knocking down Serpine1 in myocardial fibroblasts can inhibit the activation of myocardial fibroblasts. Based on this, the application further provides a drug for treating myocardial fibrosis, and provides a new idea for the treatment of heart failure diseases. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 Correlation analysis of SERPINE1 expression and fibrosis marker genes POSTN, CTGF and FIBRONECTIN in myocardial fibrosis patients.

[0021] Figure 2 Knocking down Serpine1 to reduce TGF-β1-induced activation of myocardial fibroblasts. A is the knockdown efficiency of Serpine1 detected by real-time quantitative PCR (RT-qPCR) after transfection of si-Serpine1 in myocardial fibroblasts; B is the knockdown efficiency of the protein PAI-1 encoded by si-Serpine1 detected by Western blot; C is the protein expression of the fibroblast activation marker CTGF detected by Western blot; D is the immunofluorescence representative graph and statistical results of fibroblast alpha-SMA after knocking down Serpine1 in myocardial fibroblasts. n=3, **, p<0.01, ***, p<0.001.

[0022] Figure 3 Adeno-associated virus vector map used in the application.

[0023] Figure 4To knock down Serpine1 to reduce myocardial fibrosis and improve cardiac function deterioration caused by TAC. Among them, A is the knockdown efficiency of AAV9-sh-Serpine1 in mice in vivo; B is the representative graph of echocardiogram of each treatment group; C is the statistical result of ejection fraction (EF) and fraction shortening (FS) of each treatment group; D is the representative graph of Masson staining and fibrosis area statistics of each treatment group, the blue area is the obvious collagen deposition area, E is the result of RT-qPCR detection of the expression of fibrosis marker genes Ccn2, Postn and Fibronectin in each treatment group; n = 5-10, *, p < 0.05, ***, p < 0.001. DETAILED DESCRIPTION

[0024] PAI-1 encoded by Serpine1 is a member of the serine protease inhibitor family, which mainly regulates the hydrolysis of extracellular matrix proteins by inhibiting the activity of urokinase / tissue-type plasminogen activator (uPA / tPA), thereby promoting the accumulation of collagen and fibrosis. In organs such as skin, lung, kidney and liver, Serpine1 stimulates the accumulation of collagen through the SMAD-dependent TGF-β1 signaling pathway, thereby promoting the fibrosis process. However, the role of Serpine1 in myocardial fibrosis, especially the role of Serpine1 in myofibroblasts, remains to be elucidated.

[0025] The present application first determines through experiments that Serpine1 has an important function in myocardial fibrosis, and further provides a recombinant vector for knocking down Serpine1, which can target myofibroblasts in vivo, and thus treat myocardial fibrosis. The present application first performs a correlation analysis on the expression of SERPINE1 and the fibrosis markers POSTN, CTGF and FIBRONECTIN in myocardial fibrosis patients. It is found that SERPINE1 is significantly positively correlated with these markers. Then, the present application performs a cell function experiment. By synthesizing small interfering RNA (siRNA) and transfecting si-Serpine1 in myocardial fibroblasts, the activation level of myocardial fibroblasts is detected. The results show that knocking down Serpine1 can reduce the activation of fibroblasts in mice, suggesting that Serpine1 may be related to myocardial fibrosis and can be used as a target for preparing drugs for treating myocardial fibrosis.

[0026] Thereafter, the present application further carried out animal experiments, constructed an adeno-associated virus (AAV) carrying a Periostin promoter (targeting muscle fibroblasts) knockdown Serpine1, injected and delivered the virus at 1 week after coarctation of the aorta, and evaluated the effect of knockdown Serpine1 on myocardial fibrosis and mouse heart function at 4 weeks after coarctation of the aorta by echocardiography, pathological staining, etc. The results showed that compared with mice without knockdown Serpine1, knockdown Serpine1 by adeno-associated virus significantly reduced myocardial fibrosis caused by pressure overload and improved cardiac systolic function. The above study further confirmed that Serpine1 can be used as a target for the preparation of myocardial fibrosis drugs.

[0027] Based on this, the present application provides the use of the above-mentioned vector for reducing the expression of Serpine1, the host cell comprising the above-mentioned vector in the preparation of a myocardial fibrosis drug.

[0028] The specific embodiments of the present application will be further explained by the following examples, but it does not mean that the protection scope of the present application is limited within the scope described in the examples.

[0029] Example 1 Correlation analysis of SERPINE1 and fibrosis markers in myocardial fibrosis patients

[0030] The patient data is from the data set GSE141910 (https: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE141910) of the NCBI public database, and Spearman correlation analysis is performed on the expression of SERPINE1 and the fibrosis markers POSTN, CTGF and FIBRONECTIN in fibrosis patients. The analysis results are shown in Figure 1 The results show that in the myocardial tissue of fibrosis patients, the expression of SERPINE1 increases with the increase of POSTN, CTGF and FIBRONECTIN, indicating that SERPINE1 is significantly related to myocardial fibrosis.

[0031] Example 2 In vitro experiment to verify the function of Serpine1

[0032] The present application designs and synthesizes small interfering RNA (siRNA), and transfects si-Serpine1 in myocardial fibroblasts to study the effect of knockdown Serpine1 on fibroblast activation. The sequence of the synthesized small interfering RNA is as follows: GGCAGATCCAAGATGCTAT (SEQ ID NO: 2).

[0033] (1) si-Serpine1 transfected myocardial fibroblasts: when the cell density needs to reach about 60%, si-NC and si-Serpine1 are transfected into myocardial fibroblasts using transfection reagent RNAiMAX. The siRNA transfection concentration used is 50 nM. Before transfecting siRNA and performing functional experiments on the cells, the knockdown efficiency of si-si-Serpine1 is detected using RT-qPCR and Western blot, and the specific grouping is as follows: ① negative control (si-NC) group: negative control siRNA is used for transfection; ② specific knockdown Serpine1 (si-Serpine1) group: si-Serpine1 target sequence is transfected. Lipofectin is used for transfection, and RNAiMAX is used as the transfection reagent. Before transfection, the culture medium in the cell culture plate is replaced with fresh culture medium, and the volume is the conventional volume minus the transfection liquid volume. The specific operation steps for adding the transfection liquid are as follows: dilute RNAiMAX and siRNA with culture medium respectively; mix the RNAiMAX diluent and siRNA 1:1 thoroughly, and incubate at room temperature for 5 min; add the above mixture dropwise into the cell culture medium, and mix gently. Continue to culture the cells, and the knockdown efficiency can be detected 24 h or the cells can be subjected to the next step of processing.

[0034] ​(2) Detection of mRNA expression of Serpine1: After RNA extraction according to the method of the kit (Accurate Biotechnology, AG21024), reverse transcription reaction and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5x Reverse Transcription buffer (4 μL), Primer Mix (1 μL), RT Enzyme Mix (1 μL), RNA and RNAase free Water (14 μL). The PCR amplification reaction system consists of the following components: SYBR Green Real time PCR Master Mix (10 μL), upstream primer (10 μM, 1 μL); downstream primer (10 μM, 1 μL), cDNA and RNAase free Water (8 μL); PCR reaction program: pre-denaturation (95°C, 2 min); amplification reaction (95°C, 10 s; 59°C, 10 s; 72°C, 15 s), 40 cycles; melting curve analysis (65-95°C). The upstream primer of mouse Serpine1 is: AGATGCTATGGGATTCAAAGTCAA (SEQ ID NO: 3); the downstream primer of Serpine1 is: AGGTCCCGCTGGACAAAGA (SEQ ID NO: 4). The upstream primer of Gapdh is: CCTCGTCCCGTAGACAAAATG (SEQ ID NO: 5); the downstream primer of Gapdh is: AGGTCCCGCTGGACAAAGA (SEQ ID NO: 6). The results are shown in Figure 2 As shown in A, the results show that the siRNA sequence of SEQ ID NO: 2 has a high knockdown efficiency on the mRNA expression of Serpine1.

[0035] (3) Detection of PAI-1 protein expression: Western blot was used to detect the protein expression of PAI-1 in cardiac fibroblasts: the extracted protein was collected and quantified according to the instruction of Biyun Tian BCA protein concentration kit (P0012). The loading buffer was added to the extracted protein, and the protein was denatured at 95°C for 10 min. Then SDS-PAGE electrophoresis, membrane transfer, blocking and primary and secondary antibody incubation were performed. Finally, the PVDF membrane was developed and the image was obtained, and the image was analyzed by Image J. The results are shown in Figure 2 B, the results show that the siRNA sequence of SEQ ID NO: 2 has a high knockdown efficiency on the protein expression of PAI-1.

[0036] After confirming the knockdown efficiency of the target sequence, cell function experiments of si-Serpine1 were performed. The groups were as follows: ① negative control (si-NC) group; ② si-NC + TGF-β1 stimulation (si-NC + T) group; ③ knockdown of Serpine1 (si-Serpine1) group; and ④ si-Serpine1 + TGF-β1 stimulation (si-Serpine1 + T) group.

[0037] (4) Detection of fibroblast activation marker expression. After siRNA transfection and TGF-β1 stimulation, the cells were collected to extract proteins for western blot, and the expression of the fibroblast activation marker CTGF protein was detected. The results are shown in Figure 2 C, and knockdown of Serpine1 significantly reduced the increased expression of CTGF protein induced by TGF-β1 stimulation. It was shown that knockdown of Serpine1 could reduce the expression of the activation marker gene of cardiac fibroblasts to a certain extent.

[0038] (5) Immunofluorescence staining: After siRNA transfection and TGF-β1 stimulation, in order to observe the activation of the cells, the fibroblasts were immunofluorescence stained according to the following steps: discard the cell culture medium, gently rinse the cells with PBS buffer for 2 times, add 4% paraformaldehyde to fix the cells, and fix at room temperature for 15 min. Rinse with PBS on a shaker at low speed for 3 times, 5 min each time. Permeabilize the cells with 0.5% Triton X-100 at room temperature for 10 min. Rinse with PBS on a shaker at low speed for 3 times, 5 min each time. Block the cells with 0.1% BSA blocking solution at room temperature for 30 min. After blocking, start incubating the primary antibody, add the diluted primary antibody (α-actinin ratio 1:200) after dilution with antibody diluent, and incubate overnight at 4°C. The next day, rinse with PBS buffer for 3 times, then incubate the secondary antibody, and incubate at room temperature for 2 h. Rinse with PBS buffer for 3 times, 5 min each time. Add DAPI staining solution to restain the cell nucleus, and incubate at room temperature for 10 min. Image acquisition: observe and collect images with a confocal microscope, and analyze the images with Image J. The results are shown in Figure 2 D, and knockdown of Serpine1 significantly reduced the increased expression of CTGF protein induced by TGF-β1 stimulation. It was shown that knockdown of Serpine1 could reduce the expression of the activation marker gene of cardiac fibroblasts to a certain extent.

[0039] Example 3 In vivo experiment in mice to verify the function of Serpine1

[0040] (1) Construct a mouse model of myocardial fibrosis induced by pressure overload using thoracic aorta constriction (TAC) operation. The specific operation steps are as follows: SPF healthy C57BL / 6 mice (male, 6-8 weeks, 20-22 g) are included, and randomly divided into sham operation (Sham) group and TAC group. Before operation, the mice are anesthetized by isoflurane inhalation. The mouse is fixed in supine position, the chest hair of the mouse is removed to expose the thoracic cavity, the trachea of the mouse is intubated, and the small animal respirator is connected to maintain the respiration of the mouse. Open the chest and bluntly separate the muscle and open the chest, separate the thymus, expose the aortic arch and the first, second and third branches. Pass a 5-0 silk thread through the blood vessels between the first and second branches, and tie the silk thread with a 27G needle close to the aortic arch, then remove the needle. The mice in the Sham group are only exposed to the blood vessels after opening the chest, but not tied. Close the chest and suture the muscle layer and skin, and disinfect the surgical wound with iodophor. After operation, the vital signs of the mice are closely observed, and they are routinely fed until the end of the experiment.

[0041] (2) Construct an adeno-associated virus carrying Periostin promoter targeting fibroblast knockdown Serpine1, and entrust Han Heng Biotechnology (Shanghai) Co., Ltd. to synthesize. The knockdown Serpine1 vector map is shown in Figure 3 . The knockdown sequence of the target gene is shown as SEQ ID NO: 1, the upstream primer designed to obtain the target fragment is GCTTTCCGGTCGCCACCTAAAAGGTATATTGCTGTTGACAGTGAGCGGCTAT (SEQ ID NO: 7), and the downstream primer is ATCTGTGGCTTCACTAATTGACTTTGAATCCCATAGCCGCTCACTGTCAACA (SEQ ID NO: 8). The animal experiment timeline is shown in Figure 4 A, first construct a myocardial fibrosis model according to the method in step (1), and at 1 week after TAC operation, the mice in the Sham group and the TAC group are randomly divided into two groups, and are respectively given negative control adeno-associated virus and knockdown Serpine1 adeno-associated virus by tail vein injection, and the virus injection titer of each mouse is 5x10 11 v.g. Continue to feed the mice routinely until the 4th week, and perform ultrasonic examination and sample collection.

[0042] (3) Observation of heart structure and evaluation of heart function after TAC operation in mice: Before ultrasonic examination, the mice are anesthetized by isoflurane inhalation, and the anesthetized mice are fixed on the monitoring table in supine position, the chest hair of the mouse is removed to expose the thoracic cavity, and the heart rate of the mouse is maintained at 400-500 times / min. Use 3100 small animal high frequency ultrasound imaging system, select MX400 probe (30 MHz), after observing several cardiac cycles in long axis and short axis section respectively, using gray scale mode (B mode) and motion mode (M mode) to collect echocardiogram images. After obtaining echocardiogram, using Vevo LAB 5.5.1 software to analyze images and calculate ejection fraction and fractional shortening to evaluate mouse heart function. Results are shown in Figure 4 As shown in C-D, the results show that knockdown of Serpine1 in vivo significantly increases ejection fraction and fractional shortening, which indicates that knockdown of Sepine1 significantly improves the deterioration of heart function caused by TAC.

[0043] (4) Knockdown efficiency detection: the steps are the same as step (2) of example 2. RNA is extracted from mouse heart, reverse transcription reaction and RT-qPCR are carried out, and the knockdown efficiency of adeno-associated virus mediated mouse myocardial tissue Serpine1 is detected. The sequences of upstream and downstream primers are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively. The detection results are shown in Figure 4 As shown in B, the results show that the efficiency of AAV-sh-Serpine1 in mice is about 60%.

[0044] (5) Masson staining of heart tissue to evaluate the degree of cardiac fibrosis. After ultrasound examination, the mice were euthanized, the chest was opened, the heart was taken out, and the heart was washed with PBS buffer on ice. After the heart tissue was fixed for 24 h, the conventional dehydration, transparency, paraffin embedding, sectioning was carried out, the section was deparaffinized to water, and the prepared Weigert iron hematoxylin staining solution was used for staining, acid ethanol differentiation solution was used for differentiation, Masson blue solution was used for blue, and Lichun Hong was used for staining. After each staining, water washing was required. After Lichun Hong staining, the weak acid working solution was washed, and then the phosphomolybdate solution was washed. Then it was directly put into aniline blue staining solution for staining, and then it was washed with prepared weak acid working solution, and then it was quickly dehydrated with 95% ethanol, and then it was dehydrated with anhydrous ethanol for 3 times, and finally it was transparent with xylene for 3 times, and then it was sealed with neutral gum. After staining, the section was scanned. After obtaining the scanning image, the myocardial collagen deposition was analyzed by Image J software. Results are shown in Figure 4 As shown in E, the results show that knockdown of Serpine1 in vivo significantly reduces the fibrosis area of the heart, which indicates that knockdown of Serpine1 significantly reduces the cardiac fibrosis caused by TAC.

Claims

1. Use of an expression vector for reducing expression of a Serpine1 gene or a host cell comprising the expression vector in the preparation of a medicament for preventing or treating myocardial fibrosis; the myocardial fibrosis is pressure overload-induced myocardial fibrosis; the nucleotide sequence of the gene of interest of the expression vector for reducing expression of a Serpine1 gene is SEQ ID NO: 1, and further comprises a Periostin promoter.

Images