Compositions and methods for targeted RNA delivery

Abstract

Provided herein are compositions, methods of making the same, and methods for targeted delivery of therapeutic agents to alter the expression and function of target genes, such as proteins involved in lipid and cholesterol metabolism, such as PCSK9. Also provided herein are compositions and methods for treating conditions associated with coronary artery disease.

Description

[0001] This application is a divisional application of the Chinese patent application with an application date of March 4, 2021, application number 202180033341.7, and invention name “Compositions and methods for targeted RNA delivery” (the corresponding PCT application with an application date of March 4, 2021, application number PCT / US2021 / 020955).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the benefit of U.S. Provisional Application No. 63 / 078,982, filed September 16, 2020, and U.S. Provisional Application No. 62 / 984,866, filed March 4, 2020, which are hereby incorporated by reference in their entireties.

[0004] Sequence Listing

[0005] This application contains a sequence listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy was created on March 3, 2021, is named 53989706601_SL.txt, and is 67,230 bytes in size. Technical Field

[0006] The present invention relates to compositions and methods for the targeted delivery of therapeutic agents, such as CRISPR-guide RNA and other nucleic acid agents. Background Art

[0007] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication referenced, whether expressly or implicitly, is prior art. Summary of the Invention

[0008] In one aspect, described herein is a receptor-targeted conjugate comprising a compound of formula (V):

[0009]

[0010] in,

[0011] Multiple A groups collectively comprise a receptor targeting ligand;

[0012] L 1 , L 2 , L 3 , L 4 , L 5 , L6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -OR-N(OR 1 )-;

[0013] L 11 is substituted or unsubstituted -(CH2CH2O) n -, or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0014] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0015] m is an integer selected from 1 to 10; and

[0016] n is an integer selected from 1 to 200.

[0017] In some embodiments, L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12In some embodiments, L 1 , L 4 and L 7 Each is independently a substituted or unsubstituted C2-C6 alkylene. 1 , L 4 and L 7 In some embodiments, L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR1C(=O)NR 1 -or-C(=O)NR 1 C(=O)-. In some embodiments, L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -or-NR 1 C(=O)-. In some embodiments, L 2 , L 5 and L 8 Each is -C(=O)NH-. In some embodiments, L 3 , L 6 and L 9 are each independently substituted or unsubstituted C1-C 12 In some embodiments, L 3 Each is a substituted or unsubstituted C2-C6 alkylene. In some embodiments, L 3 In some embodiments, L 6 and L 9 are each independently substituted or unsubstituted C2-C 10 In some embodiments, L 6 and L 9 Each is independently a substituted or unsubstituted C2-C6 alkylene. 6 and L 9 In one aspect, a receptor-targeted conjugate is described herein comprising a compound of formula (VI):

[0018]

[0019] in,

[0020] Multiple A groups collectively comprise a receptor targeting ligand;

[0021] L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -OR-N(OR 1 )-;

[0022] L 11 is substituted or unsubstituted -(CH2CH2O) n -, or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0023] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0024] m is an integer selected from 1 to 10; and

[0025] n is an integer selected from 1 to 200.

[0026] In some embodiments, L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 Alkylene, or substituted or unsubstituted C1-C 12 In some embodiments, L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 In some embodiments, L 1 , L 4 and L 7 Each independently is a substituted or unsubstituted C1-C 12 In some embodiments, L 1 , L 4 and L 7 Each independently is -(CH2CH2O) p1 -(CH2) q1 -; wherein p1 is 1-8; and q1 is 1-6. In some embodiments, L 1 , L 4 and L 7 Each is -(CH2CH2O)3-(CH2)2-. In some embodiments, L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 In some embodiments, L 1 , L 4 and L 7 Each is independently a substituted or unsubstituted C2-C6 alkylene. 1 , L 4 and L 7 In some embodiments, L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -or-C(=O)NR 1 C(=O)-. In some embodiments, L 2 , L5 and L 8 Each is independently -C(=O)NR 1 -or-NR 1 C(=O)-. In some embodiments, L 2 , L 5 and L 8 Each is -NHC(=O)-. In some embodiments, L 2 , L 5 and L 8 Each is -C(=O)NH-. In some embodiments, L 3 , L 6 and L 9 are each independently substituted or unsubstituted C1-C 12 In some embodiments, L 3 , L 6 and L 9 Each independently is a substituted or unsubstituted C1-C 12 In some embodiments, L 3 , L 6 and L 9 Each independently is -(CH2CH2O) p2 -(CH2CH2CH2O) q2 -; wherein p2 is 1-8; and q2 is 1-6. In some embodiments, L 3 , L 6 and L 9 Each is -(CH2CH2O)-(CH2CH2CH2O)-. In some embodiments, L 3 , L 6 and L 9 Each independently is -(CH2CH2CH2O) q3 -; wherein q3 is 1-8. In some embodiments, L 3 , L 6 and L 9 Each is -(CH2CH2CH2O)2-. In some embodiments, L 10 is substituted or unsubstituted C1-C 12 In some embodiments, L 10 is a substituted or unsubstituted C1-C4 alkylene group. 10 In some embodiments, L 11 -(OCH2CH2) n-. In some embodiments, n is 1-100. In some embodiments, n is 2-50. In some embodiments, n is 2, 12, 37 or 45. In some embodiments, L 12 is -O-, -C(=O)O-, -C(=O)NR 1 -、-NR 1 C(=O)- or -NR 1 C(=O)O-. In some embodiments, L 12 -C(=O)O- or -NR 1 C(=O)O-. In some embodiments, L 12 is -C(=O)O-. In some embodiments, L 12 is -NHC(=O)O-. In some embodiments, L 12 In some embodiments, A binds to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, A is N-acetylgalactosamine (GalNAc) or a derivative thereof. or its derivatives. A is N-acetylgalactosamine (GalNAc) or a derivative thereof. In some embodiments, each R 1 is independently H or -CH3. In some embodiments, each R 1 is H. In some embodiments, R comprises one or more of a fatty alcohol, a fatty acid, a glycerolipid, a glycerophospholipid, a sphingolipid, a glycolipid, a polyketide, a sterol lipid, and a prenol lipid. In some embodiments, R comprises one or more fatty alcohols. In some embodiments, each fatty alcohol is independently a saturated, monounsaturated, or polyunsaturated fatty alcohol. In some embodiments, the fatty alcohol comprises one or more C2-C 26 Fatty alcohol. In some embodiments, the fatty alcohol comprises two or more C2-C 26Fatty alcohol. In some embodiments, each fatty alcohol is a C12, C14, C16, C18, C20 or C22 fatty alcohol. In some embodiments, each fatty alcohol is independently docosahexaenol, eicosapentaenol, oleyl alcohol, stearyl alcohol, (9Z, 12Z)-octadeca-9,12-dien-1-yl alcohol, (Z)-docosa-13-en-1-yl alcohol, docosanol, (E)-octadeca-9-en-1-yl alcohol, eicosanol, (9Z, 12Z, 15Z)-octadeca-9,12,15-trien-1-yl alcohol or palmityl alcohol. In some embodiments, each fatty alcohol is stearyl alcohol. In some embodiments, R includes one or more sterol lipids. In some embodiments, R includes one or more of vitamins. In some embodiments, each vitamin is independently vitamin A, vitamin D, vitamin E or vitamin K. In some embodiments, R includes nucleic acids. In some embodiments, the nucleic acid is mRNA, guide RNA, siRNA, antisense oligonucleotide, aptamer, microRNA, immunostimulatory oligonucleotide, splice switching oligonucleotide, self-amplifying RNA, circular RNA or DNA, but is not limited to the above nucleic acids. In some embodiments, R comprises a protein. In some embodiments, the protein is a gene editor protein, an antibody, an antigen-binding antibody fragment or a peptide, but is not limited to the above proteins.

[0027] In one aspect, described herein is a receptor-targeted conjugate comprising a compound from Table 4.

[0028] In one aspect, a nanoparticle composition is described herein, comprising: (a) one or more nucleic acid molecule entities; and (b) a receptor-targeted conjugate as described herein. In some embodiments, the receptor-targeted conjugate accounts for about 0.001 mol% to about 20 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the receptor-targeted conjugate accounts for about 0.01 mol% to about 1 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, a sterol or a derivative thereof is included, accounting for 10 mol% to 70 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the sterol or a derivative thereof is cholesterol or a cholesterol derivative. In some embodiments, cholesterol or a cholesterol derivative accounts for 20 mol% to 50 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the nanoparticle composition comprises phospholipids, which account for 1 mol% to 20 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, phospholipids account for about 5 mol% to about 15 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the phospholipid is selected from 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 2-oleoyl-1-palmitoyl-sn-glycero-3-phosphocholine (POPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) and sphingomyelin. In some embodiments, the phospholipid is DSPC. In some embodiments, the nanoparticle composition comprises a stealth lipid, and the stealth lipid accounts for 0.1 mol% to 6 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the stealth lipid accounts for about 2.0 mol% to about 2.5 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the stealth lipid is a PEG-lipid having a number average molecular weight of about 200 Da to about 5000 Da. In some embodiments, the nanoparticle composition comprises an amino lipid, which accounts for about 10 mol% to about 60 mol% of the total lipid content present in the nanoparticle composition. In some embodiments, the nanoparticle composition comprises an antioxidant. In some embodiments, the antioxidant comprises ethylenediaminetetraacetic acid (EDTA). In some embodiments, one or more nucleic acid molecule entities comprise a single guide RNA (sgRNA) or guide RNA (gRNA) targeting a pathogenic gene of interest produced in hepatocytes. In some embodiments, one or more nucleic acid molecule entities comprise an mRNA encoding a Cas nuclease. In some embodiments, at least one of the one or more nucleic acid molecule entities comprises a chemical modification.In some embodiments, the chemical modification is a 2'-F modification, a phosphorothioate internucleotide linkage modification, an acyclic nucleotide, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-fluoro, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 4'-O-methyl, or 2'-ara-F modification. In some embodiments, the chemical modification is a 2'-O-methyl modification.

[0029] In one aspect, provided herein is a pharmaceutical composition comprising a receptor-targeted conjugate as described herein or a nanoparticle composition as described herein, and an excipient or carrier. In some embodiments, the pharmaceutical composition comprises an mRNA encoding a gene editor nuclease. In some embodiments, the pharmaceutical composition comprises one or more guide RNA molecules. In some embodiments, the pharmaceutical composition comprises two or more guide RNA molecules. In some embodiments, two or more guide RNA molecules target two or more target genes. In some embodiments, the mRNA encodes a Cas9 nuclease. In some embodiments, the mRNA encodes a base editor nuclease. In some embodiments, the mRNA and one or more guide RNA molecules are present in the same nanoparticle composition. In some embodiments, the mRNA and one or more guide RNA molecules are present in different nanoparticle compositions. In some embodiments, the ratio of gRNA molecules to mRNA in the pharmaceutical composition is about 0.01 to about 100 (by weight or by mole). In some embodiments, the ratio of the gRNA molecules to the mRNA in the pharmaceutical composition is about 50:1, about 40:1, about 30:1, about 20:1, about 18:1, about 16:1, about 14:1, about 12:1, about 10:1, about 9:1, about 8:1, about 7:1, about 6:1, about 5:1, about 4:1, about 3:1, about 2:1, about 1:1, about 1:2, about 1:3, about 1:4, about 1:5, about 1:6, about 1:7, about 1:8, about 1:9 or about 1:10 (by weight or by mole).

[0030] In one aspect, provided herein is a pharmaceutical composition comprising: (a) a first receptor-targeted conjugate or a first nanoparticle composition as described herein, and (b) a second receptor-targeted conjugate or a second nanoparticle composition as described herein. In some embodiments, the first nanoparticle composition comprises a gene editor mRNA. In some embodiments, the second nanoparticle composition comprises one or more guide RNA molecules. In some embodiments, the ratio of guide RNA molecules to mRNA in the pharmaceutical composition is about 50: 1, about 40: 1, about 30: 1, about 20: 1, about 18: 1, about 16: 1, about 14: 1, about 12: 1, about 10: 1, about 9: 1, about 8: 1, about 7: 1, about 6: 1, about 5: 1, about 4: 1, about 3: 1, about 2: 1, about 1: 1, about 1: 2, about 1: 3, about 1: 4, about 1: 5, about 1: 6, about 1: 7, about 1: 8, about 1: 9 or about 1: 10 (by weight or by mole).

[0031] In one aspect, the present invention provides a method for delivering a nucleic acid to a cell, the method comprising contacting the cell with a nanoparticle composition or a pharmaceutical composition as described herein, thereby delivering the nucleic acid to the cell. In some embodiments, the cell is contacted in vivo, ex vivo, or in vitro.

[0032] In one aspect, provided herein is a method of producing a polypeptide of interest in a cell, the method comprising contacting the cell with a nanoparticle composition or a pharmaceutical composition as described herein, whereby the nucleic acid can be translated in the cell to produce the polypeptide.

[0033] On the one hand, there is provided herein a method for treating a disease or the patient's condition of a subject, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described herein to the subject. In some embodiments, the disease or the patient's condition is coronary artery disease. In some embodiments, the subject is a low-density lipoprotein receptor (LDLR) defective. In some embodiments, the subject has heterozygous familial hypercholesterolemia (HeFH), homozygous familial hypercholesterolemia (HoFH) or clinical atherosclerotic cardiovascular disease (ASCVD). In some embodiments, the subject is at high risk for cardiovascular events. In some embodiments, although lipid-lowering therapy is tolerated to the greatest extent possible, the subject still needs to reduce low-density lipoprotein cholesterol (LDL-C) in addition.

[0034] In one aspect, provided herein is a method of delivering a nucleic acid molecular entity to the liver of a subject, the method comprising administering to the subject a pharmaceutical composition as described herein, thereby delivering the nucleic acid molecular entity.

[0035] On the one hand, a nucleotide conjugate is described herein, comprising: (a) a nucleic acid, and (b) a targeting moiety connected to the nucleic acid in (a), wherein the targeting moiety comprises the structure of Table 1. In some embodiments, the targeting moiety further comprises a coupling sequence that hybridizes with the nucleic acid in (a). On the one hand, a nucleotide conjugate is described herein, comprising: (a) a nucleic acid, and (b) a targeting moiety connected to the nucleic acid in (a), wherein the targeting moiety comprises a coupling sequence that hybridizes with the nucleic acid in (a). In some embodiments, the nucleic acid comprises a single-stranded, double-stranded, partially double-stranded, or hairpin stem-loop nucleic acid, and wherein the targeting moiety is a receptor targeting moiety. In some embodiments, the targeting moiety binds to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting moiety comprises one or more N-acetylgalactosamine (GalNAc) or a GalNAc derivative. In some embodiments, the targeting moiety comprises one or more N-acetylgalactosamine (GalNAc) or a GalNAc derivative and a spacer. In some embodiments, the targeting moiety comprises one or more galactose or galactose derivatives. In some embodiments, the targeting moiety comprises one or more galactose or galactose derivatives and a spacer. In some embodiments, the spacer comprises polyethylene glycol, a substituted or unsubstituted C1-C 12Alkylene or both, wherein the polyethylene glycol has 1 to 5 repeating units. In some embodiments, the targeting moiety is connected to one or more chains of the nucleic acid through one or more joints. In some embodiments, the targeting moiety comprises the structure of Table 1. In some embodiments, the coupling sequence hybridizes with the nucleic acid in (a). In some embodiments, the coupling sequence hybridizes with the extension portion of the nucleic acid in (a). In some embodiments, the targeting moiety is attached to the 5' end of the nucleic acid sequence, the 3' end of the nucleic acid sequence, or the middle of the nucleic acid sequence. In some embodiments, the targeting moiety comprises at least two GalNAc or GalNAc derivatives. In some embodiments, the targeting moiety comprises at least three GalNAc or GalNAc derivatives. In some embodiments, GalNAc or GalNAc derivatives are connected to the nucleic acid in (a) via a joint in the targeting moiety, via hybridization of the coupling sequence in the targeting moiety that hybridizes with the nucleic acid in (a), or via a combination thereof. In some embodiments, the targeting moiety comprises at least two galactose or galactose derivatives. In some embodiments, the targeting moiety comprises at least three galactose or galactose derivatives. In some embodiments, galactose or a galactose derivative is connected to the nucleic acid in (a) via a joint in the targeting moiety, via hybridization of a coupling sequence in the targeting moiety that hybridizes with the nucleic acid in (a), or via a combination thereof. In some embodiments, the targeting moiety comprises at least two coupling sequences that hybridize with the nucleic acid in (a). In some embodiments, at least two coupling sequences are identical. In some embodiments, at least two coupling sequences are different. In some embodiments, the nucleotide conjugate further comprises a second targeting moiety. In some embodiments, the second targeting moiety binds to the asialoglycoprotein receptor (ASGPR). In some embodiments, the second targeting moiety is connected to one or more chains of the nucleic acid by a spacer and / or by one or more joints. In some embodiments, the second targeting moiety comprises GalNAc or a GalNAc derivative. In some embodiments, the second targeting moiety comprises at least three GalNAc moieties or GalNAc derivatives. In some embodiments, GalNAc or a GalNAc derivative is connected to the nucleic acid in (a) via a joint in the targeting moiety, via hybridization of a coupling sequence in the targeting moiety that hybridizes with the nucleic acid in (a), or via a combination thereof. In some embodiments, the second targeting moiety comprises galactose or a galactose derivative. In some embodiments, the second targeting moiety comprises at least three galactose moieties or galactose derivatives. In some embodiments, galactose or a galactose derivative is connected to the nucleic acid in (a) via a joint in the targeting moiety, via the hybridization of a coupling sequence in the targeting moiety with the nucleic acid hybridization in (a), or via its combination. In some embodiments, the second targeting moiety comprises the structure of Table 1. In some embodiments, the second targeting moiety comprises a coupling sequence with nucleic acid hybridization.In some embodiments, the second targeting moiety is attached to the 5' end of the nucleic acid, the 3' end of the nucleic acid, or the middle of the nucleic acid. In some embodiments, the nucleic acid in (a) comprises RNA or DNA. In some embodiments, the coupling sequence comprises RNA, DNA, chemically modified RNA, chemically modified DNA, or a hybrid of DNA and RNA. In some embodiments, the coupling sequence comprises one or more of (a), (c), (g), (u), (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), wherein c is 2'-O-methylcytidine (2'-OMe-C), wherein g is 2'-O-methylcytidine guanine (2'-OMe-G), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, the coupling sequence comprises one or more of (a), (c), (g), (u), (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), wherein c is 2'-O-methylcytidine (2'-OMe-C), wherein g is 2'-O-methylcytidine guanine (2'-OMe-G), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, (a), (c), (g), or (u) are dispersed along the nucleic acid or coupling sequence. In some embodiments, the nucleic acid and coupling sequence comprise one or more GC base pairings within the hybrid duplex, wherein the coupling sequence hybridizes to the nucleic acid, and wherein the one or more GC base pairings increase the stability of the hybrid duplex. In some embodiments, the linker comprises a covalent linker. In some embodiments, the linker comprises a non-covalent linker. In some embodiments, the joint comprises a monovalent joint, a divalent joint, a trivalent joint or a combination thereof. In some embodiments, the joint comprises a biodegradable joint. In some embodiments, the joint comprises a non-biodegradable joint. In some embodiments, the joint comprises a phosphate, a thiophosphate, an amide, an ether, an oxime, a hydrazine or a carbamate. In some embodiments, the joint is a phosphate or a thiophosphate. In some embodiments, the nucleic acid in (a) comprises a chemical modification. In some embodiments, the nucleic acid in (a) comprises a 2'-F modification, a phosphorothioate internucleotide linkage modification, an acyclic nucleotide, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-fluoro, 2'-O-N-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 4'-O-methyl, or 2'-ara-F modification.In some embodiments, the nucleic acid comprises a 2'-O-methyl modification. In some embodiments, the nucleic acid comprises a phosphorothioate internucleotide bond modification. In some embodiments, the nucleic acid is capable of hybridizing to a target sequence within a target gene of the genome. In some embodiments, the nucleic acid comprises an mRNA, siRNA, shRNA, antisense oligonucleotide, microRNA, anti-microRNA or antimir, supermir, antagomir, ribozyme, triplex-forming oligonucleotide, decoy oligonucleotide, splice-switching oligonucleotide, immunostimulatory oligonucleotide, RNA activator, U1 adapter, guide RNA, or any combination thereof. In some embodiments, the nucleic acid encodes a protein. In some embodiments, the nucleic acid is a CRISPR enzyme. In some embodiments, the nucleic acid is a guide RNA capable of forming a complex with the CRISPR enzyme. In some embodiments, the guide RNA is a single guide RNA or a dual guide RNA. In some embodiments, the CRISPR enzyme is selected from Cas9, Cpf1, CasX, CasY, C2c1, C2c3, and a base editor fusion protein. In some embodiments, the nucleic acid further comprises an mRNA encoding the CRISPR enzyme. In some embodiments, the CRISPR enzyme causes an alteration of the target sequence. In some embodiments, the target gene is involved in a lipid metabolism pathway. In some embodiments, the target gene is selected from PCSK9, ANGPTL3, APOC3, LPA, APOB, MTP, ANGPTL4, ANGPTL8, APOA5, APOE, LDLR, IDOL, NPC1L1, ASGR1, TM6SF2, GALNT2, GCKR, LPL, MLXIPL, SORT1, TRIB1, MARC1, ABCG5, and ABCG8. In some embodiments, the guide RNA comprises a sequence selected from the sequence of Table 3. In some embodiments, the guide RNA comprises a sequence selected from the sequence of Table 5.

[0036] In one aspect, described herein is a particle comprising the nucleotide conjugate and the CRISPR enzyme. In some embodiments, the particle is a lipid nanoparticle, a liposome, an inorganic nanoparticle, or an RNP.

[0037] In one aspect, described herein is a cell comprising the nucleotide conjugate of any one of the preceding claims. In some embodiments, the cell is a prokaryotic cell, a eukaryotic cell, a vertebrate cell, a mouse cell, a non-human primate cell, or a human cell.

[0038] In one aspect, a pharmaceutical composition is described herein comprising the nucleotide conjugates, particles or cells. In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable adjuvant, diluent, carrier, preservative, excipient, buffer, stabilizer or a combination thereof. In some embodiments, the carrier comprises a solvent, a dispersion medium, a dispersion or suspension aid, a surfactant, an isotonic agent, a thickening or emulsifying agent, a preservative, a lipid, a lipidoid, a polymer, a lipid complex, a core-shell nanoparticle, a hyaluronidase, a nanoparticle mimetic or a combination thereof.

[0039] In one aspect, described herein is a kit comprising the nucleotide conjugate.

[0040] In one aspect, described herein is a method for reducing the risk of coronary artery disease in a subject in need thereof, comprising administering to the subject an effective amount of the nucleotide conjugate. In one aspect, described herein is a method for reducing the risk of coronary artery disease in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition, the pharmaceutical composition comprising (a) a nucleic acid, and (b) a targeting moiety connected to the nucleic acid in (a), wherein the targeting moiety comprises the structure of Table 1. In one aspect, described herein is a method for delivering a nucleic acid to a subject's liver, the method comprising administering to the subject the nucleic acid connected to the targeting moiety, wherein the targeting moiety comprises the structure of Table 1. In some embodiments, the targeting moiety further comprises a coupling sequence that hybridizes to the nucleic acid in (a). In one aspect, described herein is a method for reducing the risk of coronary artery disease in a subject in need thereof, the method comprising administering to the subject an effective amount of a pharmaceutical composition, the pharmaceutical composition comprising (a) a nucleic acid, and (b) a targeting moiety connected to the nucleic acid in (a), wherein the targeting moiety comprises a coupling sequence that hybridizes to the nucleic acid in (a). On the one hand, a method for delivering nucleic acid to a subject's liver is described herein, comprising administering to the subject the nucleic acid connected to a targeting moiety, wherein the targeting moiety comprises a coupling sequence hybridized to the nucleic acid. In some embodiments, the nucleic acid comprises a single-stranded, double-stranded, partially double-stranded, or hairpin stem-loop nucleic acid, and wherein the targeting moiety is a receptor targeting moiety. In some embodiments, the targeting moiety is bound to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, the targeting moiety comprises one or more N-acetylgalactosamine (GalNAc) or a GalNAc derivative. In some embodiments, the targeting moiety comprises at least three GalNAc or GalNAc derivatives. In some embodiments, the targeting moiety comprises one or more galactose or a galactose derivative. In some embodiments, the targeting moiety comprises at least three galactose or a galactose derivative. In some embodiments, the nucleic acid comprises (i) a guide RNA and a nuclease mRNA, or (ii) a guide RNA complexed with a nuclease RNP, and wherein the guide RNA is capable of guiding the nuclease to a target sequence in a target gene. In some embodiments, the guide RNA comprises a single guide RNA or a dual guide RNA. In some embodiments, the nuclease is a CRISPR enzyme. In some embodiments, the CRISPR enzyme is selected from Cas9, Cpf1, CasX, CasY, C2c1, C2c3, and a base editor fusion protein. In some embodiments, the CRISPR enzyme results in an alteration of the target sequence. In some embodiments, administration results in reduced expression of the target gene in the liver of the subject.In some embodiments, the expression of the target gene in the liver of the subject is reduced by at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or greater than 99.99% compared to a control tissue of the subject. In some embodiments, the target gene is associated with coronary artery disease. In some embodiments, the target gene is selected from PCSK9, ANGPTL3, APOC3, LPA, APOB, MTP, ANGPTL4, ANGPTL8, APOA5, APOE, LDLR, IDOL, NPC1L1, ASGR1, TM6SF2, GALNT2, GCKR, LPL, MLXIPL, SORT1, TRIB1, MARC1, ABCG5, and ABCG8. In some embodiments, the coupling sequence comprises RNA, DNA, chemically modified RNA, chemically modified DNA, or a hybrid of DNA and RNA. In some embodiments, the coupling sequence comprises (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, the nucleic acid in (a) comprises (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine, and wherein u is 2'-O-methyluridine. In some embodiments, the targeting moiety is connected to the nucleic acid in (a) via a joint in the targeting moiety, via hybridization of the coupling sequence in the targeting moiety that hybridizes with the nucleic acid in (a), or via a combination thereof. In some embodiments, the joint comprises a covalent joint. In some embodiments, the joint includes phosphate, phosphorothioate, amide, ether, oxime, hydrazine or carbamate. In some embodiments, the joint is phosphate or phosphorothioate. In some embodiments, the nucleic acid in (a) includes chemical modification. In some embodiments, the nucleic acid in (a) includes 2'-F modification, phosphorothioate internucleotide bond modification, acyclic nucleotide, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxidation, 2'-fluoro, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP) or 2'-ara-F modification. In some embodiments, the nucleic acid includes 2'-O-methyl modification. In some embodiments, the nucleic acid includes phosphorothioate internucleotide bond modification.In some embodiments, the nucleic acid levels in the subject's liver are at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 5 times, at least 10 times, at least 15 times, at least 20 times, at least 30 times, at least 40 times, at least 50 times higher than in other tissues of the subject at least 1 hour, 2 hours, 6 hours, 12 hours, 24 hours, 2 days, 1 week, 2 weeks, 3 weeks, 6 weeks, or 8 weeks after delivery. In some embodiments, the effective amount is from about 1 mg / kg to about 10 mg / kg. In some embodiments, administration results in a decrease in blood triglycerides and / or a decrease in low-density lipoprotein cholesterol in a subject in need thereof. In some embodiments, administration is performed intravenously, intrathecally, intramuscularly, intraventricularly, intracerebrally, intracerebellarly, intraventricularly, intraperenchymally, subcutaneously, or a combination thereof.

[0041] In one aspect, described herein is a method for reducing the risk of coronary artery disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising (a) (i) a single guide RNA and a nuclease mRNA, (ii) a dual guide RNA and a nuclease mRNA, (iii) a single guide RNA and an RNP, or (iv) a dual guide RNA and an RNP; and (b) an asialoglycoprotein receptor (ASGPR) targeting moiety linked to the nucleic acid of (a), wherein the single guide RNA or the dual guide RNA comprises four or more 2'-O-methyl modifications and two or more phosphorothioate internucleotide linkages, wherein the targeting moiety comprises the structure of Table 1, and wherein the guide RNA hybridizes to a PCSK9 gene. In one aspect, described herein is a method for reducing the risk of coronary artery disease in a subject in need thereof, the method comprising administering to the subject a pharmaceutical composition comprising (a) (i) a single guide RNA and a nuclease mRNA, (ii) a dual guide RNA and a nuclease mRNA, (iii) a single guide RNA and an RNP, or (iv) a dual guide RNA and an RNP; and (b) a targeting moiety linked to the nucleic acid in (a), wherein the single guide RNA or the dual guide RNA comprises four or more 2'-O-methyl modifications and two or more phosphorothioate internucleotide bonds, wherein the targeting moiety comprises a coupling sequence that hybridizes to the single guide RNA in (a), and wherein the guide RNA hybridizes to a PCSK9 gene. In some embodiments, the nuclease mRNA and / or the single guide RNA comprises at least one chemical modification. In some embodiments, the chemical modification is selected from the group consisting of a 2'-F modification, a phosphorothioate internucleotide linkage modification, an acyclic nucleotide, an LNA, an HNA, a CeNA, a 2'-methoxyethyl, a 2'-O-methyl, a 2'-O-allyl, a 2'-C-allyl, a 2'-deoxy, a 2'-fluoro, a 2'-ON-methylacetamido (2'-O-NMA), a 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), a 2'-O-aminopropyl (2'-O-AP), a 4'-O-methyl, and a 2'-ara-F modification. In some embodiments, administration of the nucleic acid conjugate results in a reduced level of immune response compared to a control nucleic acid conjugate lacking the chemical modification.

[0042] In one aspect, described herein is a nucleotide conjugate comprising a structure of formula (IV)

[0043]

[0044] wherein each X is independently H or a protecting group, R Ais -OX or -NHAc, Y is O or S, and W represents (a) (i) a single guide RNA and a nuclease mRNA, (ii) dual guide RNAs and a nuclease mRNA, (iii) a single guide RNA and an RNP, or (iv) dual guide RNAs and an RNP; or (b) a coupling sequence.

[0045] In some embodiments, one or more linkers comprise a structure selected from the group consisting of: In some embodiments, each of the linkers independently has -(L 1 ) k1 -(L 2 ) k2 -(L 3 ) k3 -(L 4 ) k4 - structure, wherein each of k1, k2, k3 and k4 is independently 0, 1 or 2, and L 1 , L 2 , L 3 and L 4 Each of them is independently selected from -O-, -S-, S(=O) 1-2 -, -C(=O)-, -C(=S)-, -NR L -, -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)NR L -、-OC(=O)NR L -、-NR L C(=O)-、-NR L C(=O)NR L -、-P(=O)R L -、-NR L S(=O)(=NR L )-、-NR L S(=O)2-、-S(=O)2NR L -, -N=N-, -(CH2-CH2-O) 1-6 -, straight chain or branched chain C 1-6 Alkylene, linear or branched C 2-6 Alkenylene, straight chain or branched C 2-6 Alkyne, C3-C8 cycloalkylene, C2-C7 heterocycloalkylene, C6-C 10 Arylene and C5-C9 heteroarylene, wherein alkylene, alkenylene, alkynylene, cycloalkylene, cycloalkylene, arylene or heteroarylene is substituted or unsubstituted, and wherein each R LR is independently H, D, cyano, halogen, substituted or unsubstituted C1-C6 alkyl, -CD3, -OCH3, -OCD3, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C1-C6 heteroalkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C2-C7 heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In some embodiments, each R L k1, k2, k3, and k4 are independently H, substituted or unsubstituted C1-C6 alkyl, -OCH3, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C1-C6 heteroalkyl, substituted or unsubstituted C3-C8 cycloalkyl, or substituted or unsubstituted C2-C7 heterocycloalkyl. In some embodiments, the sum of k1, k2, k3, and k4 is 1, 2, or 3.

[0046] In one aspect, the present invention describes a method for preparing a formulation comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, the method comprising: (a) providing a first solution comprising one or more nucleic acid molecular entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution to produce a mixture comprising nanoparticles comprising one or more nucleic acid molecular entities and one or more lipids; (d) mixing the receptor-targeted conjugate with the nanoparticles produced in step (c); (e) incubating the nanoparticles; and (f) optionally performing a buffer exchange process. In some embodiments, after the mixing step of (c), the receptor-targeted conjugate is combined with the one or more lipids. In some embodiments, the receptor-targeted conjugate is added to a dilution buffer, and wherein the dilution buffer is mixed with preformed nucleic acid-lipid nanoparticles emerging from an online mixing chamber to form nanoparticles. In some embodiments, after adding the dilution buffer to the mixture and maintaining the diluted mixture for a period of time, the receptor-targeted conjugate is introduced. In some embodiments, the holding time is 1 to 120 minutes. In some embodiments, the holding time is 1 to 90 minutes, 1 to 60 minutes, or 10 to 40 minutes. In some embodiments, the holding time is about 30 minutes. In some embodiments, after buffer exchange, the receptor-targeted conjugate is introduced to the nanoparticles. In some embodiments, after buffer exchange and concentration, but before storage, the receptor-targeted conjugate is introduced to the nanoparticles. In some embodiments, after storage and thawing and before administration or evaluation, the receptor-targeted conjugate is introduced to the nanoparticles. In one aspect, a method for preparing a formulation comprising nanoparticles is described herein, wherein the nanoparticles comprise (i) one or more nucleic acid molecule entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, the method comprising: (a) providing a first solution comprising one or more nucleic acid molecule entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution online to produce a mixture comprising nanoparticles comprising one or more nucleic acid molecule entities and one or more lipids; (d) mixing the receptor-targeted conjugate and the mixture of step (c) online to produce a mixture comprising nanoparticles comprising one or more nucleic acid molecule entities, one or more lipids, and a receptor-targeted conjugate; (e) diluting the mixture of step (d) by adding a dilution buffer; and (f) optionally performing a buffer exchange process. In some embodiments, the online mixing of step (c) and the online mixing of step (d) are performed sequentially.In one aspect, a method of preparing a formulation comprising nanoparticles is described herein, wherein the nanoparticles comprise (i) one or more nucleic acid molecule entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, the method comprising: (a) providing a first solution comprising one or more nucleic acid molecule entities; (b) providing a second solution comprising (i) at least one of the one or more lipids and (ii) at least a portion of the receptor-targeted conjugate; (c) mixing the first solution and the second solution to produce a mixture comprising the nanoparticles; (d) optionally incubating the nanoparticles; and (e) optionally performing a buffer exchange process. In some embodiments, the second solution comprises all of the receptor-targeted conjugates. In one aspect, the present invention describes a method for preparing a formulation comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecule entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, the method comprising: (a) providing a first solution comprising one or more nucleic acid molecule entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution to produce a mixture comprising nanoparticles comprising the one or more nucleic acid molecule entities and the one or more lipids; (d) combining the receptor-targeted conjugate with the one or more lipids, wherein at least a portion of the receptor-targeted conjugate is combined with the one or more lipids before or simultaneously with the mixing step; (e) optionally incubating the nanoparticles; and (f) optionally performing a buffer exchange process. In some embodiments, at least a portion of the receptor-targeted conjugate is combined with the one or more lipids while the mixing step is taking place. In some embodiments, at least a portion of the receptor-targeted conjugate is combined with the one or more lipids before the mixing step. In some embodiments, the receptor-targeted conjugate is combined with the one or more lipids in the second solution. In some embodiments, a portion of the receptor-targeted conjugate is combined with one or more lipids in the second solution, and after mixing, a portion of the receptor-targeted conjugate is combined with one or more lipids. In some embodiments, a portion of the receptor-targeted conjugate is combined with one or more lipids in the second solution, and after the incubation step, a portion of the receptor-targeted conjugate is combined with one or more lipids. In some embodiments, a portion of the receptor-targeted conjugate is combined with one or more lipids in the second solution, and after the buffer exchange step, a portion of the receptor-targeted conjugate is combined with one or more lipids. In some embodiments, the method further comprises diluting the mixture produced by mixing the first solution and the second solution by adding a dilution buffer. In some embodiments, the mixture is diluted online. In some embodiments, the dilution buffer contains at least a portion of the receptor-targeted conjugate.In some embodiments, the dilution buffer comprises at least a portion of the stealth lipid. In some embodiments, the first solution comprises an aqueous buffer. In some embodiments, the second solution comprises ethanol. In some embodiments, mixing comprises laminar mixing, vortex mixing, turbulent mixing, or a combination thereof. In some embodiments, mixing comprises cross mixing. In some embodiments, mixing comprises online mixing. In some embodiments, mixing comprises introducing at least a portion of the first solution through a first inlet channel and introducing at least a portion of the second solution through a second inlet channel, and wherein the angle between the first inlet channel and the second inlet channel is about 15 to 180 degrees. In some embodiments, mixing comprises introducing a portion of the first solution through a third inlet channel. In some embodiments, buffer exchange comprises dialysis, chromatography, or tangential flow filtration (TFF). In some embodiments, the method further comprises a filtration step. In some embodiments, the receptor-targeted conjugate comprises one or more N-acetylgalactosamine (GalNAc) or GalNAc derivatives. In some embodiments, the receptor-targeted conjugate comprises one or more galactose or galactose derivatives. In some embodiments, the receptor-targeted conjugate is selected from Table 4. In some embodiments, the receptor-targeted conjugate is a targeted conjugate described herein. In some embodiments, the nanoparticles comprise a first nanoparticle composition described herein. In some embodiments, the formulation is a pharmaceutical composition described herein.

[0047] In one aspect, a pharmaceutical composition is described herein comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, wherein the formulation is prepared by a method described herein. In one aspect, a pharmaceutical composition is described herein comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, wherein the formulation is prepared by a method comprising the following steps: (a) providing a first solution comprising one or more nucleic acid molecular entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution, thereby producing a mixture comprising nanoparticles comprising the one or more nucleic acid molecular entities and the one or more lipids; (d) mixing the receptor-targeted conjugate with the nanoparticles produced in step (c); (e) incubating the nanoparticles; and (f) optionally performing a buffer exchange process. In one aspect, described herein is a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, wherein the formulation is prepared by a method comprising the following steps: (a) providing a first solution comprising the one or more nucleic acid molecular entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution to produce a mixture comprising nanoparticles comprising the one or more nucleic acid molecular entities and the one or more lipids; (d) combining the receptor-targeted conjugate with the one or more lipids, wherein at least a portion of the receptor-targeted conjugate is combined with the one or more lipids prior to or simultaneously with the mixing step; (e) optionally incubating the nanoparticles; and (f) optionally performing a buffer exchange process.In one aspect, described herein is a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids and amino lipids, and (iii) a receptor-targeted conjugate, wherein the formulation is prepared by a method comprising the following steps: (a) providing a first solution comprising one or more nucleic acid molecular entities; (b) providing a second solution comprising at least one of the one or more lipids; (c) mixing the first solution and the second solution in-line to produce a mixture comprising nanoparticles comprising one or more nucleic acid molecular entities and one or more lipids; (d) mixing the receptor-targeted conjugate and the mixture of step (c) in-line to produce a mixture comprising nanoparticles comprising one or more nucleic acid molecular entities, one or more lipids and a receptor-targeted conjugate; (e) diluting the mixture of step (d) by adding a dilution buffer; and (f) optionally performing a buffer exchange process. In one aspect, described herein is a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecular entities, (ii) one or more lipids selected from sterols or derivatives thereof, phospholipids, stealth lipids, and amino lipids, and (iii) a receptor-targeted conjugate, wherein the formulation is prepared by a method comprising the following steps: (a) providing a first solution comprising the one or more nucleic acid molecular entities; (b) providing a second solution comprising (i) at least one of the one or more lipids and (ii) at least a portion of the receptor-targeted conjugate; (c) mixing the first solution and the second solution to produce a mixture comprising the nanoparticles; (d) optionally incubating the nanoparticles; and optionally performing a buffer exchange process.

[0048] Incorporation by reference

[0049] All publications, references, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of any inconsistency between the usages in this document and those incorporated by reference, the usage in the incorporated references should be considered supplementary to that in this document; for irreconcilable inconsistencies, the usage in this document controls. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] The novel features of the present invention are particularly set forth in the appended claims. The features and advantages of the present invention will be better understood by referring to the following detailed description of illustrative embodiments utilizing the principles of the invention and the accompanying drawings, in which:

[0051] Figure 1A-1B HPLC chromatograms of GalNAc-lipid incorporation of the compositions herein are shown. Figure 1A Reference LNPs without the presence of GalNAc-lipid are shown. Figure 1B LNPs composed of GalNAc-lipid are shown.

[0052] Figure 2 The in vitro PCSK9 gene editing efficiency of the LNP formulations in the compositions herein is shown in primary human hepatocytes.

[0053] Figure 3 Shown are PCSK9 gene editing in the livers of wild-type, LDLr- / -, and ApoE- / - mice following retroorbital administration of LNP compositions herein carrying a 1:1 ratio of SpCas9 mRNA and PCSK9 gRNA.

[0054] Figure 4 Shown is ANGPTL3 gene editing in the liver of LDLr- / - mice following retroorbital administration of the LNP composition herein carrying ABE mRNA and ANGPTL3 gRNA at a 1:1 ratio.

[0055] Figure 5 Shown are PCSK9 gene editing in the livers of wild-type and LDLr- / - mice following retroorbital administration of LNPs carrying ABE mRNA and PCSK9 gRNA at a 1:1 ratio.

[0056] Figure 6 Shown is PCSK9 gene editing in wild-type female mouse hepatocytes following retroorbital administration of the LNP compositions herein.

[0057] Figure 7 Shown is PCSK9 gene editing in wild-type female mouse hepatocytes following retroorbital administration of the LNP compositions herein.

[0058] Figure 8 Shown is PCSK9 editing in hepatocytes of LDLR- / - female mice following retroorbital administration of the LNP compositions herein carrying Cas9 mRNA and gRNA.

[0059] Figure 9 Four general processes for introducing GalNAc-lipids into lipid nanoparticles are shown.

[0060] Figure 10 Three protocols for preparing lipid nanoparticles including post-addition of GalNAc-lipids are shown.

[0061] Figure 11 Three protocols for preparing lipid nanoparticles including post-addition of GalNAc-lipids are shown.

[0062] Figure 12Three schemes for preparing lipid nanoparticles are shown, including addition of GalNAc-lipid to the LNP excipient and separate addition of GalNAc-lipid.

[0063] Figure 13 Two schemes for preparing lipid nanoparticles are shown, including the addition of GalNAc-lipid to the LNP excipient and the separate addition of GalNAc-lipid.

[0064] Figure 14 Two schemes for preparing lipid nanoparticles involving cross-mixing of GalNAc-lipids are shown.

[0065] Figure 15 Shown is PCSK9 editing in LDLR- / - female mouse hepatocytes following retroorbital administration of LNP compositions herein carrying a 1:1 ratio of PCSK9 ABE mRNA and guide RNA. DETAILED DESCRIPTION

[0066] In order to provide a thorough understanding of the various embodiments, certain specific details of this specification are set forth. However, those skilled in the art will understand that the invention can be practiced without these details. In other cases, well-known structures and / or methods are not shown or described in detail to avoid unnecessarily obscuring the description of the embodiments. Unless the context requires otherwise, throughout the specification and subsequent claims, the word "comprise" and its variants, for example, "comprises / comprising" should be interpreted in an open, inclusive sense, that is, "including but not limited to". In addition, the titles provided herein are for convenience only and do not explain the scope or meaning of the claimed invention. The section headings used herein are for organizational purposes only and should not be interpreted as limiting the subject matter described.

[0067] Effective delivery to cells requires specific targeting and substantial protection of the extracellular environment (particularly serum proteins). A method of achieving specific targeting is to conjugate a targeting moiety with an active agent or drug effector (such as a nucleic acid agent), thereby directing the active agent or drug effector to a specific cell or tissue according to the specificity of the targeting moiety. A way in which the targeting moiety can improve delivery is by receptor-mediated endocytosis activity. In some cases, this uptake mechanism can involve the invagination of a membrane structure or by the fusion of a delivery system with a cell membrane and the nucleic acid agent being bound to a membrane receptor is moved to the inside of the region enclosed by the membrane. This process is initiated via activating cell surface or membrane receptors after specific ligands bind to receptors. Many receptor-mediated endocytosis systems are known and have been studied, including those that recognize sugars (such as galactose, mannose, mannose-6-phosphate), peptides, and proteins (such as transferrin, asialoglycoprotein, vitamin B12, insulin, and epidermal growth factor (EGF)). When attached to highly hydrophilic molecules (e.g., nucleic acids), lipophilic moieties (e.g., cholesterol or fatty acids) can significantly enhance plasma protein binding and thus extend circulation half-life. To improve intracellular trafficking for targeted delivery methods, lipophilic conjugates can also be used in combination with targeting ligands.

[0068] The asialoglycoprotein receptor (ASGP-R) is a high-capacity receptor that is highly abundant on hepatocytes. ASGP-R has a 50-fold higher affinity for N-acetyl-D-galactosamine (GalNAc) than for D-Gal. Previous work has shown that achieving high affinity requires multivalency, and spacing between sugars is also crucial. The inventors herein recognize that there is a clear need for new receptor-specific ligand-conjugated RNA or DNA pharmaceutical agents and methods for their preparation that address the shortcomings of in vivo delivery of therapeutic agents using nucleic acids or nucleic acid-related complexes as described above. The present invention is directed to this very important goal.

[0069] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that the term "or" is generally employed in its sense including "and / or" unless the context clearly dictates otherwise.

[0070] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All references cited herein are incorporated by reference in their entirety as if fully set forth. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd ed., J. Wiley & Sons (New York, NY 2001); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 5th ed., J. Wiley & Sons (New York, NY 2001); and Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2001), provide a general guide to many of the terms used in this application for those skilled in the art.

[0071] Specific definition

[0072] When indicating the number of substituents, the term "one or more" refers to a range from one substituent to the highest possible number of substitutions, eg, one hydrogen is replaced by a substituent up to all hydrogens are replaced by substituents.

[0073] The terms "optional" or "optionally" mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0074] The term "nucleic acid molecular entity" is used interchangeably with "nucleic acid."

[0075] As used herein, the term "nucleic acid" generally refers to one or more nucleobases, nucleosides or nucleotides, and the term includes polynucleobases, polynucleosides and polynucleotides. Nucleic acids can include polynucleotides, mononucleotides and oligonucleotides. Nucleic acids can include DNA, RNA or a mixture thereof, and can be single-stranded, double-stranded or partially single- or double-stranded, and can form secondary structures. In some embodiments, the nucleic acid has multiple double-stranded segments and single-stranded segments. For example, the nucleic acid can include a polynucleotide, such as an mRNA, having multiple double-stranded segments therein. DNA can be in the form of, for example, an antisense molecule, plasmid DNA, pre-condensed DNA, PCR product, vector, expression cassette, chimeric sequence, chromosomal DNA or derivatives and combinations of these groups. RNA can be in the form of siRNA, asymmetric interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), CRISPR RNA, base editor RNA and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or bonds, which are synthetic, naturally occurring and non-naturally occurring, and have binding properties similar to reference nucleic acids. The example of such analogs includes but is not limited to phosphorothioate, phosphoramidate, methylphosphonate, chiral methylphosphonate, 2'-O-methyl ribonucleotide and peptide nucleic acid (PNA). Unless specifically limited, the term includes nucleic acids containing known analogs of natural nucleotides, which have binding properties similar to reference nucleic acids. Unless otherwise indicated, specific nucleic acid sequences also implicitly include variants (for example, degenerate codon replacements), alleles, straight homologues, SNPs and complementary sequences and sequences clearly indicated thereof, of conservative modifications. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is replaced by mixed base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mal. Cell. Probes, 8:91-98 (1994)). A "nucleotide" contains a substituted and / or unsubstituted sugar deoxyribose (DNA), or a substituted and / or unsubstituted sugar ribose (RNA), or a substituted and / or unsubstituted carbocyclic ring, or a substituted and / or unsubstituted acyclic moiety (e.g., diol nucleic acids), a base, and a phosphate group. The nucleotides are linked together by the phosphate group. "Bases" include purines and pyrimidines, which also include the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, as well as natural analogs and synthetic derivatives of purines and pyrimidines, which include but are not limited to modifications that place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0076] The term "gene" refers to a nucleic acid (eg, DNA or RNA) sequence that contains a partial or full-length coding sequence necessary to produce a polypeptide or precursor polypeptide.

[0077] As used herein, "gene product" refers to the product of a gene (eg, RNA transcript) or a polypeptide.

[0078] As used herein, the term "polynucleotide" generally refers to a molecule comprising two or more connected nucleic acid subunits (e.g., nucleotides), and can be used interchangeably with "oligonucleotides." For example, a polynucleotide can include one or more nucleotides selected from adenosine (A), cytosine (C), guanine (G), thymine (T), and uracil (U) or variants thereof. Nucleotide generally includes nucleosides and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphate (PO3) groups. Nucleotide can include a core base, a five-carbon sugar (ribose or deoxyribose) and one or more phosphate groups. Ribonucleotides include nucleotides in which sugar is ribose. Deoxyribonucleotides include nucleotides in which sugar is deoxyribose. Nucleotide can be nucleoside monophosphate, nucleoside diphosphate, nucleoside triphosphate, or nucleoside polyphosphate. For example, nucleotide can be a deoxyribonucleoside polyphosphate, such as deoxyribonucleoside triphosphate (dNTP). Exemplary dNTPs include deoxyadenosine triphosphate (dATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), uridine triphosphate (dUTP) and deoxythymidine triphosphate (dTTP). dNTPs can also include detectable labels, such as luminescent labels or markers (e.g., fluorophores). For example, nucleotides can be purines (e.g., A or G or variants thereof) or pyrimidines (e.g., C, T or U or variants thereof). In some instances, polynucleotides are deoxyribonucleic acids (DNA), ribonucleic acids (RNA) or derivatives or variants thereof. Exemplary polynucleotides include, but are not limited to, short interfering RNA (siRNA), microRNA (miRNA), plasmid DNA (pDNA), short hairpin RNA (shRNA), small nuclear RNA (snRNA), messenger RNA (mRNA), precursor mRNA (pre-mRNA), antisense RNA (asRNA) and heteronuclear RNA (hnRNA), and include nucleotide sequences and any structural embodiment thereof, such as single-stranded, double-stranded, triple-stranded, spiral, hairpin, stem-loop, protrusion, etc. In some cases, polynucleotide is circular.Polynucleotide can have various lengths.For example, the length of polynucleotide can be at least about 7 bases, 8 bases, 9 bases, 10 bases, 20 bases, 30 bases, 40 bases, 50 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobase (kb), 2kb, 3kb, 4kb, 5kb, 10kb, 50kb or larger.Polynucleotide can be separated from cell or tissue.For example, the polynucleotide sequence can comprise the DNA / RNA molecule of separation and purification, synthetic DNA / RNA molecule and / or synthetic DNA / RNA analog.

[0079] The polynucleotide may include one or more nucleotide variants, including non-standard nucleotides, non-natural nucleotides, nucleotide analogs and / or modified nucleotides. Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyl Uracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyl adenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, 2,6-diaminopurine, etc. In some cases, the nucleotide may include modifications of its phosphate moiety, including modifications to the triphosphate moiety. Non-limiting examples of such modifications include phosphate chains of greater length (e.g., phosphate chains with 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) and modifications of thiol moieties (e.g., α-thiotriphosphates and β-thiotriphosphates). Nucleic acid molecules can also be modified at the base moiety (e.g., at one or more atoms that are typically available for hydrogen bonding with complementary nucleotides and / or at one or more atoms that are typically unable to hydrogen bond with complementary nucleotides), at the sugar moiety, or at the phosphate backbone. Nucleic acid molecules can also contain amine-modified groups, such as aminoallyl 1-dUTP (aa-dUTP) and aminohexyl acrylamide-dCTP (aha-dCTP), to allow covalent attachment of amine-reactive moieties, such as N-hydroxysuccinimide ester (NHS). Alternatives to standard DNA base pairs or RNA base pairs in the oligonucleotides of the present invention can provide higher sites / cubic mm density, higher safety (against accidental or purposeful synthesis of natural toxins), and easier discrimination or lower secondary structures in light-programmable polymerases.Such alternative base pairs compatible with natural and mutant polymerases for de novo and / or amplification synthesis are described in Betz K, Malyshev DA, Lavergne T, Welte W, Diederichs K, Dwyer TJ, Ordoukhanian P, Romesberg FE, Marx A. Nat. Chem. Biol. 2012 Jul;8(7):612-4, which is incorporated herein by reference for all purposes.

[0080] As used herein, the terms "polypeptide," "protein," and "peptide" are used interchangeably and refer to a polymer of amino acid residues linked via peptide bonds, which may be composed of two or more polypeptide chains. The terms "polypeptide," "protein," and "peptide" refer to a polymer of at least two amino acid monomers linked together by an amide bond. Amino acids can be L-optical isomers or D-optical isomers. More specifically, the terms "polypeptide," "protein," and "peptide" refer to a molecule composed of two or more amino acids in a specific order; for example, an order determined by the base sequence of nucleotides in a gene or RNA encoding the protein. Proteins are essential for the structure, function, and regulation of somatic cells, tissues, and organs, and each protein has a unique function. Examples are hormones, enzymes, antibodies, and any fragments thereof. In some cases, a protein may be a part of a protein, such as a domain, subdomain, or motif of a protein. In some cases, a protein may be a variant (or mutation) of a protein, in which one or more amino acid residues are inserted, deleted, and / or substituted into the naturally occurring (or at least known) amino acid sequence of the protein. A protein or its variant may be naturally occurring or recombinant.

[0081] As used herein, the term "intercalating" or "intercalation" refers to the action of an agent (e.g., a small molecule) that inserts itself between consecutive bases in DNA. In some cases, the intercalation prevents the proper function of the DNA.

[0082] As used herein, "complementary" refers to a sequence that is complementary to a nucleic acid according to the standard Watson / Crick pairing rules. A complementary sequence can also be an RNA sequence that is complementary to a DNA sequence or its complementary sequence, and can also be a cDNA. Complementarity can be complete complementarity or partial complementarity, such that the two sequences hybridize under stringent hybridization conditions. It will be understood by those skilled in the art that complementary or substantially complementary sequences do not need to hybridize along their full length. In specific embodiments, a complementary or substantially complementary sequence can comprise a continuous base sequence that does not hybridize with a target sequence, located 3' or 5' to the continuous base sequence that hybridizes with the target sequence.

[0083] As used herein, "hybridization" refers to the process in which two nucleic acid chains anneal to each other according to the Watson-Crick base pairing rules. Nucleic acid hybridization techniques are well known in the art. See, for example, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, NY. Those skilled in the art understand how to determine the appropriate stringency of hybridization / washing conditions so that sequences with at least the desired level of complementarity will stably hybridize, while sequences with lower complementarity will not hybridize. For examples of hybridization conditions and parameters, see, for example, Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, Plainview, NY; Ausubel, FM et al., 1994, Current Protocols in Molecular Biology. John Wiley & Sons, Secaucus, NJ, all of which are incorporated herein by reference in their entirety. In certain embodiments, hybridization may occur between nucleic acid molecules having a length of 20-100 nucleotides. 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110 98, 99, or 100 consecutive nucleotides. In some embodiments, the hybridizing nucleic acid molecule can contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 tolerated mismatches.

[0084] As used herein, the term "biological sample" refers to any biological material from which polynucleotides, polypeptides, biomarkers and / or metabolites can be prepared and detected. Non-limiting examples include whole blood, plasma, saliva, cheek swabs, stool samples, urine samples, cell pellets, or any other body fluid or tissue.

[0085] As used herein, the terms "administer / administering / administration" and the like refer to methods that can be used to deliver a compound or composition to a desired biological site of action. These methods include, but are not limited to, oral routes (po), intraduodenal routes (id), parenteral injections (including intravenous (iv), subcutaneous (sc), intraperitoneal (ip), intramuscular (im), intravascular or infusion (inf.)), topical (top.) and rectal (pr) administration. Those skilled in the art are familiar with administration techniques that can be used with the compounds and methods described herein. In some embodiments, the compounds and compositions described herein are administered orally.

[0086] As used herein, the terms "co-administered," "co-administered," and the like are meant to include administration of selected therapeutic agents to a single patient, and are intended to include treatment regimens in which the agents are administered by the same or different routes of administration, or at the same or different times.

[0087] As used herein, the term "effective amount" or "therapeutically effective amount" refers to a sufficient amount of an administered agent or compound that will alleviate to some extent one or more of the symptoms of the disease or condition being treated; for example, a reduction and / or alleviation of one or more signs, symptoms, or causes of a disease, or any other desired alteration in a biological system. For example, an "effective amount" for therapeutic use can be an amount of an agent that provides a clinically significant reduction in one or more disease symptoms. An appropriate "effective" amount can be determined in an individual case using techniques such as dose escalation studies.

[0088] As used herein, the terms "enhance" and "enhancing" mean to increase or prolong the amount, potency, or duration of a desired effect.

[0089] As used herein, "carbohydrate" refers to a compound that is itself a carbohydrate composed of one or more monosaccharide units having at least 6 carbon atoms (which may be linear, branched, or cyclic), wherein an oxygen, nitrogen, or sulfur atom is bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety composed of one or more monosaccharide units, each monosaccharide unit having at least six carbon atoms (which may be linear, branched, or cyclic), wherein an oxygen, nitrogen, or sulfur atom is bonded to each carbon atom. Representative carbohydrates include sugars (monosaccharides, disaccharides, trisaccharides, and oligosaccharides containing about 4-9 monosaccharide units) and polysaccharides, such as starch, glycogen, cellulose, and polysaccharide gums. Specific monosaccharides include C5 and above (preferably C5-C8) sugars; disaccharides and trisaccharides include sugars having two or three monosaccharide units (preferably C5-C8).

[0090] The term "monosaccharide" includes allose, altrose, arabinose, cladinose, erythrose, erythrulose, fructose, D-fucitol, L-fucitol, fucosamine, fucose, fucose, galactosamine, D-galactitol, N-acetyl-galactosamine, galactose, glucosamine, N-acetyl-glucosamine, glucosaminol, glucose, glucose-6-phosphate, gulose, glyceraldehyde, L-glycero-D-mannos-heprose, glycerol, glycerone, gulose, idose, lyxose, mannosamine, mannose, mannose-6-phosphate, psicose, quinovose, quinosamine, rhamnitol, rhamnosamine, rhamnose, ribose, ribulose, sedoheptulose, sorbose, tagatose, talose, tartaric acid, throse, xylose, and xylulose radicals. Monosaccharides may be in the D- or L- configuration. Monosaccharides may further be deoxy sugars (alcoholic hydroxyl groups replaced by hydrogen), amino sugars (alcoholic hydroxyl groups replaced by amino groups), thio sugars (alcoholic hydroxyl groups replaced by thiol, or C=O replaced by C=S, or cyclic cyclic oxygen replaced by sulfur), seleno sugars, telluryl sugars, aza sugars (ring carbon replaced by nitrogen), imino sugars (ring oxygen replaced by nitrogen), phosphano sugars (ring oxygen replaced by phosphorus), phospha sugars (ring carbon replaced by phosphorus), C-substituted monosaccharides (hydrogen on non-terminal carbon atoms replaced by carbon), unsaturated monosaccharides, sugar alcohols (carbonyl groups replaced by CHOH groups), aldonic acids (aldehyde groups replaced by carboxyl groups), ketoaldonic acids, uronic acids, aldaric acids, and the like. Amino sugars include amino monosaccharides, preferably galactosamine, glusamine, mannosamine, fucosmine, quinavosamine, neuraminic acid, muramic acid, lactosediamine, acosamine, bacillosamine, daunosamine, erythrodeoxysaccharide, forosamine, galactosamine, kanosamine, mycosamine, myosamine, persosamine, pneumosamine, purpurosamine, rhodosmine. It should be understood that monosaccharides and the like can be further substituted.

[0091] As used herein, "N / P ratio" is the molar ratio of ionizable nitrogen atoms in lipids (e.g., within the physiological pH range) to phosphate groups in nucleic acid molecule entities, e.g., in nanoparticle compositions comprising lipid components and RNA. Ionizable nitrogen atoms can include, for example, nitrogen atoms that can be protonated at about pH 1, about pH 2, about pH 3, about pH 4, about pH 5, about pH 6, about pH 7, about pH 7.5, or about pH 8 or higher. Physiological pH ranges can include, for example, the pH ranges of different cellular compartments (e.g., organs, tissues, and cells) and body fluids (e.g., blood, CSF, gastric juice, milk, bile, saliva, tears, and urine). In certain specific embodiments, physiological pH ranges refer to the pH range of mammalian blood, e.g., from about 7.35 to about 7.45. In some embodiments, ionizable nitrogen atoms refer to those nitrogen atoms that are ionizable within the range of pH 5 to 14.

[0092] The terms "disaccharide," "trisaccharide," and "polysaccharide" include abecidose, acarbose, amicetose, amylopectin, amylose, apiose, arcanose, ascarose, ascorbic acid, boivinose, cellobiose, cellotriose, cellulose, potato triose, chalose, chitin, colisaccharide, cyclodextrin, dextrin, 2-deoxyribose, 2-deoxyglucose, diglucose, digitalose, digitalose, evalose, evemitrose, oligofructose, galto-oligosaccharide, gentiotriose, genitiobiose, dextran, gluicogen, glylcogen, hamamelisose, heparin, inulin, isolevoglucosenone, isomaltose, isomaltose, Maltotriose, isoglucosylmaltose, kojibiose, lactose, aminolactoside, lactosamine, laminaribiose, levoglucosan, levoglucosone, β-maltose, maltotriose, mannan-oligosaccharide, amnninotriose, melezitose, melibiose, muramic acid, mycarose, allose, neuraminic acid, migerose, nojirimycon, noviose, oleanose, panose, palatose, The term "disaccharide" refers to a group of sugars such as psyllium, primrose, raffinose, rhodone, rutinose, oleanose, panose, palatose, psyllium, primrose, raffinose, rhodinose, rutinose, salmentose, sedoheptulose, sedoheptulose anhydrous, solanose, sophorose, stachyose, streptobiose, sucrose, α,α-trehalose, trahalosamine, turanose, tyvese, xylobiose, umbelliferyl, etc. In addition, it should be understood that "disaccharides", "trisaccharides" and "polysaccharides" can be further substituted. Disaccharides also include amino sugars and their derivatives, particularly mycamine derivatized at the C-4' position or 4-deoxy-3-amino-glucose derivatized at the C-6' position.

[0093] The term "subject" or "patient" includes mammals. Examples of mammals include, but are not limited to, any member of the class Mammalia: humans, non-human primates (e.g., chimpanzees), and other ape and monkey species; farm animals, such as cattle, horses, sheep, goats, pigs; livestock, such as rabbits, dogs, and cats; laboratory animals, including rodents, such as rats, mice, and guinea pigs, etc. In one aspect, the mammal is a human. As used herein, the term "animal" includes humans and non-human animals. In one embodiment, a "non-human animal" is a mammal, such as a rodent, such as a rat or mouse. In one embodiment, the non-human animal is a mouse or a monkey.

[0094] As used herein, the term "treat / treating / treatment" includes alleviating, reducing or ameliorating at least one symptom of a disease or condition, preventing additional symptoms, inhibiting a disease or condition, for example, preventing the development of a disease or condition, alleviating a disease or condition, causing regression of a disease or condition, alleviating a condition caused by a disease or condition, or prophylactically and / or therapeutically stopping the symptoms of a disease or condition. The term "treat" also includes the concept of "prevent / preventing / prevention" as described below. It should be understood that, although not excluded, treating a disorder or condition does not require the complete elimination of the disorder, condition or symptoms associated therewith.

[0095] The terms "preventing" or "prevention" of a disease state mean causing clinical symptoms of the disease state to not develop in a subject who is exposed to or susceptible to the disease state but who does not yet experience or display symptoms of the disease state.

[0096] The terms "pharmaceutical composition" and "pharmaceutical formulation" (or "formulation") are used interchangeably and refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient and one or more pharmaceutically acceptable excipients, for administration to a subject, such as a human in need thereof.

[0097] As used herein, the term "drug combination" refers to a product produced by mixing or combining more than one active ingredient, and includes fixed and non-fixed combinations of active ingredients. The term "fixed combination" refers to active ingredients (e.g., compounds described herein and co-agents) that are all administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" refers to active ingredients (e.g., compounds described herein and co-agents) that are administered to a patient simultaneously, in parallel or sequentially as separate entities, without specific time interval restrictions, wherein such administration provides effective levels of the two compounds in the patient's body. The latter is also applicable to cocktail therapy, for example, the administration of three or more active ingredients.

[0098] The term "pharmaceutically acceptable" refers to the properties of materials useful in preparing pharmaceutical compositions that are generally safe, non-toxic, and neither biologically nor otherwise undesirable, and are acceptable for veterinary as well as human pharmaceutical use. "Pharmaceutically acceptable" can refer to materials, such as carriers or diluents, that do not abrogate the biological activity or properties of a compound and are relatively non-toxic, e.g., materials that can be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0099] The terms "pharmaceutically acceptable excipient," "pharmaceutically acceptable carrier," "pharmaceutically acceptable vehicle," and "therapeutically inert excipient" are used interchangeably and refer to any pharmaceutically acceptable ingredient in a pharmaceutical composition that is not therapeutically active and is non-toxic to the subject to which it is administered, such as a disintegrant, binder, filler, solvent, buffer, tonicity agent, stabilizer, antioxidant, surfactant, carrier, diluent, excipient, preservative, or lubricant used to formulate a drug product.

[0100] The terms "base editing" and "base correction" are used interchangeably to indicate a base change or mutation that results in a base modification at a target sequence within a target gene. In certain embodiments, base editing occurs at a single base in the target sequence. In preferred embodiments, base editing does not involve double-strand breaks in the target sequence.

[0101] As used herein, the term "siRNA" refers to an agent that mediates the targeted cleavage of an RNA transcript. These agents are associated with a cytoplasmic multiprotein complex called the RNAi-induced silencing complex (RISC). Agents that effectively induce RNA interference are also referred to herein as siRNA, RNAi agents, or iRNA agents. As used herein, the term siRNA includes microRNAs and precursor microRNAs (pre-microRNAs). As used herein, the terms "siRNA activity" and "RNAi activity" refer to the gene silencing of siRNA.

[0102] The term "2'-O-methoxyethyl" (also known as 2'-MOE, 2'-O(CH2)2-OCH3, and 2'-O-(2-methoxyethyl)) refers to an O-methoxy-ethyl modification of the 2' position of the furosyl ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0103] The term "2'-O-methoxyethyl nucleotide" refers to a nucleotide comprising a 2'-O-methoxyethyl modified sugar moiety.

[0104] The term "5-methylcytosine" refers to cytosine modified with a methyl group attached to the 5' position. 5-Methylcytosine is a modified nucleobase.

[0105] The term "oxo" refers to a =0 substituent.

[0106] The term "alkyl" refers to a straight or branched hydrocarbon chain radical having from one to twenty carbon atoms and attached to the rest of the molecule by a single bond. Alkyl groups containing up to 10 carbon atoms are referred to as C1-C 10Similarly, for example, an alkyl group containing up to 6 carbon atoms is a C1-C6 alkyl group. Alkyl groups containing other numbers of carbon atoms (and other moieties defined herein) are similarly represented. Alkyl groups include, but are not limited to, C1-C6 alkyl groups. 10 C1-C9 alkyl, C1-C8 alkyl, C1-C7 alkyl, C1-C6 alkyl, C1-C5 alkyl, C1-C4 alkyl, C1-C3 alkyl, C1-C2 alkyl, C2-C8 alkyl, C3-C8 alkyl and C4-C8 alkyl. Representative alkyl groups include but are not limited to methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, isobutyl, sec-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, 1-ethylpropyl, etc. In some embodiments, alkyl is methyl or ethyl. In some embodiments, alkyl is -CH (CH 3 ) 2 or -C (CH 3 ) 3. Unless otherwise specifically stated in this specification, alkyl groups can be optionally substituted as described below. "Alkylene" or "alkylene chain" refers to a straight or branched divalent hydrocarbon chain that connects the rest of the molecule to a group. In some embodiments, alkylene is -CH2-, -CH2CH2-, or -CH2CH2CH2-. In some embodiments, alkylene is -CH2-. In some embodiments, alkylene is -CH2CH2-. In some embodiments, alkylene is -CH2CH2-. In some embodiments, alkylene is -CH2CH2CH2-.

[0107] The term "alkoxy" refers to a group of the formula -OR, wherein R is an alkyl group as defined. Unless otherwise specifically stated in this specification, an alkoxy group may be optionally substituted as described below. Representative alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, butoxy, and pentoxy. In some embodiments, the alkoxy group is a methoxy group. In some embodiments, the alkoxy group is an ethoxy group.

[0108] The term "alkylamino" refers to a group of the formula -NHR or -NRR, wherein each R is independently an alkyl group as defined above. Unless stated otherwise specifically in the specification, an alkylamino group may be optionally substituted as described below.

[0109] The term "alkenyl" refers to a class of alkyl groups wherein there is at least one carbon-carbon double bond. In one embodiment, the alkenyl group has the formula -C (R) = CR2, wherein R refers to the remainder of the alkenyl group, which may be the same or different. In some embodiments, R is H or an alkyl group. In some embodiments, the alkenyl group is selected from ethylidene (i.e., vinyl), propenyl (i.e., allyl), butenyl, pentenyl, pentadienyl, etc. Non-limiting examples of alkenyl groups include -CH = CH2, -C (CH3) = CH2, -CH = CHCH3, -C (CH3) = CHCH3, and -CH2CH = CH2. Depending on the structure, the alkenyl group may be monovalent or divalent (i.e., alkenylene group).

[0110] The term "alkynyl" refers to a class of alkyl groups in which at least one carbon-carbon triple bond is present. Thus, "alkynylene" may refer to a divalent alkynyl group. In one embodiment, an alkenyl group has the formula -C≡CR, where R refers to the remainder of the alkynyl group. In some embodiments, R is H or an alkyl group. In some embodiments, the alkynyl group is selected from ethynyl, propynyl, butynyl, pentynyl, hexynyl, and the like. Non-limiting examples of alkynyl groups include -C≡CH, -C≡CCH3, -C≡CCH2CH3, -CH2C≡CH.

[0111] The term "aryl" refers to an aromatic ring in which each of the atoms forming the ring is a carbon atom. The aryl group may be optionally substituted. Examples of aryl groups include, but are not limited to, phenyl and naphthyl. In some embodiments, the aryl group is a phenyl group. Depending on the structure, the aryl group may be monovalent or divalent (i.e., an "arylene" group). Unless otherwise specifically stated in this specification, the term "aryl" or the prefix "ar-" (e.g., in "aralkyl") refers to an aryl group that includes optional substitutions. In some embodiments, the aryl group is partially reduced to form a cycloalkyl group defined herein. In some embodiments, the aryl group is fully reduced to form a cycloalkyl group defined herein. In some embodiments, the aryl group is C6-C 14 In some embodiments, the aryl group is C6-C 10 Aryl.

[0112] The term "cycloalkyl" refers to a monocyclic or polycyclic non-aromatic group, wherein each of the atoms forming the ring (i.e., skeleton atoms) is a carbon atom. In some embodiments, the cycloalkyl is saturated or partially unsaturated. In some embodiments, the cycloalkyl is a spirocyclic or bridged compound. In some embodiments, the cycloalkyl is fused to an aromatic ring (in this case, the cycloalkyl is bonded to a non-aromatic ring carbon atom). The cycloalkyl group includes a group with 3 to 10 ring atoms. Representative cycloalkyls include, but are not limited to, cycloalkyls with three to ten carbon atoms, three to eight carbon atoms, three to six carbon atoms, or three to five carbon atoms. Monocyclic cycloalkyl groups include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In some embodiments, the monocyclic cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. In some embodiments, the monocyclic cycloalkyl is cyclopentenyl or cyclohexenyl. In some embodiments, the monocyclic cycloalkyl is cyclopentenyl. Polycyclic groups include, for example, adamantyl, 1,2-dihydronaphthyl, 1,4-dihydronaphthyl, tetrahydronaphthyl, decalinyl, 3,4-dihydronaphthyl-1(2H)-one, spiro[2.2]pentyl, norbornyl, and bicyclo[1.1.1]pentyl. Unless otherwise specifically stated in this specification, cycloalkyl groups may be optionally substituted. Depending on the structure, cycloalkyl groups may be monovalent or divalent (i.e., cycloalkylene groups).

[0113] The term "haloalkyl" refers to an alkyl group in which at least one of the hydrogen atoms of the alkyl group has been replaced by identical or different halogen atoms, in particular fluorine atoms. Examples of haloalkyl groups include monofluoro-, difluoro- or trifluoro-methyl, -ethyl or -propyl, such as 3,3,3-trifluoropropyl, 2-fluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl or trifluoromethyl. The term "perhaloalkyl" refers to an alkyl group in which all of the hydrogen atoms of the alkyl group have been replaced by identical or different halogen atoms.

[0114] The term "heteroalkylene" refers to an alkyl group as described above in which one or more carbon atoms of the alkyl group are replaced by an O, N, or S atom. "Heteroalkylene" or "heteroalkylene chain" refers to a straight or branched divalent heteroalkyl chain that connects the remainder of the molecule to a radical. Unless specifically stated otherwise in this specification, a heteroalkyl or heteroalkylene group may be optionally substituted as described below. Representative heteroalkylene groups include, but are not limited to, -OCH2CH2O-, -OCH2CH2OCH2CH2O-, or -OCH2CH2OCH2CH2OCH2CH2O-.

[0115] The term "heterocycloalkyl" refers to a cycloalkyl group comprising at least one heteroatom selected from nitrogen, oxygen, and sulfur. Unless specifically stated otherwise in this specification, a heterocycloalkyl group can be a monocyclic or bicyclic ring system, which can include a fused (when fused to an aryl or heteroaryl ring, the heterocycloalkyl is bonded to a non-aromatic ring atom) or bridged ring system. The nitrogen, carbon, or sulfur atom in the heterocyclyl group can be optionally oxidized. The nitrogen atom can be optionally quaternized. The heterocycloalkyl group is partially or completely saturated. Examples of heterocycloalkyl groups include, but are not limited to, dioxolanyl, thienyl[1,3]dithianyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuranyl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, 1,1-dioxo-thiomorpholinyl. The term heterocycloalkyl also includes all ring forms of carbohydrates, including, but not limited to, monosaccharides, disaccharides, and oligosaccharides. Unless otherwise indicated, the ring of heterocycloalkyl has 2 to 12 carbons. In some embodiments, the ring of heterocycloalkyl has 2 to 10 carbons. In some embodiments, the ring of heterocycloalkyl has 2 to 10 carbons and 1 or 2 N atoms. In some embodiments, the ring of heterocycloalkyl has 2 to 10 carbons and 3 or 4 N atoms. In some embodiments, the ring of heterocycloalkyl has 2 to 12 carbons, 0-2 N atoms, 0-2 O atoms, 0-2 P atoms and 0-1 S atoms. In some embodiments, the ring of heterocycloalkyl has 2 to 12 carbons, 1-3 N atoms, 0-1 O atoms and 0-1 S atoms. It should be understood that when referring to the number of carbon atoms in heterocycloalkyl, the number of carbon atoms in heterocycloalkyl is different from the total number of atoms (including heteroatoms) constituting heterocycloalkyl (i.e., the skeleton atoms of heterocycloalkyl ring). Unless otherwise specifically stated in this specification, heterocycloalkyl groups may be optionally substituted. As used herein, the term "heterocycloalkylene" may refer to a divalent heterocycloalkyl group.

[0116] The term "heteroaryl" refers to an aryl group comprising one or more ring heteroatoms selected from nitrogen, oxygen, and sulfur. Heteroaryl is monocyclic or bicyclic. Illustrative examples of monocyclic heteroaryl groups include pyridyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, furazanyl, indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. Illustrative examples of monocyclic heteroaryls include pyridyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, and furazanyl. Illustrative examples of bicyclic heteroaryls include indolizine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolizine, quinoline, isoquinoline, cinnoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. In some embodiments, the heteroaryl is pyridyl, pyrazinyl, pyrimidinyl, thiazolyl, thienyl, thiadiazolyl, or furyl. In some embodiments, the heteroaryl ring contains 0-6 N atoms. In some embodiments, the heteroaryl ring contains 1-4 N atoms. In some embodiments, the ring of the heteroaryl group contains 4-6 N atoms. In some embodiments, the ring of the heteroaryl group contains 0-4 N atoms, 0-1 O atoms, 0-1 P atoms and 0-1 S atoms. In some embodiments, the ring of the heteroaryl group contains 1-4 N atoms, 0-1 O atoms and 0-1 S atoms. In some embodiments, the heteroaryl group is a C1-C9 heteroaryl group. In some embodiments, the monocyclic heteroaryl group is a C1-C5 heteroaryl group. In some embodiments, the monocyclic heteroaryl group is a 5-membered or 6-membered heteroaryl group. In some embodiments, the bicyclic heteroaryl group is a C6-C9 heteroaryl group. In some embodiments, the heteroaryl group is partially reduced to form a heterocycloalkyl group defined herein. In some embodiments, the heteroaryl group is fully reduced to form a heterocycloalkyl group defined herein. Depending on the structure, the heteroaryl group can be monovalent or divalent (i.e., a "heteroarylene" group).

[0117] Unless otherwise indicated, the terms "substituted," "substituent," and the like may refer to the individual and independent replacement of one or more hydrogen radicals in a given structure with the radical of a specified substituent including, but not limited to, D, halogen, -CN, -NH2, -NH(alkyl), -N(alkyl), -OH, -C02H, -C02alkyl, -C(=O)NH2, -C(=O)NH(alkyl), -C(=O)N(alkyl), -S(=O)2NH2, -S(=O)2NH(alkyl), -S(=O)2N(alkyl), alkyl, cycloalkyl, fluoroalkyl, heteroalkyl, alkoxy, fluoroalkoxy, heterocycloalkyl, aryl, heteroaryl, aryloxy, alkylthio, arylthio, alkylsulfoxide, arylsulfoxide, alkylsulfone, and arylsulfone. In some other embodiments, the optional substituents are independently selected from D, halogen, -CN, -NH2, -NH(CH3), -N(CH3)2, -OH, -CO2H, -CO2(C1-C4 alkyl), -C(=O)NH2, -C(=O)NH(C1-C4 alkyl), -C(=O)N(C1-C4 alkyl)2, -S(=O)2NH2, -S(=O)2NH(C1-C4 alkyl), -S(=O)2N(C1-C4 alkyl)2, C1-C4 alkyl, C3-C6 cycloalkyl, C1-C4 fluoroalkyl, C1-C4 heteroalkyl, C1-C4 alkoxy, C1-C4 fluoroalkoxy, -SC1-C4 alkyl, -S(=O)C1-C4 alkyl, and -S(=O)2(C1-C4 alkyl). In some embodiments, the optional substituents are independently selected from D, halogen, -CN, -NH2, -OH, -NH(CH3), -N(CH3)2, -NH(cyclopropyl), -CH3, -CH2CH3, -CF3, -OCH3, and -OCF3. In some embodiments, the substituted groups are substituted with one or two of the aforementioned groups. In some embodiments, the optional substituents on aliphatic carbon atoms (acyclic or cyclic) include oxo (=O).

[0118] The term "unsubstituted" means that the specified group bears no substituents. The term "optionally substituted" means that the specified group is unsubstituted or substituted with one or more substituents independently selected from the possible substituents. When indicating the number of substituents, the term "one or more" refers to from one substituent to the highest possible number of substitutions, i.e., one hydrogen is replaced by a substituent until all hydrogens are replaced by substituents.

[0119] "About" means within ±10% of a value. For example, if it is stated that "a marker can be increased by about 50%," it implies that the marker can be increased by 45%-55%.

[0120] "Active pharmaceutical agent" refers to the substance in a pharmaceutical composition that provides a therapeutic benefit when administered to a subject.

[0121] "Dosage unit" refers to the form in which a pharmaceutical agent is provided, such as a pill, tablet, or other dosage unit known in the art. In certain embodiments, a dosage unit is a vial containing a lyophilized antisense oligonucleotide. In certain embodiments, a dosage unit is a vial containing a reconstituted antisense oligonucleotide.

[0122] "Dose" refers to a specific amount of a medicament provided in a single administration or over a specific time period. In certain embodiments, a dose can be administered as one, two, or more boluses, tablets, or injections. For example, in certain embodiments requiring subcutaneous administration, the desired dose requires a volume that is not easily accommodated by a single injection, and therefore, two or more injections may be used to achieve the desired dose. In certain embodiments, a medicament is administered over an extended period of time or by continuous infusion. A dose can be stated as the amount of the medicament per hour, per day, per week, or per month. A dose can also be stated as mg / kg or g / kg.

[0123] "Modified internucleoside linkage" refers to a substitution or any alteration of a naturally occurring internucleoside linkage. For example, a phosphorothioate linkage is a modified internucleoside linkage.

[0124] "Modified nucleobase" refers to any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. For example, 5-methylcytosine is a modified nucleobase. "Unmodified nucleobase" refers to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0125] "Modified nucleoside" refers to a nucleoside having at least one modified sugar moiety and / or a modified nucleobase.

[0126] "Modified nucleotide" refers to a nucleotide having at least one modified sugar moiety, modified internucleoside linkage, and / or modified nucleobase.

[0127] "Modified oligonucleotide" refers to an oligonucleotide comprising at least one modified nucleotide.

[0128] A "modified sugar" is a substitution or alteration of a natural sugar. For example, a 2'-O-methoxyethyl modified sugar is a modified sugar.

[0129] "Motif" refers to the pattern of chemically distinct regions in an antisense compound.

[0130] "Statin" refers to an agent that inhibits the activity of HMG-CoA reductase.

[0131] "Symptoms of a cardiovascular disease or condition" refer to phenomena that are caused by and accompany a cardiovascular disease or condition and serve as an indicator of the cardiovascular disease or condition. For example, angina; chest pain; shortness of breath; palpitations; weakness; dizziness; nausea; sweating; tachycardia; bradycardia; arrhythmia; atrial fibrillation; swelling of the lower limbs; cyanosis; fatigue; fainting; facial paralysis; limb paralysis; claudication or muscle cramps; abdominal distension; or fever are symptoms of a cardiovascular disease or condition.

[0132] "Target nucleic acid" and "target sequence" refer to a nucleic acid that can be targeted by a genome editing composition. For example, a target DNA sequence within or adjacent to the ANGPTL3 gene can be targeted by a guide nucleotide associated with the Cas9 nuclease.

[0133] Methods for detecting and / or measuring polypeptides in biological materials are well known in the art and include, but are not limited to, Western blotting, flow cytometry, ELISA, RIA, and various proteomics techniques. An exemplary method for measuring or detecting polypeptides is an immunoassay, such as an ELISA. This type of protein quantification can be based on an antibody capable of capturing a specific antigen and a second antibody capable of detecting the captured antigen. Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, (1988), Cold Spring Harbor Laboratory Press, describe exemplary assays for detecting and / or measuring polypeptides.

[0134] Methods for detecting and / or measuring RNA in biological materials are well known in the art and include, but are not limited to, Northern blotting, RNA protection assays, and RT-PCR. Suitable methods are described in Molecular Cloning: A Laboratory Manual (4th Edition) By Michael R. Green, Joseph Sambrook, Peter MacCallum 2012, 2,028 pp, ISBN 978-1-936113-42-2.

[0135] Ribonucleoprotein (RNP) refers to a nuclear protein that contains RNA. RNP can be a complex of ribonucleic acid and RNA-binding protein. This combination can also be called a protein-RNA complex. These complexes can play many biological functions, including but not limited to DNA replication, DNA modification, gene expression, metabolism and RNA modification, and pre-mRNA splicing.

[0136] As used herein, the term "nucleobase editor (BE)" or "base editor (BE)" refers to a composition, for example, a fusion protein comprising a polypeptide capable of performing nucleobase modification and a Cas protein. In some embodiments, the fusion protein comprises a nuclease-inactivated Cas9 (dCas9) fused to a deaminase. In some embodiments, the fusion protein comprises a Cas9 nickase fused to a deaminase. In some embodiments, the fusion protein comprises a D10X mutation or an H840X mutation of Cas9 numbered as in the wild-type Cas9 sequence (e.g., SEQ ID NO: 1), which enables Cas9 to cut only one chain of a nucleic acid duplex. In some embodiments, the base editor comprises a programmable DNA nuclease domain fused or connected to a deaminase domain (e.g., an adenosine deaminase domain or a cytidine deaminase domain). Details of base editors are described in International PCT Application Nos. PCT / 2017 / 045381 (WO2018 / 027078) and PCT / US2016 / 058344 (WO2017 / 070632), each of which is incorporated herein by reference in its entirety.See also Komor, AC, et al., "Programmable base editing of A·T to G·Cin genomic DNA without DNA cleavage" Nature 533, 420-424 (2016); Gaudelli, NM, et al., "Programmable base editing of A·T to G·Cin genomic DNA without DNA cleavage" Nature 551,464-471(2017); Komor, AC, et al., "Improved base excision repair inhibition and bacteriophage Mu Gam proteinyields C:G-to-T:A base editors with higher efficiency and product purity" Science Advances 3:eaao4774(2017); Nishida, K. et al., "Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems", Science 353, aaf8729 (2016); Gehrke JM, Cervantes O, Clement MK, Wu Y, Zeng J, Bauer DE, Pinello L, Joung JK. An APOBEC3A-Cas9 base editor with minimized bystander and off-target activities. Nat Biotechnol. 2018 Nov; 36(10): 977-982, the entire contents of which are hereby incorporated by reference.

[0137] As used herein, the terms "biomarker" or "marker" are used interchangeably and refer to any biochemical marker, serological marker, genetic marker, or other clinical or echographic characteristic that can be used to classify a sample from a patient as being associated with a pathological condition (e.g., a cardiovascular disease or disorder).

[0138] As used herein, the term "antibody" includes, but is not limited to, a population of immunoglobulin molecules or a fragment of an immunoglobulin molecule, which can be polyclonal or monoclonal and has any class and isotype. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), for example, IgG1, IgG2, IgG3, IgG4, IgA1 (people), IgA2 (people), IgAa (dog), IgAb (dog), IgAc (dog), and IgAd (dog). This fragment typically comprises a part of an antibody molecule that specifically binds to an antigen. For example, a fragment of an immunoglobulin molecule referred to in the art as Fab, Fab', or F(ab')2 is included within the meaning of the term antibody.

[0139] As used herein, the term "label" refers to a detectable compound, composition or solid support that can be directly or indirectly conjugated to a monoclonal antibody or protein (e.g., via covalent or non-covalent means, alone or encapsulated). The label can be detectable per se (e.g., radioisotope labeling, chemiluminescent dyes, electrochemical labels, metal chelates, latex particles or fluorescent markers), or in the case of enzyme labels, can catalyze the chemical alteration of a detectable substrate compound or composition (e.g., enzymes such as horseradish peroxidase, alkaline phosphatase, etc.). The label used in the present invention can be, but is not limited to, alkaline phosphatase; glucose-6-phosphate dehydrogenase ("G6PDH"); horseradish peroxidase (HRP); chemiluminescent agents (e.g., isoluminol), fluorescent agents (e.g., fluorescein and rhodamine compounds); ribozymes; and dyes. The label can also be a specific binding molecule that is detectable itself (e.g., biotin, avidin, streptavidin, digioxigenin, maltose, oligohistidine (e.g., hexahistidine (SEQ ID NO: 114)), 2,4-dinitrobenzene, phenylarsenate, ssDNA, dsDNA, etc.). The use of the label generates a signal that can be detected by, for example, detection of electromagnetic radiation or direct visualization, and which can optionally be measured.

[0140] "Substantial binding" or "substantially binding" refers to the amount of specific binding or affinity between molecules in an assay mixture under specific assay conditions. In its broadest aspect, substantial binding involves the difference between the inability of a first molecule to bind to or recognize a second molecule and the ability of the first molecule to bind to or recognize a third molecule, such that the difference is sufficient to allow a meaningful assay to distinguish specific binding under a specific set of assay conditions, including the relative concentrations of the molecules and the time and temperature of incubation. On the other hand, in the sense of cross-reactivity, a molecule is substantially unable to bind to or recognize another molecule, wherein the reactivity exhibited by the first molecule to the second molecule is less than 25%, e.g., less than 10%, e.g., less than 5%, of the reactivity exhibited to the third molecule under a specific set of assay conditions, including the relative concentrations of the molecules and incubation. Specific binding can be tested using a number of widely known methods, e.g., immunohistochemistry assays, enzyme-linked immunosorbent assays (ELISAs), radioimmunoassays (RIAs), or western blots.

[0141] As used herein, the term "substantially identical amino acid sequence" includes amino acid sequences that are similar but not identical to naturally occurring amino acid sequences. For example, an amino acid sequence (e.g., a polypeptide) having an amino acid sequence substantially identical to flagellin may have one or more modifications, such as amino acid additions, deletions, or substitutions, relative to the amino acid sequence of naturally occurring flagellin, provided that the modified polypeptide substantially retains at least one biological activity of flagellin, such as immunoreactivity. The "percent similarity" between two sequences is a function of the number of positions containing matching or conserved residues shared by the two sequences divided by the number of positions compared, multiplied by 100. In this regard, a conserved residue in a sequence is a residue that is physically or functionally similar to a corresponding reference residue, for example, having similar size, shape, charge, chemical properties, including the ability to form covalent or hydrogen bonds, etc.

[0142] The term "targeting moiety" refers to any molecule that provides enhanced affinity for a selected target, e.g., a cell, cell type, tissue, organ, body region, or compartment (e.g., a cell, tissue, or organ compartment). Some exemplary targeting moieties include, but are not limited to, antibodies, antigens, carbohydrate base moieties, folic acid, receptor ligands, carbohydrates, aptamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands. Carbohydrate-based targeting moieties include, but are not limited to, D-galactose, multivalent galactose, N-acetyl-D-galactosamine (GalNAc), multivalent GalNAc, such as GalNAc2 and GalNAc3; D-mannose, multivalent mannose, multivalent lactose, N-acetyl-glucosamine, multivalent fucose, glycosylated polyamino acids, and lectins. The term multivalent refers to the presence of more than one monosaccharide unit. These monosaccharide subunits can be linked to each other or to the scaffold molecule via glycosidic bonds.

[0143] The term "heterologous" refers to any two or more nucleic acid or polypeptide sequences that are not typically found in the same relationship to each other in nature. For example, a heterologous nucleic acid is typically recombinantly produced and has two or more sequences, e.g., sequences from unrelated genes, that are arranged to produce a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous polypeptide typically refers to two or more subsequences that are not typically found in the same relationship to each other in nature (e.g., a fusion protein).

[0144] As used herein, the term "fragment" includes a peptide, polypeptide, or protein segment of the amino acids of a full-length protein, provided that the fragment retains reactivity with at least one antibody in the serum of a patient with the disease.

[0145] An "epitope" is an antigenic determinant on a polypeptide that is recognized and bound by a paratope on a polypeptide-specific antibody (eg, an IBD-associated antibody).

[0146] The term "clinical factors" includes symptoms of a patient associated with cardiovascular disease. Examples of clinical factors include, but are not limited to, angina; chest pain; shortness of breath; palpitations; weakness; dizziness; nausea; sweating; tachycardia; bradycardia; arrhythmia; atrial fibrillation; swelling of the lower limbs; cyanosis; fatigue; syncope; facial paralysis; quadriplegia; claudication or muscle cramps; abdominal distension; or fever. In some embodiments, the diagnosis of cardiovascular disease is based on analyzing the presence or level of one or more markers in a patient using a statistical algorithm and determining whether the patient has a combination of one or more clinical factors.

[0147] The term "prognosis" includes a prediction of the likely course and outcome of a pathological condition (e.g., cardiovascular disease), or the likelihood of recovery from the disease. In some embodiments, the use of a statistical algorithm provides a prognosis for a patient's cardiovascular disease. For example, the prognosis can be surgery, the development of one or more clinical factors, or recovery from the disease.

[0148] Provided herein are methods and compositions for targeted delivery of therapeutic agents (e.g., nucleic acid agents). As used herein, therapeutic agents can be connected or associated with a targeting moiety to help targeted delivery. For example, a therapeutic agent and a targeting moiety can form a conjugate. The therapeutic agent can include a programmable nuclease system guided by a nucleic acid compounded with a nucleic acid (e.g., a guide RNA). In some embodiments, the guide RNA can be chemically modified. In some embodiments, the modified guide RNA can be used to prepare a drug for treating any disease, disorder, or condition associated with a gene, wherein the gene can be changed, manipulated, edited, and modified by insertion or deletion of DNA. According to another aspect of the present invention, the modified guide RNA can be used to change a gene by deletion, substitution, repair, or insertion of DNA. This can be done in microorganisms or animals, particularly mammals, and more particularly in humans. The guide RNA of the present invention and CRISPR / Cas systems known in the art can be used to genetically alter or correct human cells or tissues in vitro and then inserted back into patients in need. In another aspect of the present invention, a pharmaceutical composition is provided, comprising a modified guide RNA and CRISPR-Cas system according to the present invention and a pharmaceutically acceptable carrier or excipient. The pharmaceutical composition may include a vector or cell having the modified guide RNA of the present invention. In another aspect of the present invention, a composition is provided comprising the modified guide RNA and at least one delivery means selected from GalNAc, polymers, liposomes, peptides, aptamers, antibodies, viral vectors, folic acid or transferrin.

[0149] Nuclease system

[0150] Provided herein are compositions and methods for targeted delivery of active agents or therapeutic agents (including nucleic acids, polynucleotides or oligonucleotides). The active agent can be a pharmaceutical composition, a drug, a polynucleotide, an oligonucleotide, an RNP, a lipid nanoparticle or a protein-RNA complex. Targeted delivery as described herein can guide the active agent to a specific desired location, for example, to a specific in vivo location, a cell, a tissue or organ, an identification location in the intracellular matrix, a specific location within the cell. In some embodiments, the active agent comprises a guide RNA associated with a nuclease (e.g., a CRISPR nuclease). In some embodiments, the active agent comprises a nuclease system capable of modifying the activity and / or function of one or more target genes (e.g., PCSK9 or ANGPTL3 genes).

[0151] In some embodiments, the active agent comprises a genome editing composition comprising a nuclease system. In some embodiments, the genome editing composition is a target-specific genome editing composition. In some embodiments, the genome editing composition comprises a nucleic acid-guided programmable nuclease or a portion thereof. In some embodiments of the present invention, the nuclease system comprises at least one nuclease. In some embodiments, the nuclease system comprises at least one programmable nuclease. In some embodiments, the nuclease may comprise at least one DNA binding domain and at least one nuclease domain. In some embodiments, the nuclease domain and the DNA binding domain may be heterologous. In certain embodiments, the nuclease is a DNA endonuclease and can cut single-stranded or double-stranded DNA. In certain embodiments, the nuclease can cut RNA.

[0152] In some embodiments, the nuclease system can include a Cas protein domain (also referred to as "Cas nuclease") from a CRISPR / Cas system. The Cas protein can include at least one domain that interacts with a guide nucleic acid, such as a guide RNA (gRNA). In addition, the Cas protein can be guided to the target sequence by a guide RNA. The guide RNA interacts with the Cas protein and the target sequence so that the Cas protein is guided to the target sequence and can be able to cut the target sequence. In certain embodiments, for example, Cas9, the Cas protein is a single protein effector, RNA-guided nuclease. In some embodiments, the guide RNA provides specificity for targeted cutting, and the Cas protein can be universal and paired with different guide RNAs to cut different target sequences. The terms Cas protein and Cas nuclease are used interchangeably herein.

[0153] In some embodiments, the CRISPR / Cas system can include type I, type II, or type III system components, or any orthologs thereof. The updated CRISPR / Cas locus classification scheme defines type 1 and type 2 CRISPR / Cas systems with types I to V or VI. See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36(2015); Shmakov et al., Molecular Cell, 60:385-397(2015). The type 2 CRISPR / Cas system has a single protein effector. Type II, type V, and type VI Cas proteins can be single protein, RNA-guided nucleases, referred to herein as "type 2 Cas nucleases." Type 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. S3.

[0154] In some embodiments, the Cas protein can be from a type II CRISPR / Cas system, i.e., a Cas9 protein from a CRISPR / Cas9 system. In some embodiments, the Cas protein can be from a class 2 CRISPR / Cas system, i.e., a single-protein Cas nuclease, such as a Cas9 protein or a Cpf1 protein. As further described herein, the Cas9 and Cpf1 protein families are enzymes with DNA endonuclease activity, and they can be directed to cleave a desired nucleic acid target by designing appropriate guide RNAs.

[0155] Type II CRISPR / Cas system components can be from type IIA, type IIB or type IIC systems. Cas9 nuclease structure and sequence are known to those skilled in the art (Jinek et al., Science 2012, 337: 816-821; Delcheva et al., Nature 2011, 471: 602-607, which are incorporated herein by reference). In some embodiments, wild-type Cas9 corresponds to Streptococcus pyogenes Cas9 (NCBI reference NC_002737.2, SEQ ID NO: 2) and Uniprot reference Q99ZW2 (SEQ ID NO: 1).

[0156] Streptococcus pyogenes Cas9 (wild type) protein sequence (SEQ ID NO: 1)

[0157]

[0158]

[0159] Non-limiting exemplary species from which Cas9 proteins or other components can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus spp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wallia succinicigenes, Sutterella wadsworthensis, Gammaproteus, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Succinicifiably, Rhodospirillum rubrum, Nocardia dasyphylla, Streptomyces protospiralis, Streptomyces viridechromogenes, Streptomyces viridechromogenes, Streptomyces roseus, Streptomyces roseus, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina), Burkholderia, Polaromonas naphthalenivorans, Polaromonas spp., Crocosphaera watsonii, Cyanothece sp.), Microcystis aeruginosa, Synechococcus sp., Halobacterium arabinaceticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Thiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas shaloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena), Nostoc spp., Arthrospira maxima, Arthrospira platensis, Arthrospira spp., Coleus spp., Microcoleuschthonoplastes, Oscillatoria spp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria griseus, Campylobacter gullus, Parvibaculum lavamentivorans, Corynebacterium diphtheriae, or Acaryochloris marina. In some embodiments, the Cas9 protein may be derived from Streptococcus pyogenes. In some embodiments, the Cas9 protein may be derived from Streptococcus thermophilus. In some embodiments, the Cas9 protein may be derived from Neisseria meningitidis. In some embodiments, the Cas9 protein may be derived from Staphylococcus aureus.

[0160] In some embodiments, the Cas protein may include more than one nuclease domain. For example, the Cas9 protein may include at least one RuvC-like nuclease domain (e.g., Cpf1 / Cas12a) and at least one HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 protein may be able to introduce DSB into the target sequence. In some embodiments, the Cas9 protein may be modified to contain only one functional nuclease domain. For example, the Cas9 protein may be modified so that one mutation or complete or partial deletion in the nuclease domain is present to reduce its nucleic acid cleavage activity. In some embodiments, the Cas9 protein may be modified to not contain a functional RuvC-like nuclease domain. In other embodiments, the Cas9 protein may be modified to not contain a functional HNH-like nuclease domain. In some embodiments in which only one of the nuclease domains is functional, the Cas9 protein may be a nickase capable of introducing a single-strand break ("nick") into the target sequence. In some embodiments, the conserved amino acids in the Cas9 protein nuclease domain are substituted to reduce or change the nuclease activity. In some embodiments, the Cas protein nickase can include amino acid replacements in the RuvC sample nuclease domain. Exemplary amino acid replacements in the RuvC sample nuclease domain include D10A (based on Streptococcus pyogenes Cas9 protein). In some embodiments, the nickase can include amino acid replacements in the HNH sample nuclease domain. Exemplary amino acid replacements in the HNH sample nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on Streptococcus pyogenes Cas9 protein). In some embodiments, the nuclease system described herein can include a nickase and a pair of guide RNAs, which are complementary to the sense and antisense strands of the target sequence, respectively. The guide RNA can guide the nickase to the target and introduce DSB by producing a nick (i.e., double nicking) on ​​the opposite strand of the target sequence. Chimeric Cas9 proteins can also be used, in which a domain or region of the protein is replaced by a part of different proteins. For example, the Cas9 nuclease domain can be replaced with a domain from different nucleases (e.g., Fok1). The Cas9 protein can be a modified nuclease.

[0161] Wild-type Cas9 and Cas9 sequences from various species can be compared to determine corresponding homologous amino acid residues, and the amino acid residues at, for example, D10 and H840 of SEQ ID NO: 1 can be determined and / or modified to allow the generation of Cas9 variants with corresponding mutations in homologous amino acid residues. Alignment methods are known to those skilled in the art. For example, alignment can be performed using the NCBI Constrained Multiple Alignment Tool (COBALT, accessible at st-va.ncbi.nlm.nih.gov / tools / cobalt).

[0162] In alternative embodiments, the Cas protein may be from a type I CRISPR / Cas system. In some embodiments, the Cas protein may be a component of the Cascade complex of a type I CRISPR / Cas system. For example, the Cas protein may be a Cas3 protein. In some embodiments, the Cas protein may be from a type III CRISPR / Cas system. In some embodiments, the Cas protein may be from a type IV CRISPR / Cas system. In some embodiments, the Cas protein may be from a type V CRISPR / Cas system. In some embodiments, the Cas protein may be from a type VI CRISPR / Cas system. In some embodiments, the Cas protein may have RNA cleavage activity.

[0163] Fusion protein

[0164] Provided herein are compositions and methods for targeted gene modification, such as PCSK9, ANGPTL3, APOC3, LPA, APOB, MTP, ANGPTL4, ANGPTL8, APOA5, APOE, LDLR, IDOL, NPC1L1, ASGR1, TM6SF2, GALNT2, GCKR, LPL, MLXIPL, SORT1, TRIB1, MARC1, ABCG5, or ABCG8. In some cases, the modification can be ex vivo or in vivo. In preferred embodiments, the targeted modification can be directed to a specific type of organ, tissue, or cell, such as liver hepatocytes. In some embodiments, the target gene is genetically modified using a genome editing composition comprising a fusion protein. Therefore, in some embodiments, provided herein are fusion proteins for targeted gene modification. In some embodiments, the fusion protein comprises a target-specific nuclease domain. In some embodiments, the fusion protein comprises a nucleic acid-guided programmable nuclease domain. In some embodiments, the nucleic acid-guided programmable nuclease may comprise at least one DNA binding domain and at least one nuclease domain. In some embodiments, the nuclease domain and the DNA binding domain may be heterologous. In some embodiments, the nuclease domain can be modified so that the nuclease domain is mutated to reduce its nuclease cleavage activity. In some embodiments, the nuclease activity is completely lost. In some embodiments, the nuclease activity is partially reduced. In some embodiments, the modified nuclease domain may include a modified Cas protein domain. In certain embodiments, the modified Cas protein domain is a modified Cas9. In some embodiments, the modified Cas9 domain is a nuclease-inactivated Cas9 (dCas9) domain. In some embodiments, the modified dCas9 domain is a nickase domain. In some embodiments, based on the Streptococcus pyogenes Cas9 protein, the modified Cas9 domain contains at least one substituent selected from D10A, N497A, R661A, Q695A, E762A, H840A, N863A, Q926A, H983A and D986A. In some embodiments, the modified nuclease domain is a catalytically inactive Cpf1 domain, a catalytically inactive Cas13a domain, a catalytically inactive Cas13b domain, or a catalytically inactive Cas13c domain. In some embodiments, the modified nuclease domain is a catalytically inactive CasX, CasY, Cpf1, C2c1, C2c2, C2c3, and Argonaute protein domain.

[0165] In some embodiments, the fusion protein as described herein further comprises one or more functional domains in addition to the nuclease domain. At least one protein domain may be located at the N-terminus, C-terminus, or internal position of the fusion protein. In some embodiments, two or more heterologous protein domains are located at one or more positions on the fusion protein. Non-limiting examples of functional domains include repressor domains, activator domains, methyltransferase domains, and demethylase domains. In some embodiments, the functional domain comprises a base editing enzyme domain. In some embodiments, the functional domain is a cytidine deaminase domain. For example, cytidine deaminase can deaminate a specific cytidine to uracil, resulting in a UG mismatch, which is then resolved via a cell repair mechanism to form a UA base pair, and then a TA base pair is formed, thereby producing a C to T substitution. Cytidine deaminase domains and cytidine deaminase fusion protein sequences are known to those skilled in the art, as described in Komor et al., Science Advances 2017, 3(8):eaao4774; Komor et al., Nature 2016, 533:420-424. In some embodiments, the functional domain is an adenine deaminase domain. For example, an adenine deaminase domain can deaminate adenosine to generate inosine, which can be base-paired with cytidine and then corrected to guanine by cellular repair mechanisms, thereby converting A to G. Exemplary adenosine deaminase fusion proteins such as those described in Gaudelli et al., Nature 2017 551(7681):464-471 are incorporated herein by reference in their entirety.

[0166] In some embodiments, the fusion protein as described herein comprises a nuclear localization signal (NLS). In some embodiments, the fusion protein may comprise 2, 3, 4, or 5 NLSs. In some embodiments, the fusion protein may comprise 1-10 NLSs. The NLS sequence may be fused at the N-terminus and / or C-terminus of the fusion protein. In some embodiments, the NLS may be a unipinator sequence, for example, SV40 NLS, PKKKRKV (SEQ ID NO: 3), or PKKKRRV (SEQ ID NO: 4). In some embodiments, the NLS may be a diipinator sequence, for example, the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 5). In some embodiments, the NLS may be genetically modified from its wild-type counterpart. In a preferred embodiment, the fusion protein comprises the sequence of ABE7.10 (SEQ ID NO: 6).

[0167] In some embodiments, the fusion protein may further comprise a tag domain. In some embodiments, the tag domain may comprise a fluorescent tag, a purification tag, an epitope tag, or a reporter gene tag. In some embodiments, the tag domain may comprise a fluorescent protein domain. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, MonomericAzami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent protein (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent protein (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent protein (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), or any other suitable fluorescent protein. In some embodiments, the tag domain can comprise a purification tag and / or an epitope tag. Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein (MBP), thioredoxin (TRX), poly (NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6×His (SEQ ID NO: 114), biotin carboxyl carrier protein (BCCP) and calmodulin. In some embodiments, the tag domain can include a reporter gene domain. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase or fluorescent protein.

[0168] In other embodiments, the nuclease in the nuclease system can include one or more programmable nucleases other than Cas proteins. For example, the nuclease can be selected from a large range of nucleases (e.g., homing endonucleases), ZFNs, TALENs, and megaTALs.

[0169] Naturally occurring meganucleases can recognize and cut double-stranded DNA sequences of about 12 to 40 base pairs and are generally divided into five families. In some embodiments, the meganucleases can be selected from the LAGLIDADG family, the GIY-YIG family, the HNH family, the His-Cys box family, and the PD-(D / E)XK family. In some embodiments, the DNA binding domain of the meganuclease can be engineered to recognize and bind to sequences other than its cognate target sequence. In some embodiments, the DNA binding domain of the meganuclease can be fused with a heterologous nuclease domain. In some embodiments, a meganuclease (e.g., a homing endonuclease) can be fused with a TAL module to produce a hybrid protein, such as a "megaTAL" protein. By recognizing the target sequence of the DNA binding domain of the meganuclease and the TAL module, the megaTAL protein can have improved DNA targeting specificity.

[0170] ZFN is a fusion protein comprising a zinc finger DNA binding domain ("zinc finger" or "ZF") and a nuclease domain. Each naturally occurring ZF can bind to three consecutive base pairs (DNA triplets), and the ZF repeats are combined to recognize the DNA target sequence and provide sufficient affinity. Therefore, engineered ZF repeats can be combined to recognize longer DNA sequences, for example, 9bp, 12bp, 15bp, or 18bp, etc. In some embodiments, the ZFN can comprise a ZF fused to a nuclease domain from a restriction endonuclease. For example, the restriction endonuclease can be FokI. In some embodiments, for example, when the nuclease dimerization becomes active, the nuclease domain can comprise a dimerization domain, and a pair of ZFNs comprising ZF repeats and nuclease domains can be designed for targeting a target sequence comprising two half target sequences recognized by each ZF repeat on opposite strands of the DNA molecule, with an interconnected sequence (sometimes referred to as a spacer in the literature) in between. For example, the length of the interconnected sequence can be 5bp to 7bp. When two paired ZFNs bind, the nuclease domains can dimerize and introduce a DSB within the interconnected sequence. In some embodiments, the dimerization domain of the nuclease domain can include a knob-into-hole motif to promote dimerization. For example, a ZFN can include a knob-into-hole motif in the dimerization domain of FokI.

[0171] The DNA binding domain of TALEN typically contains a variable number of 34 or 35 amino acid repeats ("modules" or "TAL modules"), each module binding to a single DNA base pair, A, T, G, or C. The 12th and 13th adjacent residues of each module ("repeat variable diresidues" or RVDs) specify the single DNA base pair to which the module binds. Although the module used to recognize G can also have an affinity for A, TALEN benefits from a simple recognition code - there is one module for each of the 4 bases - which greatly simplifies the customization of the DNA binding domain that recognizes a specific target sequence. In some embodiments, TALEN can contain a nuclease domain from a restriction endonuclease. For example, the restriction endonuclease can be FokI. In some embodiments, the nuclease domain can dimerize to become active, and a pair of TALEN can be designed to target a target sequence that contains two half target sequences recognized by each DNA binding domain on opposite strands of the DNA molecule, with an interconnecting sequence in between. For example, each half target sequence can range from 10 bp to 20 bp, and the length of the interconnecting sequence can be from 12 bp to 19 bp. When the two paired TALENs bind, the nuclease domain can dimerize and introduce a DSB within the interconnecting sequence. In some embodiments, the dimerization domain of the nuclease domain can include a knob-to-hole motif to promote dimerization. For example, a TALEN can include a knob-to-hole motif in the dimerization domain of FokI.

[0172] Certain embodiments of the present invention also provide nucleic acids encoding the nuclease systems described herein, which are provided on a vector. In some embodiments, the nucleic acid can be a DNA molecule. In other embodiments, the nucleic acid can be an RNA molecule. In some embodiments, the nucleic acid encoding the nuclease can be an mRNA molecule.

[0173] In some embodiments, nucleic acids encoding nucleases can be codon optimized for efficient expression in one or more eukaryotic cell types. In some embodiments, nucleic acids encoding nucleases can be codon optimized for efficient expression in one or more mammalian cells. In some embodiments, nucleic acids encoding nucleases can be codon optimized for efficient expression in human cells. Codon optimization methods, including codon usage tables and codon optimization algorithms, are available in the art.

[0174] Guide polynucleotide

[0175] In some embodiments of the present invention, the CRISPR / Cas nuclease system includes at least one guide polynucleotide, for example, a guide RNA. In some embodiments, the guide RNA and the Cas protein can form a ribonucleoprotein (RNP), for example, a CRISPR / Cas complex. The guide RNA can guide the Cas protein to a target sequence on a target nucleic acid molecule, wherein the guide RNA hybridizes with the target sequence, and the Cas protein cuts the target sequence. In some embodiments, the CRISPR / Cas complex can be a Cpf1 / guide RNA complex. In some embodiments, the CRISPR complex can be a type II CRISPR / Cas9 complex. In some embodiments, the Cas protein can be a Cas9 protein. In some embodiments, the CRISPR / Cas9 complex can be a Cas9 / guide RNA complex.

[0176] A guide nucleic acid (e.g., a guide RNA) can be bound to a Cas protein and target the Cas protein to a specific position within a target polynucleotide. The guide nucleic acid can comprise a nucleic acid targeting segment and a Cas protein binding segment.

[0177] A guide nucleic acid can refer to a nucleic acid that can hybridize with another nucleic acid (e.g., a target polynucleotide in a cell genome). A guide nucleic acid can be RNA, e.g., a guide RNA. A guide nucleic acid can be DNA. A guide nucleic acid can comprise DNA and RNA. A guide nucleic acid can be single-stranded. A guide nucleic acid can be double-stranded. A guide nucleic acid can comprise nucleotide analogs. A guide nucleic acid can comprise modified nucleotides. A guide nucleic acid can be programmed or designed to bind to a nucleic acid site-specific sequence.

[0178] The guide nucleic acid may comprise one or more modifications to provide a nucleic acid with new or enhanced characteristics. The guide nucleic acid may comprise a nucleic acid affinity tag. The guide nucleic acid may comprise synthetic nucleotides, synthetic nucleotide analogs, nucleotide derivatives, and / or modified nucleotides.

[0179] Guiding nucleic acid can for example comprise nucleic acid targeting region (for example, spacer region) at or near 5 ' end or 3 ' end, and it is complementary to the protospacer sequence in target polynucleotide.The spacer of guiding nucleic acid can interact with protospacer in a sequence-specific manner via hybridization (base pairing).The protospacer sequence can be located at 5 ' or 3 ' of the protospacer adjacent motif (PAM) in target polynucleotide.The nucleotide sequence in spacer region can change and determine the position that guiding nucleic acid can interact with it in target nucleic acid.The spacer region of guiding nucleic acid can be designed or modified to hybridize with any desired sequence in target nucleic acid.

[0180] The guiding nucleic acid can include two separate nucleic acid molecules, which can be referred to as dual guiding nucleic acids. The guiding nucleic acid can include a single nucleic acid molecule, which can be referred to as a single guiding nucleic acid (e.g., sgRNA). In some embodiments, the guiding nucleic acid is a single guiding nucleic acid comprising a fused CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA). In some embodiments, the guiding nucleic acid is a single guiding nucleic acid comprising crRNA. In some embodiments, the guiding nucleic acid is a single guiding nucleic acid comprising crRNA but lacking a tracRNA. In some embodiments, the guiding nucleic acid is a dual guiding nucleic acid comprising non-fused crRNA and tracrRNA. Exemplary dual guiding nucleic acids can include crRNA-like molecules and tracrRNA-like molecules. Exemplary single guiding nucleic acids can include crRNA-like molecules. Exemplary single guiding nucleic acids can include fused crRNA-like and tracrRNA-like molecules.

[0181] The crRNA can comprise the nucleic acid targeting segment (e.g., a spacer) of the guide nucleic acid and a stretch of nucleotides that can form one half of a double-stranded duplex of the Cas protein binding segment of the guide nucleic acid.

[0182] The tracrRNA may comprise a stretch of nucleotides that forms the other half of the double-stranded duplex of the Cas protein-binding segment of the gRNA. A stretch of nucleotides of the crRNA may be complementary and hybridize with a stretch of nucleotides of the tracrRNA to form a double-stranded duplex of the Cas protein-binding domain of the guide nucleic acid.

[0183] CrRNA and tracrRNA can hybridize to form guide nucleic acid.CrRNA can also provide a single-stranded nucleic acid targeting segment (e.g., spacer region) hybridized with a target nucleic acid recognition sequence (e.g., pre-spacer region).The sequence of crRNA (including spacer region) or tracrRNA molecule can be designed to be specific for the species to be used for guiding nucleic acid.

[0184] The guide RNA of the CRISPR / Cas9 system generally comprises CRISPR RNA (crRNA) and tracrRNA (tracr). The guide RNA of the CRISPR / Cpf1 system generally comprises crRNA. In some embodiments, crRNA may comprise a targeting sequence that is complementary to and hybridizes with a target sequence on a target nucleic acid molecule. The crRNA may also comprise a sequence that is complementary to and hybridizes with a portion of the tracrRNA. In some embodiments, the crRNA may be similar in structure to a naturally occurring crRNA transcribed from a bacterial CRISPR locus, wherein the targeting sequence serves as a spacer for the CRISPR / Cas9 system.

[0185] The guide RNA can target any target sequence via the targeting sequence of the crRNA. In some embodiments, the degree of complementarity between the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can be about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100%. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can be 100% complementary. In other embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can contain at least one mismatch. For example, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can contain 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 mismatches. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can contain 1-6 mismatches. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule can contain 5 or 6 mismatches.

[0186] The length of the targeting sequence can depend on the CRISPR / Cas9 system and components used. For example, different Cas9 proteins from different bacterial species have different optimal targeting sequence lengths. Therefore, the length of the targeting sequence can include 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more than 50 nucleotides. In some embodiments, the length of the targeting sequence can include 18-30 nucleotides. In some embodiments, the length of the targeting sequence can include 19-24 nucleotides. In some embodiments, the length of the targeting sequence can include 20 nucleotides.

[0187] crRNA and tracr can include any sequence with sufficient complementarity to promote the formation of a functional CRISPR / Cas9 complex. In some embodiments, the complementary sequence between crRNA and tracr can include all or part of a naturally occurring crRNA sequence (also referred to as a "tag" or "handle") complementary to the tracrRNA in the same CRISPR / Cas9 system. In some embodiments, the complementary sequence can include all or part of a repeat sequence in a naturally occurring CRISPR / Cas9 system. In some embodiments, the complementary sequence can include a truncated or modified tag or handle sequence. In some embodiments, the degree of complementarity between tracrRNA and the portion of the complementary portion that hybridizes with tracrRNA along the length of the shorter of the two sequences can be about 40%, 50%, 60%, 70%, 80% or higher, but less than 100%. In some embodiments, tracrRNA and the portion that hybridizes with tracrRNA are not 100% complementary along the length of the shorter of the two sequences because one or more protruding structures are present on tracr and / or wobble base pairing. The length of the complementary portion of tracrRNA and tracr can depend on the CRISPR / Cas9 system or tracrRNA used. For example, the length of the complementary portion can include 10-50 nucleotides, or more than 50 nucleotides. In some embodiments, the length of the complementary portion can include 15-40 nucleotides. In other embodiments, the length of the complementary portion can include 20-30 nucleotides. In other embodiments, the length of the complementary portion can include 22 nucleotides. For example, when using dual guide RNAs, the length of the complementary portion can have no upper limit.

[0188] In some embodiments, tracrRNA may comprise all or part of a wild-type tracrRNA sequence in a naturally occurring CRISPR / Cas9 system. In some embodiments, tracrRNA may comprise a truncated or modified variant of a wild-type tracrRNA. The length of tracrRNA may depend on the CRISPR / Cas9 system used. In some embodiments, the length of tracrRNA may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 nucleotides. In certain embodiments, tracrRNA has a length of at least 26 nucleotides. In another embodiment, tracrRNA has a length of at least 40 nucleotides. In some embodiments, tracrRNA may comprise certain secondary structures, for example, one or more hairpins or stem-loop structures, or one or more protruding structures.

[0189] In some embodiments, the guide RNA may comprise two RNA molecules and is referred to herein as "dual guide RNA" or "dgRNA". In some embodiments, the dgRNA may comprise a first RNA molecule comprising crRNA and a second RNA molecule comprising tracrRNA. The first and second RNA molecules may form an RNA duplex via base pairing between the flagpole on the crRNA and the tracrRNA.

[0190] In some embodiments, the guide RNA may comprise a single RNA molecule and is referred to herein as a "single guide RNA" or "sgRNA". In some embodiments, the sgRNA may comprise a crRNA covalently linked to the tracrRNA. In some embodiments, the crRNA and tracrRNA may be covalently linked via a linker. In some embodiments, the single molecule guide RNA may comprise a stem-loop structure via base pairing between a flagpole on the crRNA and the tracrRNA.

[0191] Certain embodiments of the present invention also provide nucleic acids encoding guide RNAs described herein, for example, vectors. In some embodiments, the nucleic acid may be a DNA molecule. In other embodiments, the nucleic acid may be an RNA molecule. In some embodiments, the nucleic acid may include a nucleotide sequence encoding crRNA. In some embodiments, the nucleotide sequence encoding crRNA includes a targeting sequence flanked by all or part of a repeat sequence in a naturally occurring CRISPR / Cas system. In some embodiments, the nucleic acid may include a nucleotide sequence encoding tracrRNA. In some embodiments, crRNA and tracrRNA may be encoded by two separate nucleic acids. In some embodiments, crRNA and tracrRNA may be encoded by a single nucleic acid. In some embodiments, crRNA and tracrRNA may be encoded by opposite strands of a single nucleic acid. In other embodiments, crRNA and tracrRNA may be encoded by the same strand of a single nucleic acid.

[0192] In certain embodiments, more than one guide RNA can be used with the CRISPR / Cas nuclease system. Each guide RNA can contain different targeting sequences, so that the CRISPR / Cas system cuts more than one target sequence. In some embodiments, one or more guide RNAs can have the same or different properties, such as activity or stability within the Cas9 RNP complex. When more than one guide RNA is used, each guide RNA can be encoded on the same or different vectors. The promoters used to drive the expression of more than one guide RNA can be the same or different.

[0193] The method of selecting the effective targeted guide RNA for high specificity and low off-target effect is known to those skilled in the art. For programmable base editing, the selection of the genomic sequence containing the target sequence can be as described in Komor et al., Nature, 533,420-424 (2016), which is incorporated herein by reference. The guide RNA sequence and PAM preference define the genomic target sequence of the programmable nuclease domain (e.g., Cas9, dCas9, Cas9n, Cpf1, NgAgo domain). Methods for reducing off-target binding as described in Hsu et al. (Nature biotechnology, 2013, 31(9):827-832), Fusi et al. (bioRxiv 021568; doi: http: / / dx.doi.org / 10.1101 / 021568), Chari et al. (Nature Methods, 2015, 12(9):823-6), Doench et al. (Nature Biotechnology, 2014, 32(12):1262-7), Wang et al. (Science, 2014, 343(6166):80-4), Moreno-Mateos et al. (Nature Methods, 2015, 12(10):982-8), Housden et al. (Science Signaling, 2015, 8(393):rs9), Haeussler et al. (Genome Biol. 2016; 17:148) are incorporated herein by reference. The possibility of forming a bulge between the guide RNA and the target DNA, as well as other parameters that may affect target sequence binding, can also be considered as described in Bae et al. (Bioinformatics, 2014, 30, 1473-5), Housden et al. (Science Signaling, 2015, 8(393):rs9), and Farboud et al. (Genetics, 2015, 199(4):959-71), which are also incorporated herein by reference.

[0194] RNA modification

[0195] Provided herein are modified RNA molecules suitable for targeting ex vivo and in vivo delivery systems. The modified RNA molecules can include two or more connected ribonucleic acid subunits. Non-limiting exemplary modified RNAs include CRISPR guide RNAs, short interfering RNAs (siRNAs), microRNAs (miRNAs), short hairpin RNAs (shRNAs), small nuclear RNAs (snRNAs), messenger RNAs (mRNAs), precursor mRNAs (pre-mRNAs), antisense RNAs (asRNAs), and heteronuclear RNAs (hnRNAs). Modified RNAs as described herein include RNA sequences and any structural embodiments thereof, such as single-stranded, double-stranded, triple-stranded, circular, helical, hairpins, stem-loops, protrusions, etc. The modified RNA can include at least about 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, or 500 bases in length. The modified RNA may comprise at least about 1 kilobase (kb), 2kb, 3kb, 4kb, 5kb, 10kb, 20kb, 50kb or greater length. In some embodiments, the modified RNA is a CRISPR guide RNA (gRNA). The gRNA may be a single guide RNA or a dual guide RNA. In some embodiments, the modified RNA is an mRNA. In some embodiments, the mRNA may be isolated from a cell or tissue. In some embodiments, the mRNA may be transcribed from DNA. In some embodiments, the mRNA may be chemically synthesized.

[0196] In certain embodiments, the RNA molecules of the modification provided herein are resistant to degradation by RNA enzymes or other exonucleases. In certain embodiments, the RNA molecules of the modification provided herein are stable to prevent degradation by endonucleases. In some embodiments, compared with unmodified RNA, the RNA molecules of the modification provided herein are suitable for in vivo delivery and induce less cellular immune receptor activation (e.g., TLR, RIG-I). Such as Diebold (2008) Adv Drug Deliv Rev. Apr 29; 60 (7): 813-23) and Sorrentino (1998) Cell Mol Life Sci. Aug; 54 (8): RNA modifications described in 785-94, both of which are incorporated herein by reference in their entirety.

[0197] In addition to "unmodified" or "natural" nucleobases (e.g., the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U)), many modified nucleobases or nucleobase mimetics known to those skilled in the art are suitable for use in the compounds described herein. Unmodified or natural nucleobases can be modified or substituted to provide oligonucleotides with improved properties. For example, nuclease-resistant oligonucleotides can be prepared with these bases or with any of the synthetic and natural nucleobases (e.g., inosine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidine) and oligomer modifications described herein. Alternatively, any substituted or modified analogs of the above bases and "universal bases" can be used. When a natural base is replaced by a non-natural and / or universal base, the nucleotide is referred to herein as comprising a modified nucleobase and / or nucleobase modification. Modified nucleobases and / or nucleobase modifications also include natural, non-natural and universal bases comprising a conjugate moiety, such as a ligand as described herein. Preferred conjugate moieties for conjugation to nucleobases include cationic amino groups, which can be conjugated to nucleobases via appropriate alkyl, alkenyl or amide bonded linkers.

[0198] As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Exemplary modified nucleobases include, but are not limited to, other synthetic and natural nucleobases such as inosine, xanthine, hypoxanthine, nubularine, isoguanine, tuberculin, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(methylthio)-N6-(isopentenyl)adenine, 6-(alkyl)adenine, 6-(methyl)adenine, 7-(deaza)adenine, 8-(alkenyl)adenine, 8-(alkyl)adenine, 8-(alkynyl)adenine, 8-( adenine, 8-(alkyl)guanine, 8-(thio)adenine, 8-(thiol)adenine, N6-(isopentyl)adenine, N6-(methyl)adenine, N6,N6-(dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(deaza)guanine, 8-(alkyl)guanine, 8-(alkenyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine, 8-(hydroxy)adenine )guanine, 8-(thioalkyl)guanine, 8-(thiol)guanine, N-(methyl)guanine, 2-(thio)cytosine, 3-(deaza)-5-(aza)cytosine, 3-(alkyl)cytosine, 3-(methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5-(methyl)cytosine, 5-(propynyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N4-(acetyl)cytosine, 3-(3-amino-3-carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)cytosine, uracil, 5-(methylaminomethyl)-2-(thio)uracil, 4-(thio)uracil, 5-(methyl)-4-(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4-(dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil, 5-(aminoalkyl)uracil, 5-(guanidinoalkyl)uracil, 5-(1,uracil, 5-(3-oxadiazole-1-alkyl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonyl-methyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(thio)pseudouracil, 4-(thio)pseudouracil, 2,4-(dithio)pseudouracil, 5-(alkyl)pseudouracil Pyrimidine, 5-(methyl)pseudouracil, 5-(methyl)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4-(thio)pseudouracil, 5-(methyl)-4-(thio)pseudouracil, 5-(alkyl)-2,4-(dithio)pseudouracil, 5-(methyl)-2,4-(dithio)pseudouracil, 1-methylpseudouracil (N1-methylpseudouracil), 1-substituted pseudouracil, 1-substituted 2(thio)-pseudouracil, 1-substituted 4-(thio)pseudouracil, 1-substituted 2,4-(dithio)pseudouracil, 1-(aminocarbonylethylidene)-pseudouracil, 1-(aminocarbonylethylidene)-2(thio)-pseudouracil , 1-(aminocarbonylethylidene)-4-(thio)pseudouracil, 1-(aminocarbonylethylidene)-2,4-(dithio)pseudouracil, 1-(aminoalkylaminocarbonylethylidene)-pseudouracil, 1-(aminoalkylamino-carbonylethylidene)-2(thio)-pseudouracil, 1-(aminoalkylaminocarbonylethylidene)-4-(thio)pseudouracil, 1-(aminoalkylaminocarbonylethylidene)-2,4-(dithio)pseudouracil, 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 1-(aza) -2-(thio)-3-(aza)-phenothiazin-1-yl, 7-substituted-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-substituted-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-substituted-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-1-yl, 7-(guanidinylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(guanidinylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(guanidinylhydroxy)-1,3-(diaza)-2-(oxo)-phenothiazin-1-yl -yl, 7-(guanidinylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenothiazin-l-yl, 1,3,5-(triaza)-2,6-(dioxane)-naphthalene, inosine, xanthine, hypoxanthine, nubularine, tuberculocidin, isoguanine, inosinyl, 2-azainosinyl, 7-deaza-inosinyl, nitroimidazolyl, nitropyrazolyl, nitrobenzimidazolyl, nitroindazolyl, aminoindolyl, pyrrolopyrimidine phenyl, 3-(methyl)isoquinolone, 5-(methyl)isoquinolone, 3-(methyl)-7-(propynyl)isoquinolone, 7-(aza)indolyl, 6-(methyl)-7-(aza)indolyl, imidazopyridinyl, 9-(methyl)-imidazopyridinyl, pyrrolopyrazinyl, isoquinolone, 7-(propynyl)isoquinolone, propynyl-7-(aza)indolyl, 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6-(dimethyl)indolyl , phenyl, naphthyl, anthracenyl, phenanthrenyl, pyrenyl, stilbene, tetraphenylene, pentacene, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymine, 2-pyridone, 5-nitroindole, 3-nitropyrrole, 6-(aza)pyrimidine, 2-(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidines, N2-substituted purines, N6-substituted purines, O6-substituted purines, substituted 1,2,4-triazole, pyrrolopyrimidin-2-one-3-yl, 6-phenyl-pyrrolopyrimidin-2-one-3-yl, para-substituted-6-phenyl-pyrrolopyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolopyrimidin-2-one-3-yl, di-ortho-substituted 6-phenyl-pyrrolopyrimidin-2-one-3-yl, p-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidin-2-one-3-yl, o-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidin-2-one-3-yl, di-o-(aminoalkylhydroxy)-6-phenyl-pyrrolopyrimidin-2-one-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, or any O-alkylated or N-alkylated derivative thereof. Alternatively, any substituted or modified analogs of the above bases and "universal bases" can be used. A universal nucleobase is any nucleobase that is capable of pairing with all four naturally occurring nucleobases without substantially affecting the melting behavior, intracellular enzyme recognition, or activity of the oligonucleotide duplex. Some exemplary universal nucleobases include, but are not limited to, 2,4-difluorotoluene, nitropyrrolyl, nitroindolyl, 8-aza-7-deazaadenine, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methylisoquinolonyl, 5-methylisoquinolonyl, 3-methyl-7-propynylisoquinolonyl, 7-azaindolyl, 6-methyl-7-azaindolyl, imidazopyridinyl, 9-methyl-imidazopyridinyl, pyrrolopyrazinyl, isoquinolonyl, 7-propynylisoquinolonyl, propynyl-7-azaindolyl, 2,4,5-trimethylphenyl, 4-methylindolyl, 4,6-dimethylindolyl, phenyl, naphthyl, anthracenyl, phenanthrenyl, pyrenyl, stilbenyl, tetracenyl, pentacene, and structural derivatives thereof (see, e.g., Loakes, 2001, Nucleic Acids and Related Products). Acids Research, 29, 2437-2447, which is incorporated herein by reference in its entirety). Other nucleobases include those disclosed in U.S. Pat. No. 3,687,808; those disclosed in International Application No. PCT US09 / 038425, filed March 26, 2009; those disclosed in the Concise Encyclopedia Of Polymer Science And Engineering, pp. 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990; those disclosed in English et al., Angewandte Chemie, International Edition, 1991, 30, 613; those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn,P.Ed.Wiley-VCH, 2008; and those disclosed by Sanghvi, YS, Chapter 15, dsRNA Research and Applications, pp. 289-302, Crooke, ST and Lebleu, B., eds., CRC Press, 1993. All contents of the above documents are incorporated herein by reference.

[0199] In some embodiments, the RNA of modification as described herein is modified to attach delivery and / or targeting moiety, such as GalNAc. Suitably, GalNAc can be attached to 3' end, 5' end or both of RNA. In some embodiments, GalNAc is attached to 3' end. In some embodiments, the RNA of modification shows improvement relative to its unmodified equivalent. This improvement can be related to improved specificity (such as reducing the gRNA of off-target effect or requiring lower concentration), improved stability (such as resistance to enzyme (such as nuclease)), improved functionality or reduced immunogenicity or immunostimulatory properties. In some embodiments, the RNA of modification shows effective transfection into cells and / or improved properties, allowing it to be delivered and maintained in organisms, tissues, body fluids or cells so that RNA (such as guide RNA) can play functionality. Compared with their unmodified equivalents, the method for measuring the properties of these improvements is well known to those skilled in the art, and includes those methods as described herein. Therefore, in some embodiments, a modified RNA is provided herein, which has improved stability compared with its unmodified equivalent. Unmodified equivalent refers to RNA, for example, targeting the same specific gene sequence and interacting with the same Cas9 or CRISPR nuclease and comprising a guide RNA of natural nucleotides. The stability improved includes improved stability or resistance to enzymes (such as nucleases), which can be present in cells, tissues or body fluids, and can additionally contribute to the degradation of RNA so that its functionality is reduced. In certain embodiments, the improved stability includes increased serum stability. In some embodiments, there is provided herein a modified guide RNA, which has improved CRISPR activity compared to an unmodified equivalent. This paper describes a method for measuring CRISPR activity. In some embodiments, there is provided herein a modified guide RNA, which has reduced immunostimulatory activity compared to an unmodified equivalent. This paper describes a method for measuring immunostimulation.

[0200] Provided herein are modified mRNA molecules for targeted delivery. For example, mRNA encoding a CRISPR enzyme (e.g., Cas9, Cas12b, or base editor (BE)) can be modified for specific tissue targeting. mRNA can be modified at least one nucleotide and / or backbone modification at the 2' position. In some embodiments, the nucleotides in the mRNA may include modifications of thioate. In some embodiments, the mRNA may include modifications of one or more of 2'-OMe, 2'-F, N-1-methyl-5-pseudouridine, 5-methyluridine, 5-methoxyuridine, and 5-ethoxyuridine.

[0201] In certain embodiments, the mRNA sequence provided herein comprises fully modified or partially modified mRNA. In some embodiments, mRNA comprises chemical modifications in fragments or multiple fragments of entire length. Non-limiting exemplary modifications and modification patterns of the nucleotides of mRNA or its sections are shown in Table 2 and Table 3.

[0202] Provided herein are modified guide RNAs for use with CRISPR / Cas systems, wherein the guide RNA can be modified by chemically modifying at least one nucleotide and / or backbone modification at the 2' position. Backbone modification can include modification of thioesters. In certain embodiments, the modified nucleotides are selected from nucleotides that interact with the Cas amino acids in the Cas protein to achieve binding of the guide RNA to Cas. In certain embodiments, the modification can include replacement of the 2'-OH on the nucleotide by H, -OR, -R, -O-C1-C6-alkylene-OR, -O-C1-C6-alkylene-OH, halogen, -SH, -SR, -NH2, -NHR, -N(R)2, -C1-C6-alkylene-NH2, -C1-C6-alkylene-NHR, -C1-C6-alkylene-N(R)2, or CN, wherein each R is independently C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, and halogen is F, Cl, Br, or I. In some cases, the modification is 2'-O-methyl and / or 2'-F. In some embodiments, the modification comprises one or more of 2'-F, phosphorothioate internucleotide linkage modification, acyclic nucleotide, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), and 2'-ara-F modification. In some embodiments, the modification comprises 2'-MOE. In some embodiments, the modification comprises phosphorothioate internucleotide linkage modification. In some embodiments, the modification comprises 4-O-alkyl ribose sugars, such as 4'-methoxy and 4'-ethoxy modifications.

[0203] Suitably, the modified guide RNA can be applied with the Streptococcus pyogenes CRISPR / Cas9 system or any other CRISPR / Cas system (e.g., those in Staphylococcus aureus or Staphylococcus haemolyticus). The guide RNA of Cpf1 from Lachnospiraceae bacterium ND2006 or Cpf1 from Acidominococcus species BV3L6 can also be modified or similar modification patterns can be used.

[0204] In certain embodiments, the guide RNA sequence comprises a fully modified single guide RNA. In some embodiments, the guide RNA comprises a chemical modification in the tracrRNA portion. Non-limiting exemplary modifications and modification patterns of the nucleotides of the guide RNA according to the present invention are shown in Tables 2 and 3.

[0205] Modified guide RNAs as described herein can be used in combination with CRISPR / Cas systems or CRISPR / Cas enzymes to achieve changes in target genes or DNA sequences. The CRISPR / Cas enzyme can comprise a CRISPR nuclease, such as Cas9, Cpf1, C2c1, C2c2, or C2c3. In some embodiments, the CRISPR / Cas enzyme can comprise a CRISPR nuclease with modified or reduced nuclease activity, such as a nuclease-inactivated Cas9 or Cpf1. For example, mutations can be introduced into one or both nuclease subdomains of the Cas9 enzyme to generate a Cas9 nickase or nuclease-inactivated Cas9. Exemplary inactivating mutations in Cas9 include changes in positions D10, E762, H840, N854, N863, or D986 of SEQ ID NO: 1. For example, a D10A mutation in the RuvC subdomain of Cas9 and an H840A mutation in the HNH subdomain inactivate the Cas9 nuclease. The D10A mutation in the RuvC subdomain of Cas9 or the H840A mutation in the HNH subdomain generates the Cas9 nickase. Additional amino acid substitutions in Cas9 are discussed in WO 15 / 89354, which is incorporated herein in its entirety.

[0206] The modified guide RNA shares sequence identity with or is capable of hybridizing to a target nucleotide (e.g., a target gene or target DNA sequence). In some embodiments, the modified guide RNA has at least 100%, 99%, 98%, 96%, 95%, 90%, 85%, 80%, 75%, or 70% correspondence or identity with the target nucleotide of the gene or target DNA.

[0207] Nucleotides as described herein can be synthetic or chemically modified. For example, the guide RNA provided herein can be synthetic or chemically modified guide RNA. The nucleotides in the modified guide RNA can be those corresponding to one or more nucleotides in the binding region of the guide RNA and Cas9 and / or the nucleotides in the binding region of the guide RNA and the target DNA. The remaining unmodified nucleotides of the guide RNA can be those that need to be identified in order to minimize the binding of Cas9 to the 2'-OH position on the base. In some embodiments, the nucleotides can be modified at the 2' position of the sugar portion of the nucleotide. In some embodiments, the 2'-OH group of the sugar portion is selected from H, OR, R, halogen, SH, SR, H2, NHR, N (R) 2 or CN group replacement, wherein R is C1-C6 alkyl, alkenyl or alkynyl, and halogen is F, Cl, Br or I. Other modifications may include reverse (deoxy) abasic, amino, fluoro, chloro, bromo, CN, CF, methoxy, imidazole, carboxylate, thioester, C1 to C10 lower alkyl, substituted lower alkyl, alkaryl or aralkyl, heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino or substituted silyl. Methods for preparing RNA with specific sequences and modifications are known to those skilled in the art, for example, Dellinger et al. (2011), J. Am. Chem. Soc, 133, 11540; US 8,202,983; Kumar et al., (2007), J. Am. Chem. Soc, 129, 6859-64; WO2013176844, which are incorporated herein by reference in their entirety.

[0208] In some embodiments, polynucleotides or oligonucleotides as provided herein can be synthetic. For example, guide RNA can be a guide RNA of chemical synthesis. The yield of synthetic RNA is based on sequence and modification. 2'-O-methyl modification has been shown to increase coupling effectiveness or efficiency during RNA synthesis, and thus increases the yield of chemically synthesized RNA. In addition, nucleotides can be modified by phosphorothioate. Phosphorothioate (PS) bonds replace the sulfur atom of the non-bridge oxygen in the phosphate backbone of the oligonucleotide. Therefore, exemplary nucleotides of the present invention include but are not limited to ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, including LNA with β-D-ribose configuration, α-LNA with α-L-ribose configuration (diastereomers of LNA), 2'-amino-LNA with 2'-amino functionalization and 2'-amino-α-LNA with 2'-amino functionalization) or its hybrid.

[0209] Conjugates for targeted delivery

[0210] Provided herein are conjugates suitable for targeted delivery of agents (e.g., mRNA, guide RNA, miRNA, siRNA, DNA, peptides, or other micro- or macromolecules). The conjugate may contain one or more aptamers, ligands, or moieties for in vitro or in vivo targeted delivery. In some embodiments, the conjugate comprises a targeting moiety (or ligand), a linker, and an active agent (or payload) connected to the targeting moiety. The active agent may be a therapeutic agent, a prophylactic agent, or a diagnostic / prognostic agent. The active agent may have the ability to manipulate the physiological function (e.g., gene expression) of a subject. The active agent may be a guide RNA, mRNA, miRNA, siRNA, DNA, or peptide. The active agent may be connected to the targeting moiety via a linker, via a non-covalent bond, via a core base pairing, or any combination thereof. In some embodiments, the conjugate may be a conjugate between a single active agent and a single targeting moiety having formula (I): XYZ, wherein X is a targeting moiety; Y is a linker; and Z is a guide RNA. In certain embodiments, one targeting ligand can be conjugated to two or more active agents, wherein the conjugate has the formula: X-(YZ)n. For example, the conjugate can comprise a guide RNA and an mRNA. In certain embodiments, one active agent can be linked to two or more targeting ligands, wherein the conjugate has the formula: (XY)nZ. In other embodiments, one or more targeting moieties can be linked to one or more active payloads, wherein the conjugate can be of the formula (XYZ)n. In various combinations, the conjugate can be of the formula XYZYX, (XYZ)nYZ, or XY-(XYZ)n, wherein X is a targeting moiety; Y is a linker; and Z is an active agent, such as a guide RNA. The number of each moiety in the conjugate can vary depending on the type of agent, the size of the conjugate, the delivery target, the particles used to package the conjugate, other active agents (e.g., immune adjuvants), and the route of administration. Each occurrence of X, Y, and Z can be the same or different, e.g., a conjugate can contain more than one type of targeting moiety, more than one type of linker, and / or more than one type of active agent, and n is an integer equal to or greater than 1. In some embodiments, n is an integer between 1 and 50, or between 2 and 20, or between 5 and 40. In some embodiments, n is an integer of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 41, 43, 44, 45, 46, 47, 48, 49, or 50.

[0211] In some embodiments, active agents (e.g., guide RNAs) can be delivered to cells and tissues using viral, polymer and liposome formulations, cell penetrating peptides, aptamers, ligands or conjugates, and antibody methods. A moiety or ligand can guide the guide RNA to a specific organ, tissue, or cell, e.g., liver hepatocytes, and can be referred to as a targeting moiety. In some embodiments, the targeting moiety modifies one or more properties of the attached molecule (e.g., mRNA or guide RNA), including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and clearance.

[0212] Exemplary moieties that can be attached to the active agents described herein include, but are not limited to, intercalators, reporters, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, bile acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, dyes, lipid moieties (e.g., cholesterol moieties) (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); bile acid (Ma Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); thioethers, for example, hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765); sulfocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533); aliphatic chains, for example, dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 49); phospholipids, for example, dihexadecyl-rac-glycerol or triethylammonium-1,2-bis-O-hexadecyl-rac-glycerol-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777); polyamine or polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969); adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651); palmitoyl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229); or octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923), all references incorporated herein in their entirety. Targeting moieties may include naturally occurring molecules or recombinant or synthetic molecules, including but not limited to GalNAc or its derivatives (e.g.,dimers, trimers or tetramers of GalNAc or its derivatives), polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl)methacrylamide copolymer (HMPA), polyethylene glycol (PEG, e.g., PEG-2K, PEG-5K, PEG-10K, PEG-12K, PEG-15K, PEG-20K, PEG-40K), MPEG, [MPEG]2, polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide acrylamide polymers, polyphosphazenes, polyethyleneimine, cationic groups, spermine, spermidine, polyamines, pseudopeptide-polyamines, peptidomimetic polyamines, dendritic polyamines, arginine, amidines, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, thyrotropin, melanocyte-stimulating hormone, lectins, glycoproteins, surfactant protein A, mucins, glycosylated polyamino acids, transferrin, diphosphates, polyglutamate, polyaspartate, aptamers, asialofetuin, hyaluronic acid, procollagen, immunoglobulins (e.g., antibodies), insulin, transferrin, albumin, sugar-albumin conjugates, intercalating agents (e.g., acridine), cross-linking agents (e.g., psoralen, mitomycin C), Porphyrins (e.g., TPPC4, texaphyrin, Sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., steroids, bile acids, cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propylene glycol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine), peptides (e.g., α-helical peptides, dimethoxytrityl or phenoxazine),

[00145] The present invention also includes but is not limited to peptides such as peptides for the treatment of leukemia, leukemia, and leukemia. These peptides may include, but are not limited to, peptides for the treatment of leukemia, leukemia, and leukemia. These peptides may include but are not limited to, peptides for the treatment of leukemia, leukemia, and leukemia. These peptides may include but are not limited to, peptides for the treatment of leukemia, leukemia, and leukemia. These peptides may include but are not limited to, peptides for the treatment of leukemia, leukemia, and leukemia.folic acid, B12, riboflavin, biotin and pyridoxal), vitamin cofactors, lipopolysaccharides, activators of p38 MAP kinase, activators of NF-κB, taxa, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, myoservin, tumor necrosis factor alpha (TNFα), interleukin-1β, gamma interferon, natural or recombinant low-density lipoprotein (LDL), natural or recombinant high-density lipoprotein (HDL), and cell permeating agents (e.g., helical cell permeating agents), peptides and peptidomimetic ligands, including those with naturally occurring or modified peptides (e.g., D or L peptides); alpha, beta or gamma peptides; N-methyl peptides; azapeptides; peptides having one or more amide bonds (i.e., peptide bonds) replaced by one or more urea, thiourea, carbamate or sulfonylurea bonds; or cyclic peptides Amphipathic peptides include, but are not limited to, cecropin, lycotoxin, paradaxin, buforin, CPF, bombinin-like peptide (BLP), cathelicidin, ceratotoxin, stalked ascidian peptide, lamprey intestinal antimicrobial peptide (HFIAP), magainine, brevinins-2, dermaseptin, melittin, pleurocidin, H2A peptide, clawed frog peptide, esculentinis-1, and caerin. Peptidomimetics (also referred to herein as oligopeptides) are molecules that can fold into a defined three-dimensional structure similar to a natural peptide. The peptide or peptidomimetic ligand or portion can be about 5-50 amino acids long, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long. In some embodiments, the targeting moiety can be other peptides, such as somatostatin, octreotide, LHRH (luteinizing hormone releasing hormone), epidermal growth factor receptor (EGFR) binding peptide, aptide or bipodal peptide, RGD-containing peptide, protein scaffold (e.g., fibronectin domain), single domain antibody, stable scFv or other homing peptide. As non-limiting examples, the protein or peptide-based targeting moiety can be a protein, such as thrombospondin, tumor necrosis factor (TNF), annexin V, interferon, angiostatin, endostatin, cytokine, transferrin, GM-CSF (granulocyte-macrophage colony stimulating factor) or growth factor, such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), platelet-derived growth factor (PDGF), basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF). In some embodiments,The targeting moiety can be an antibody, an antibody fragment, an RGD peptide, folic acid, or a prostate-specific membrane antigen (PSMA). In some embodiments, the protein scaffold can be an antibody-derived protein scaffold. Non-limiting examples include single domain antibodies (dAbs), nanobodies, single chain variable fragments (scFvs), antigen binding fragments (Fabs), antibodies (Avibodies), minibodies, CH2D domains, Fcabs, and bispecific T cell engager (bite) molecules. In some embodiments, scFvs are stable scFvs, wherein scFvs have ultra-stable properties. In some embodiments, nanobodies can be derived from single variable domains (VHHs) of camelid antibodies. ,

[0213] In some embodiments, the targeting moiety identifies or binds to a target cell, marker or molecule that is only present on or mainly present on a specific cell surface. For example, the targeting moiety can bind to a tumor antigen and guide an activator (such as a guide RNA-Cas complex) to a malignant cell. In some embodiments, the targeting moiety identifies intracellular proteins. In some embodiments, the targeting moiety guides the conjugate to a position in a specific tissue, cell or cell. The targeting moiety can guide the conjugate in culture or in the whole organism or in both. In different cases, the targeting moiety can be bound to a receptor present on the target cell surface or in the target cell, wherein the targeting moiety is bound to the receptor with effective specificity, affinity and activity. In other embodiments, the targeting moiety targets the conjugate to a specific tissue, such as the liver, kidney, lung or pancreas. In other cases, the targeting moiety can guide the conjugate to cells of the reticuloendothelium or lymphatic system, or to specialized phagocytes, such as macrophages or eosinophils. In some embodiments, the targeting moiety can recognize an RTK receptor, an EGF receptor, a serine or threonine kinase, a G protein-coupled receptor, a methyl CpG binding protein, a cell surface glycoprotein, a cancer stem cell antigen or marker, a carbonic anhydrase, a cytolytic T lymphocyte antigen, a DNA methyltransferase, an exoenzyme, a glycosylphosphatidylinositol-anchored co-receptor, a glypican-associated integral membrane proteoglycan, a heat shock protein, a hypoxia-inducible protein, a multidrug resistance transporter, a tumor-associated macrophage marker, a tumor-associated carbohydrate antigen, a TNF receptor family member, a transmembrane protein, a tumor necrosis factor receptor superfamily member, a tumor differentiation antigen, a zinc-dependent metalloexopeptidase, a zinc transporter, a sodium-dependent transmembrane transporter, a member of the SIGLEC family of lectins, or a matrix metalloproteinase.

[0214] In some embodiments, the conjugates described herein (e.g., guide RNA conjugates) comprise at least one N-acetyl-galactosamine (GalNAc), N-acetyl-glucosamine (GluNAc), or mannose (e.g., mannose-6-phosphate). In some embodiments, the targeting moiety comprises at least one N-acetyl-galactosamine (GalNAc), N-acetyl-glucosamine (GluNAc), or mannose (e.g., mannose-6-phosphate).

[0215] In some embodiments, the conjugates described herein include one or more targeting moieties comprising N-acetylgalactosamine (GalNAc) or a GalNAc derivative. Such conjugates are also referred to herein as GalNAc conjugates. In some embodiments, the conjugates target RNA to specific cells, e.g., liver cells, e.g., hepatocytes. In some embodiments, the GalNAc derivatives can be attached via a linker (e.g., a divalent or trivalent branched linker).

[0216] In some embodiments, the conjugates described herein are carbohydrate conjugates. In some embodiments, the carbohydrate conjugate comprises a monosaccharide. In some embodiments, the monosaccharide is N-acetylgalactosamine (GalNAc). GalNAc and GalNAc derivatives can bind to the asialoglycoprotein receptor (ASGPR), also known as the Ashwell-Morell receptor, a lectin expressed primarily on liver hepatocytes.

[0217] For example, GalNAc conjugates are described in U.S. Patent No. 8,106,022, the entire contents of which are incorporated herein by reference. In some embodiments, GalNAc conjugates are used as ligands for targeting guide RNA to specific cells. In some embodiments, for example, by being used as ligands for the asialoglycoprotein receptors of liver cells (e.g., hepatocytes), GalNAc conjugates target guide RNA to liver cells. In some embodiments, carbohydrate conjugates include one or more GalNAc derivatives. GalNAc derivatives can be attached via joints (e.g., divalent or trivalent branched joints). In some embodiments, GalNAc conjugates are conjugated to the 3' end of the sense strand. In some embodiments, the GalNAc ligand is conjugated to an active agent (e.g., 3' end of a guide RNA) via a joint (e.g., a joint as described herein). In some other embodiments, the GalNAc ligand is conjugated to an active agent (e.g., 5' end of a guide RNA) via a joint (e.g., a joint as described herein).

[0218] In some embodiments, the GalNAc ligand can be conjugated to a short polymer oligonucleotide via a joint and a spacer, wherein the shorter oligonucleotide conjugate is complementary to the segment of RNA. RNA includes all lengths, structures and forms of RNA molecules, including, for example, target mRNA and target guide RNA. In some embodiments, short polymer GalNAc conjugates and RNA constitute a pharmaceutical composition. For example, the oligonucleotide and RNA (e.g., coupling sequence) conjugated to short polymer GalNAc can together constitute a pharmaceutical composition via the WCH-bonding of complementary nucleotides. The length of the short polymer oligonucleotide conjugate can include 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or more than 50 nucleotides. In some embodiments, the length of the coupling sequence can include 15-40 nucleotides. In some embodiments, the length of the coupling sequence can comprise 19-30 nucleotides. In some embodiments, the length of the coupling sequence can comprise 20-24 nucleotides.

[0219] In some embodiments, provided herein are pharmaceutical compositions comprising one or more GalNAc-conjugated short polymer oligonucleotides and one or more RNAs. In some embodiments, a single GalNAc-conjugated short polymer oligonucleotide (e.g., GalNAc-conjugated RNA) can be complementary to multiple oligonucleotide segments in an RNA. For example, a single GalNAc-conjugated short polymer can comprise a coupling sequence complementary to multiple segments in an RNA. In some embodiments, a plurality of GalNAc ligand-conjugated short polymer oligonucleotides complementary to multiple oligonucleotide segments in an RNA can constitute a pharmaceutical composition.

[0220] In certain embodiments, the targeting moiety of the conjugates described herein comprises a ligand having the structure shown in Table 1 below.

[0221] Table 1. Non-limiting examples of targeting moiety structures.

[0222]

[0223]

[0224]

[0225]

[0226] As shown in Table 1, each of t, n, p, q, and m is independently 0 or an integer from 1 to 30. In some embodiments, each of t, n, p, q, and m of Table 1 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 13, 15, 16, 17, 18, 19, or 20. In some embodiments, each of t, n, p, q, and m of Table 1 is independently 0, 1, 2, 3, 4, or 5. In some embodiments, each of t, n, p, q, and m of Table 1 is independently 0, 1, 2, or 3. In some embodiments, each of t, n, p, q, and m of Table 1 is independently 1 or 2. Therefore, it is understood that it is contemplated herein that in some embodiments of the compounds of Table 1, t is 0 to 10. In some embodiments, t is 1 to 5. In some embodiments, t is 10 to 20. In some embodiments, t is 1 or 2. In some embodiments, t is 1. In some embodiments, t is 2. In some embodiments of the compounds of Table 1, m is 0 to 10. In some embodiments, m is 1 to 5. In some embodiments, m is 10 to 20. In some embodiments, m is 1 or 2. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments of the compounds of Table 1, n is 0 to 10. In some embodiments, n is 1 to 5. In some embodiments, n is 10 to 20. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments of the compounds of Table 1, p is 0 to 10. In some embodiments, p is 1 to 5. In some embodiments, p is 10 to 20. In some embodiments, p is 1 or 2. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments of the compounds of Table 1, q is 0 to 10. In some embodiments, q is 1 to 5. In some embodiments, q is 10 to 20. In some embodiments, q is 1 or 2. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, each R is OH or NHC(O)CH3 or a combination thereof. In some embodiments, in compounds (1-1a), (1-2a), (1-3a), (1-4a), (1-5a), (1-6a), (1-7a), (1-8a), (1-9a), (1-10a), (1-11a), (1-12a), (1-16a), (1-21a), (1-22a), (1-23a), (1-24a), (1-25a) and (1-26a) of Table 1, x is 0 or an integer from 1 to 5.In some embodiments, in compounds (1-1b), (1-2b), (1-3b), (1-4b), (1-5b), (1-6b), (1-7b), (1-8b), (1-9b), (1-10b), (1-11b), (1-12b), (1-16b), (1-21b), (1-22b), (1-23b), (1-24b), (1-25b), and (1-26b) of Table 1, x is 0 or an integer from 1 to 5. In some embodiments, x is 1. In some embodiments, x is 2. In some embodiments, x is 0. In some embodiments, x is 3. In some embodiments, x is 4. In some embodiments, x is 5.

[0227] The targeting moiety can be conjugated to a core base, a sugar moiety or an internucleoside bond of a nucleic acid (e.g., a guide RNA or mRNA). Conjugation with a purine core base or a derivative thereof can occur at any position, including endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7- or 8-position of a purine core base is attached to a moiety. Conjugation with a pyrimidine core base or a derivative thereof can also occur at any position. In some embodiments, the 2-, 5- and 6-positions of a pyrimidine core base can be partially substituted. When a moiety is conjugated to a core base, a preferred position is one that does not interfere with hybridization (i.e., does not interfere with the hydrogen bond interactions required for base pairing).

[0228] Conjugation with the sugar moiety of nucleoside can occur on any carbon atom.Exemplary carbon atoms that can be attached to the sugar moiety of conjugate moiety include 2', 3' and 5' carbon atoms.γ-position can also be attached to (for example, in abasic residues) conjugate moiety.Internucleoside bond can also carry conjugate moiety.For phosphorus-containing bond (for example, phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate etc.), conjugate moiety can be directly attached to phosphorus atom or attached to O, N or S atom combined with phosphorus atom.For amine or amide-containing internucleoside bond (for example, PNA), conjugate moiety can be attached to the nitrogen atom of amine or amide or attached to adjacent carbon atoms.

[0229] There are many methods for preparing oligonucleotide conjugates. Generally, oligonucleotide is attached to conjugate part by making reactive groups (for example, OH, SH, amine, carboxyl, aldehyde etc.) on oligonucleotide contact with reactive groups on conjugate part. In some embodiments, a reactive group is electrophilic, and another is nucleophilic. For example, electrophilic group can be the functional group containing carbonyl, and nucleophilic group can be amine or thiol. The conjugation method of nucleic acid and related oligomeric compound with and without linking group is well described in document (for example, Manoharan in Antisense Research and Applications, Crooke and LeBleu, ed., CRC Press, Boca Raton, Fla., 1993, Chapter 17), which is incorporated herein by reference in its entirety.

[0230] The targeting moiety can be attached to an active agent or therapeutic nucleic acid as described herein, such as a guide RNA, via RNA-RNA or RNA-DNA base pairing and hybridization. Without wishing to be bound by any theory, the targeting moiety can include a coupling sequence that can identify or bind to an active agent (e.g., a guide RNA or mRNA). In some embodiments, the targeting moiety includes a coupling sequence that can hybridize with the 5' portion, 3' portion, or middle portion of the guide RNA. The guide RNA hybridized with the coupling sequence can include an extension. For example, the coupling sequence can hybridize with the extension sequence of the guide RNA, so that the guide RNA is guided to the desired position in vivo, in vitro, between cells, or within the cell, while the functionality of the guide RNA (e.g., interaction with a CRISPR enzyme or binding to a target sequence) is unaffected. In some embodiments, the guide RNA includes an extension that includes a polynucleotide tail. In some embodiments, the guide nucleic acid includes a poly (A) tail, a poly (U) tail, or a poly (T) tail that can hybridize with the poly (U) tail, poly (A) tail, or poly (A) tail of the coupling sequence. In some embodiments, the guide nucleic acid can be a guide RNA comprising an (A)n or (U)n sequence. In some embodiments, the guide nucleic acid can comprise DNA and can comprise an (A)n or (T)n sequence. In some embodiments, the coupling sequence can comprise an (A)n (SEQ ID NO: 115), (U)n (SEQ ID NO: 116), or (T)n (SEQ ID NO: 117) sequence. As used herein, n can be any integer between 1 and 200.

[0231] The conjugated sequence may share sequence identity or complementarity with the nucleic acid active agent or a portion thereof. In some embodiments, the conjugated sequence may share at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with a guide RNA described herein or a portion of such a guide RNA. In some embodiments, the conjugate sequence can share at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% identity with the complement of a guide RNA described herein, or the complement of a portion of such a guide RNA. In some embodiments, the conjugate sequence can comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 7, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least 100 consecutive nucleobases.

[0232] In some embodiments, the targeting moiety can include a chemically modified coupling sequence or be associated with a chemically modified coupling sequence. In some embodiments, the coupling sequence includes an extension that hybridizes with a therapeutic nucleic acid (e.g., a guide RNA) or a portion thereof. In some embodiments, the extension of the coupling sequence can be chemically modified. In some embodiments, the therapeutic nucleic acid (e.g., a guide RNA) can include an extension. In some embodiments, the extension of the guide RNA can be chemically modified. Non-limiting examples of guide RNA extensions and complementary or substantially complementary coupling sequence extensions are shown in Table 2 below.

[0233] Table 2. Exemplary RNA GalNAc conjugate single chemical entity coupling sequences.

[0234]

[0235]

[0236]

[0237] As used in Table 2, capital letters A, C, G, and U refer to ribonucleotides with the nucleobases adenine, cytosine, guanine, and uracil, respectively; lowercase letters a, c, g, and u refer to modified (e.g., 2'-OMe or 2'-MOE) ribonucleotides with the nucleobases adenine, cytosine, guanine, and uracil, respectively; the letter "T" refers to thymine or deoxythymidine; and the letter "s" refers to a phosphorus-containing bond (e.g., a phosphorothioate (PS) bond, a phosphodiester bond, or a phosphorodithioate bond). As used in Table 2, "(GalNAc)" refers to a targeting moiety, such as a targeting moiety comprising GalNAc or a derivative thereof. As used in Table 2, "(GalNAc)" also includes a targeting moiety comprising multiple GalNAc structures or derivatives thereof (e.g., dimers, trimers, tetramers of GalNAc or derivatives thereof, including the GalNAc structures described in Table 1). In some embodiments, "s" represents a phosphorothioate (PS) bond. As disclosed herein, nucleotide sequences and modification patterns include all lengths, structures, and types of RNA or fragments thereof, CRISPR guide RNAs (e.g., sgRNAs), dual guide RNAs, or mRNAs. For example, the nucleotide sequences and modification patterns described in Table 2 above may indicate RNA sequences and modification patterns in single guide RNAs, dual guide RNAs, nuclease mRNAs, or any fragments or segments thereof.

[0238] Non-limiting examples of guide RNAs conjugated to receptor targeting moieties and coupling sequences comprising targeting moieties are provided in Table 3 below. The (GalNAc) conjugate moiety is covalently conjugated to the 3' and / or 5' ends of the guide RNA, and / or is covalently conjugated to the 3' and / or 5' ends of the guide RNA and has an additional nucleotide spacer between the ligand and the guide RNA. Guide RNA conjugates 3-1 and 3-2 (Table 3) are representative examples of direct conjugation of the GalNAc ligand to the guide RNA. Guide RNA conjugates 3-10 to 3-21, wherein the GalNAc ligand is conjugated to the 3' / 5' ends of the additional 3' and / or 5' nucleotide spacers. The guide RNA chain is extended to the 3' end or the 5' end or both with the desired number of nucleotides. (GalNAc) is conjugated to the 3' end, the 5' end or both of the oligonucleotide, which is complementary to the nucleotides extended on the guide RNA chain to form a complementary duplex resulting in a single chemical entity. Conjugate designs 3-3 to 3-8 consist of an extended nucleotide spacer and a complementary strand of the spacer carrying a GalNAc ligand. As used in Table 3, capital letters A, C, G, and U refer to ribonucleotides with the nucleobases adenine, cytosine, guanine, and uracil, respectively; lowercase letters a, c, g, and u refer to modified (e.g., 2'-OMe or 2'-MOE) ribonucleotides with the nucleobases adenine, cytosine, guanine, and uracil, respectively; the letter "T" refers to thymine or deoxythymidine; and the letter "s" refers to a phosphate bond (e.g., a phosphorothioate (PS) bond, a phosphodiester bond, or a phosphorodithioate bond). In some embodiments, "s" represents a PS bond. As used in Table 3, "(GalNAc)" refers to a targeting moiety, such as a targeting moiety comprising GalNAc or a derivative thereof. As used in Table 3, "(GalNAc)" also includes targeting moieties comprising multiple GalNAc structures or derivatives thereof (eg, dimers, trimers, tetramers of GalNAc or derivatives thereof).

[0239] Table 3. Guide RNA GalNAc conjugate design

[0240]

[0241]

[0242]

[0243]

[0244]

[0245] As disclosed herein, nucleotide sequences and modification patterns include all lengths, structures, and types of RNA or fragments thereof, CRISPR guide RNAs (e.g., sgRNAs), dual guide RNAs, or mRNAs. For example, the nucleotide sequences and modification patterns described in Table 3 above may indicate RNA sequences and modification patterns in single guide RNAs, dual guide RNAs, nuclease mRNAs, or any fragments or segments thereof.

[0246] The targeting moiety can be attached to nucleic acid as described herein via a carrier. The carrier can include (i) at least one "backbone attachment point", preferably two "backbone attachment points", and (ii) at least one "tether attachment point". As used herein, "backbone attachment point" refers to a functional group (e.g., a hydroxyl group), or is generally useful for and suitable for incorporating a carrier monomer into an oligonucleotide backbone (e.g., a phosphate or modified phosphate, e.g., a sulfur-containing backbone). A "tether attachment point" (TAP) refers to an atom of a carrier monomer connecting a selected portion, e.g., a carbon atom or a heteroatom (different from the atom providing a backbone attachment point). The selected portion can be, for example, a carbohydrate, such as a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, and a polysaccharide. Optionally, the selected portion is connected to the carrier monomer by an intervening tether. Therefore, the carrier will generally include a functional group (e.g., an amino group) or generally provide a key that is suitable for incorporating another chemical entity (e.g., a part) or tethering to a constituent atom.Representative U.S. patents that teach the preparation of nucleic acid conjugates include, but are not limited to, U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512 ,439;5,578,718;5,608,046;4,587,044;4,605,735;4,667,025;4,762,779;4,789,737;4,824,941;4,835,263;4,876,335;4,904,582;4,958,013;5,082,830;5,112,963;5,214,136;5,082,830;5,112,963;5,149,782;5,214,136 ; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241; 5,391,723; 5,416,203; 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,5 Nos. 95,726; 5,597,696; 5,599,923; 5,599,928; 5,672,662; 5,688,941; 5,714,166; 6,153,737; 6,172,208; 6,300,319; 6,335,434; 6,335,437; 6,395,437; 6,444,806; 6,486,308; 6,525,031; 6,528,631; 6,559,279; the contents of which are incorporated herein by reference in their entirety.

[0247] The targeting moiety can be attached to an active agent, such as a guide RNA, via a joint. The joint can be bound to one or more active agents and a targeting moiety ligand to form a conjugate, wherein the conjugate releases at least one active agent, such as a guide RNA or a guide RNA-Cas complex after being delivered to the target cell. The joint can be attached to the targeting moiety and the active agent by a functional group independently selected from ester bonds, disulfides, amides, acylhydrazones, ethers, carbamates, carbonates and ureas. Alternatively, the joint can be attached to the targeting moiety or the active agent by a non-cleavable group (such as provided by the conjugation between thiol and maleimide, azide and alkynes). In some embodiments, the targeting moiety includes one or more joints. In some embodiments, one or more joints as described herein connect a part of the targeting moiety to the different parts of the targeting moiety. For example, the targeting moiety can include 2, 3, 4, 5 or more GalNAc structures or derivatives thereof, which are connected by one or more joints. In some embodiments, two or more GalNAc structures or derivatives thereof in the targeting moiety are connected by one or more non-cleavable joints. In some embodiments, the conjugates described herein comprise an active agent directly linked to a sugar moiety of a targeting moiety.

[0248] The linkers may each independently comprise one or more functional groups selected from the group consisting of ethylene glycol, propylene glycol, amide, ester, ether, alkyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl, wherein each of the alkyl, alkenyl, cycloalkyl, heterocyclyl, aryl, and heteroaryl groups is optionally substituted with one or more groups each independently selected from the group consisting of halogen, cyano, nitro, hydroxy, carboxyl, carbamoyl, ether, alkoxy, aryloxy, amino, amide, carbamate, alkyl, alkenyl, alkynyl, aryl, aralkyl, cycloalkane, In some embodiments, the linker comprises a phosphate, a thiophosphate, an amide, an ether, an oxime, a hydrazine, or a carbamate. As contemplated herein, it is understood that in some embodiments, the targeted conjugates of formula (V), (VI), (VIa), or (VIb) comprise a linker as described herein. For example, the groups R and L are independently selected from the group consisting of halogen, cyano, nitro, hydroxy, carboxyl, carbamoyl, ether, alkoxy, aryloxy, amino, amide, carbamate, alkyl, alkenyl, alkynyl, aryl, arylalkyl, cycloalkyl, heteroaryl, and heterocyclyl. 1 -L 12 Any of may comprise one or more linkers.

[0249] In some embodiments, the linker may independently comprise C1-C 10Straight chain alkyl, C1-C 10 Straight chain O-alkyl, C1-C 10 Straight-chain substituted alkyl, C1-C 10 Straight chain substituted O-alkyl, C4-C 13 Branched alkyl, C4-C 13 Branched O-alkyl, C2-C 12 Straight chain alkenyl, C2-C 12 Straight chain O-alkenyl, aralkyl, C3-C 12 Straight-chain substituted alkenyl, C3-C 12 Straight chain substituted O-alkenyl, polyethylene glycol, polylactic acid, polyglycolic acid, poly(lactide-co-glycolide), polycaprolactone, polycyanoacrylate, ketone, aryl, heterocycle, succinate, amino acid, aromatic group, ether, crown ether, urea, thiourea, amide, purine, pyrimidine, bipyridine, indole derivative used as a crosslinking agent, chelating agent, aldehyde, ketone, diamine, diol, heterocyclic structure, aziridine, disulfide, thioether, hydrazone and combination thereof. For example, the linker can be a C3 straight chain alkyl or ketone. The alkyl chain of the linker can be substituted by one or more substituents or heteroatoms. In some embodiments, the alkyl chain of the linker can be optionally interrupted by one or more atoms or groups selected from -O-, -C(=O)-, -NR, -O-C(=O)-NR-, -S-, -SS-.

[0250] In some embodiments, the linker can be cleavable and cleaved to release the active agent. The cleavable functional group can be hydrolyzed in vivo or can be designed to be enzymatically hydrolyzed (e.g., by cathepsin B). As used herein, a "cleavable" linker refers to any linker that can be physically or chemically cleaved. Examples of physical cleavage can be cleavage by light, radioactive emission, or heat, while examples of chemical cleavage include cleavage by redox reaction, hydrolysis, pH-dependent cleavage.

[0251] The linker may comprise a direct bond or an atom (e.g. oxygen or sulfur), a unit (e.g. NR 1, C(O), C(O)NH, SO, SO2, SO2NH or a chain of atoms such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, aralkyl, aralkenyl, aralkynyl, heteroaralkyl, heteroaralkenyl, heteroaralkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylaralkyl, alkylaralkenyl, alkylaralkynyl, alkenylaralkyl, alkenylaralkenyl, alkenylaralkynyl, alkynylaralkyl, alkynylaralkenyl, alkynylaralkynyl, alkylheteroaralkyl, alkylheteroaralkenyl, alkylheteroaralkynyl, alkenylheteroaralkyl, alkenylheteroaralkenyl, alkenylheteroaralkynyl Alkynyl, alkynylheteroaralkyl, alkynylheteroaralkenyl, alkynylheteroaralkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, wherein one or more methylene groups may be interrupted or terminated by O, S, S(O), SO2, N(R'), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocycle; wherein R' is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is 1-24 atoms, preferably 4-24 atoms, preferably 6-18 atoms, more preferably 8-18 atoms, and most preferably 8-16 atoms.

[0252] In one embodiment, the linker is —[(PQ″-R)q—X—(P'Q'″-R')q']q″-T—, wherein P, R, T, P′, R′ and T are each independently absent at each occurrence, CO, NH, O, S, OC(O), NHC(O), CH2, CH2NH, CHO; NHCH(Ra)C(O), —C(O)—CH(Ra)—NH—, CH═N—O,

[0253]

[0254]

[0255] or heterocyclyl; Q" and Q'" are each independently absent at each occurrence, -(CH2)n-, -C(R1)(R2)(CH2)n-, -(CH2)nC(R1)(R2)-, -(CH2CH2O)mCH2CH2-, or -(CH2CH2O)mCH2CH2NH-; X is absent or a cleavable linker; Ra is H or an amino acid side chain; R1 and R2 are each independently H, CH3, OH, SH, or N(RN)2 at each occurrence; RN is each independently H, methyl, ethyl, propyl, isopropyl, butyl, or benzyl at each occurrence; q, q', and q" are each independently 0-20 at each occurrence, and the repeat units may be the same or different; n is independently 1-20 at each occurrence; m is independently 0-50 at each occurrence.

[0256] In one embodiment, the linker comprises at least one cleavable linking group. In certain embodiments, the linker is a branched linker. The branch point of the branched linker can be at least trivalent, but can be a tetravalent, pentavalent, or hexavalent atom, or a group exhibiting such multivalence. In certain embodiments, the branch point is -N, -N(O)-C, -O-C, -S-C, -SS-C, -C(O)N(O)-C, -OC(O)N(O)-C, -N(O)C(O)-C, or -N(O)C(O)O-C; wherein Q is independently H or an optionally substituted alkyl group at each occurrence. In other embodiments, the branch point is glycerol or a glycerol derivative.

[0257] In one embodiment, the linker can be cleaved by an enzyme. As a non-limiting example, the linker can be a polypeptide portion, such as AA in WO2010093395 of Govindan, the contents of which are incorporated herein by reference in their entirety; it can be cleaved by intracellular peptidases. Govindan teaches that the AA in the linker can be a dipeptide, tripeptide or tetrapeptide, such as Ala-Leu, Leu-Ala-Leu and Ala-Leu-Ala-Leu. In another example, the cleavable linker can be a branched peptide. The branched peptide linker can comprise two or more amino acid portions that provide an enzyme cleavage site. Any branched peptide linker disclosed in WO1998019705 of Dubowchik (the contents of which are incorporated herein by reference in their entirety) can be used as a linker in the conjugate of the present invention. As another example, the linker can comprise a lysosomal cleavable polypeptide disclosed in US 8877901 of Govindan et al., the contents of which are incorporated herein by reference in their entirety. As another example, the linker can comprise a protein peptide sequence that is selectively enzymatically cleavable by a tumor-associated protease, such as any of the Y and Z structures disclosed in US 6,214,345 to Firestone et al., the contents of which are incorporated herein by reference in their entirety.

[0258] In some embodiments, the linker may include a cleavable linking group. A cleavable linking group is a linking group that is sufficiently stable outside the cell but is cut to release the two parts of the linker binding after entering the target cell. In a preferred embodiment, the cleavage ratio of the cleavage group in the target cell or under a first reference condition (which can, for example, be selected to simulate or represent intracellular conditions) is at least 10 times faster than the cleavage ratio in the blood of the subject or under a second reference condition (which can, for example, be selected to simulate or represent conditions found in blood or serum), preferably at least 100 times faster. The cleavable linking group can be sensitive to cleavage agents, for example, pH, redox potential, or the presence of degradation molecules. Typically, cleavage agents are more prevalent or found at higher levels or activity in serum or blood within the cell. Examples of such degrading agents include: redox agents that are selected for a particular substrate or that are not substrate specific, including, for example, oxidative or reductive enzymes or reducing agents (e.g., thiols) present in cells that can degrade the redox-cleavable linking group by reduction; esterases; endosomes or agents that are capable of generating an acidic environment, e.g., those that result in a pH of five or less; enzymes that can hydrolyze or degrade the acid-cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

[0259] The cleavable linking group (e.g., a disulfide bond) can be sensitive to pH. The pH of human serum is 7.4, while the average pH in cells is slightly lower, ranging from about 7.1-7.3. Endosomes have a more acidic pH, ranging from 5.5-6.0, and lysosomes have an even more acidic pH, about 5.0. Some linkers will have a cleavable linking group that is cleaved at a preferred pH, thereby releasing the cationic lipid from the ligand in the cell or releasing it into the desired compartment of the cell.

[0260] The linker can include a cleavable linking group that can be cleaved by a specific enzyme. The type of cleavable linking group incorporated into the linker can depend on the cell to be targeted. For example, a liver targeting ligand can be linked to a cationic lipid via a linker that includes an ester group. Liver cells are rich in esterases, so the linker is more effectively cleaved in liver cells than in cell types that are not rich in esterases. Other cell types rich in esterases include cells of the lung, renal cortex, and testis.

[0261] A class of cleavable linking groups is a redox cleavable linking group, which is cut after reduction or oxidation. The example of a reducible cleavable linking group is a disulfide linking group (—S—S—). In order to determine whether a candidate cleavable linking group is a suitable "reducible cleavable linking group" or, for example, whether it is suitable for use with a specific RNA portion and a specific targeting agent, the method described herein can be considered. For example, a reagent known in the art can be used to evaluate a candidate by incubating with dithiothreitol (DTT) or other reducing agents, which simulates the cleavage rate observed in a cell (e.g., a target cell). Candidates can also be evaluated under conditions selected to simulate blood or serum conditions. In a preferred embodiment, the candidate compound cuts at most 10% in blood. In a preferred embodiment, the degradation of useful candidate compounds in cells (or under conditions selected to simulate intracellular conditions) is at least 2, 4, 10 or 100 times faster than blood (or under conditions selected to simulate extracellular conditions in vitro). Standard enzyme kinetic assays can be used to determine the rate of cleavage of candidate compounds under conditions selected to mimic intracellular media and compared to conditions selected to mimic extracellular media.

[0262] In some embodiments, the linker can comprise a cleavable linking group based on a phosphate. The cleavable linking group based on a phosphate is cleaved by an agent that degrades or hydrolyzes the phosphate group. Examples of agents that cleave phosphate groups in cells are enzymes, such as phosphatases in cells. Examples of phosphate-based linking groups (i.e., phosphorus-containing bonds or linkers) are —P(O)(ORk)—O—, —O—P(S)(ORk)—O—, —O—P(S)(SRk)—O—, —S—P(O)(ORk)—O—, —O—P(O)(ORk)—S—, —S—P(O)(ORk)—S—, —O—P(S)(ORk)—S—, —S—P(S)(ORk)—O—, —O—P(O)(Rk)—O—, —O—P(S)(Rk)—O—, —S—P(O)(Rk)—O—, —S—P(S)(Rk)—O—, —S—P(O)(Rk)—S—, —O—P(S)(Rk)—S—. In some embodiments, the phosphate-based linking group is —O—P(O)(OH)—O—, —O—P(S)(OH)—O—, —O—P(S)(SH)—O—, —S—P(O)(OH)—O—, —O—P(O)(OH)—S—, —S—P(O)(OH)—S—, —O—P(S)(OH)—S—, —S—P(S)(OH)—O—, —O—P(O)(H)—O—, —O—P(S)(H)—O—, —S—P(O)(H)—O—, —S—P(S)(H)—O—, —S—P(O)(H)—S—, —O—P(S)(H)—S—S—. In some embodiments, the phosphate-based linker is —O—P(O)(OH)—O—.

[0263] In some embodiments, the linker may include an acid-cleavable linking group. An acid-cleavable linking group is a linking group that is cut under acidic conditions. In a preferred embodiment, the acid-cleavable linking group is cut in an acidic environment having a pH of about 6.5 or lower (e.g., about 6.0, 5.5, 5.0 or lower), or is cut by a reagent (e.g., enzyme) that can be used as a general acid. In cells, specific low pH organelles (e.g., endosomes and lysosomes) can provide a cutting environment for the acid-cleavable linking group. Examples of acid-cleavable linking groups include, but are not limited to, esters of hydrazones, esters, and amino acids. The acid-cleavable group may have the general formula—C═NN—, C(O)O, or—OC(O). A preferred embodiment is when the carbon (alkoxy group) attached to the oxygen of the ester is an aryl group, a substituted alkyl group, or a tertiary alkyl group (e.g., dimethylpentyl or tert-butyl). These candidates can be evaluated using methods similar to those described above.

[0264] In some embodiments, the linker can comprise an ester-based linking group. Ester-based cleavable linking groups are cleaved by enzymes (e.g., esterases and amidases) in cells. Examples of ester-based cleavable linking groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. Ester-cleavable linking groups have the general formula—C(O)O— or —OC(O)—. These candidates can be evaluated using methods similar to those described above.

[0265] In some embodiments, the linker may comprise a peptide-based linking group. Peptide-based cleavable linking groups are cleaved by enzymes (e.g., peptidases and proteases) in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to produce oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. Peptide-based cleavable groups do not include amide groups (—C(O)NH—). Amide groups can be formed between any alkylene, alkenylene, or alkynylene groups. Peptide bonds are special types of amide bonds formed between amino acids to produce peptides and proteins. Peptide-based cleavable groups are generally limited to peptide bonds (i.e., amide bonds) formed between amino acids that produce peptides and proteins, and do not include the entire amide functional group. Peptide-based cleavable linking groups have the general formula —NHCHRAC(O)NHCHRBC(O)—, where RA and RB are the R groups of two adjacent amino acids.

[0266] When targeting cell types rich in peptidases (eg, liver cells and synoviocytes), linkers containing peptide bonds can be used.

[0267] Typically, the suitability of a candidate's cleavable linking group can be assessed by testing the ability of a degradation agent (or condition) to cut the candidate linking group. It is also necessary to test the ability of a candidate's cleavable linking group to resist cutting in blood or when in contact with other non-target tissues. Therefore, the relative sensitivity to cutting between the first and second conditions can be determined, wherein the first condition is selected to indicate the cutting in the target cell, and the second condition is selected to indicate the cutting in other tissues or biological fluids (e.g., blood or serum). It can be assessed in a cell-free system, in a cell, in a cell culture, in an organ or tissue culture, or in a whole animal. An initial assessment is performed under cell-free or culture conditions and confirmed to be potentially useful by further assessment in a whole animal. In a preferred embodiment, the cutting of a useful candidate compound in a cell (or under selected in vitro conditions to simulate intracellular conditions) is at least 2, 4, 10, or 100 times faster than that of blood or serum (or under selected in vitro conditions to simulate extracellular conditions).

[0268] In some embodiments, the conjugates described herein comprise a structure of Formula (I),

[0269]

[0270] Wherein each X is independently H or a protecting group, and W represents an active agent or a coupling sequence. One or more linkers of formula (I) may each independently comprise a linker as described in the present invention. In some embodiments, each of the protecting groups of formula (I) is independently selected from: 4-acetoxy-2,2-dimethylbutyryl (ADMB), 3-(2-hydroxyphenyl)-3,3-dimethylpropionate (DMBPP), 3-(2-hydroxy-4,6-dimethylphenyl)-3,3-dimethylpropionate group (TMBPP), methylsulfonylethoxycarbonyl (Msc), 2,2-dimethylcyclopropane (DMTM) phosphate, 2-pyridylmethyl, flat In some embodiments, X is H. In some embodiments, each X is independently selected from H and Bz. In some embodiments of formula (I), W is an active agent. In some embodiments, W is a nucleic acid. In some embodiments, W is a gRNA. In some embodiments, W is a single-stranded, double-stranded, partially double-stranded or hairpin stem-loop nucleic acid. In some embodiments of formula (I), W is a coupling sequence. In some embodiments, W comprises RNA or DNA sequence. W can include one or more modified DNA or RNA bases. The core base can include any chemical modification as described herein. In some embodiments, the core base includes 2'-OH or 2'-OMe modification. For example, W can include one or more 2'-OMe modified adenine, cytosine, guanine and uracil, referred to as (a), (c), (g) or (u). In some embodiments, the modified RNA (such as gRNA or mRNA) includes at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50 or more modified core bases. In some embodiments, the modified RNA includes one or more modified core bases near the 5' end, near the 3' end or in the middle of the sequence. The modified nucleobases in the modified RNA may be continuous or discontinuous. In some embodiments, the modified RNA comprises one or more 2'-OMe modifications dispersed along the length of the sequence. In some embodiments, the modified RNA comprises one or more 2'OH modifications dispersed along the length of the sequence.In some embodiments, the modified RNA comprises alternating 2'-OH and 2'OMe modifications. In some embodiments, W comprises (A)n, (T)n, (U)n, (a)n or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 50 (SEQ ID NO: 118). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 20 (SEQ ID NO: 119) or 3 to 15 (SEQ ID NO: 120). In some embodiments, W comprises one or more nucleotide sequences complementary to the coupling sequence. In some embodiments, W comprises one or more guanines or cytosines. In some embodiments, W comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50 or more guanines or cytidines. In some embodiments, one or more guanines or cytidines are complementary to one or more cytidines or guanines in the coupling sequence. In some embodiments, the guanine or cytidine is at the end of W or the coupling sequence. Without wishing to be bound by any theory, it is expected that guanine-cytidine pairing forms a "GC lock" or "CG lock", which will increase binding affinity. The guanine and / or cytidine in W or the coupling sequence can be continuous or discontinuous and can comprise any of the chemical modifications as described herein, such as 2'-OMe or 2'-OH modifications.

[0271] In some embodiments, the conjugate of Formula (I) comprises the structure of Formula (Ia),

[0272]

[0273] In some embodiments, the conjugate of formula (I) comprises the structure of formula (Ib),

[0274]

[0275] In some embodiments, the conjugates described herein comprise a structure of Formula (II),

[0276]

[0277] Wherein each X is independently H or a protecting group, Z is a modified or unmodified C5 or C6 monosaccharide, and W represents an active agent or a coupling sequence. One or more linkers of formula (II) can each independently comprise a linker as described in the present invention. In some embodiments, each of the protecting groups of formula (II) is independently selected from: 4-acetoxy-2,2-dimethylbutyryl (ADMB), 3-(2-hydroxyphenyl)-3,3-dimethylpropionate (DMBPP), 3-(2-hydroxy-4,6-dimethylphenyl)-3,3-dimethylpropionate group (TMBPP), methylsulfonylethoxycarbonyl (Msc), 2,2-dimethylcyclopropane (DMTM) phosphate, 2-pyridylmethyl, In some embodiments, X is H. In some embodiments, each X is independently selected from H and Bz. In some embodiments of formula (II), Z is galactose or mannose. In some embodiments of formula (II), Z is GalNAc. In some embodiments of formula (II), W is an active agent. In some embodiments, W is a nucleic acid. In some embodiments, W is a gRNA. In some embodiments, W is a single-stranded, double-stranded, partially double-stranded, or hairpin stem-loop nucleic acid. In some embodiments of formula (II), W is a coupling sequence. In some embodiments, W comprises an RNA or DNA sequence. In some embodiments, W comprises (A)n, (T)n, (U)n, (a)n or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 50 (SEQ ID NO: 118). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 20 (SEQ ID NO: 119) or 3 to 15 (SEQ ID NO: 120).

[0278] In some embodiments, the conjugate of formula (II) comprises the structure of formula (IIa),

[0279]

[0280] In some embodiments, the conjugate of formula (II) comprises the structure of formula (IIb),

[0281]

[0282] In some embodiments, the conjugate of formula (II) comprises the structure of formula (IIc),

[0283]

[0284] In some embodiments, the conjugates described herein comprise a structure of Formula (III),

[0285]

[0286] Wherein each X is independently H or a protecting group, Z is a modified or unmodified C5 or C6 monosaccharide, and W represents an active agent or a coupling sequence. One or more linkers of formula (III) can each independently comprise a linker as described in the present invention. In some embodiments, each of the protecting groups of formula (III) is independently selected from: 4-acetoxy-2,2-dimethylbutyryl (ADMB), 3-(2-hydroxyphenyl)-3,3-dimethylpropionate (DMBPP), 3-(2-hydroxy-4,6-dimethylphenyl)-3,3-dimethylpropionate group (TMBPP), methylsulfonylethoxycarbonyl (Msc), 2,2-dimethylcyclopropane (DMTM) phosphate, 2-pyridylmethyl, In some embodiments, X is H. In some embodiments, each X is independently selected from H and Bz. In some embodiments of formula (III), Z is galactose or mannose. In some embodiments of formula (III), Z is GalNAc. In some embodiments of formula (III), W is an active agent. In some embodiments, W is a nucleic acid. In some embodiments, W is a gRNA. In some embodiments, W is a single-stranded, double-stranded, partially double-stranded, or hairpin stem-loop nucleic acid. In some embodiments of formula (III), W is a coupling sequence. In some embodiments, W comprises an RNA or DNA sequence. In some embodiments, W comprises (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 50 (SEQ ID NO: 118). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 20 (SEQ ID NO: 119) or from 3 to 15 (SEQ ID NO: 120).

[0287] In some embodiments, the conjugate of formula (III) comprises the structure of formula (IIIa),

[0288]

[0289] In some embodiments, the conjugate of formula (III) comprises the structure of formula (IIIb),

[0290]

[0291] In some embodiments, the conjugate of formula (III) comprises the structure of formula (IIIc),

[0292]

[0293] Wherein Y is O or S.

[0294] In some embodiments, the conjugate of formula (III) comprises the structure of formula (IIId),

[0295]

[0296] Wherein Y is O or S.

[0297] In some embodiments, the conjugate of formula (III) comprises the structure of formula (IIIe),

[0298]

[0299] Wherein Y is O or S.

[0300] In some embodiments, the conjugates described herein comprise a structure of Formula (IV),

[0301]

[0302] wherein each X is independently H or a protecting group, R AIs -OX or -NHAc, Y is O or S, and W represents an active agent or a coupling sequence. One or more linkers of formula (IV) can each independently comprise a linker as described in the present invention. In some embodiments, each of the protecting groups of formula (IV) is independently selected from: 4-acetoxy-2,2-dimethylbutyryl (ADMB), 3-(2-hydroxyphenyl)-3,3-dimethylpropionate (DMBPP), 3-(2-hydroxy-4,6-dimethylphenyl)-3,3-dimethylpropionate group (TMBPP), methylsulfonylethoxycarbonyl (Msc), 2,2-dimethylcyclopropane (DMTM) phosphate, 2-pyridylmethyl, In some embodiments, X is H. In some embodiments, each X is independently selected from H and Bz. In some embodiments, R A In some embodiments, R A In some embodiments, R A -NHAc. In some embodiments of formula (IV), W is an active agent. In some embodiments, W is a nucleic acid. In some embodiments, W is a gRNA. In some embodiments, W is a single-stranded, double-stranded, partially double-stranded, or hairpin stem-loop nucleic acid. In some embodiments of formula (IV), W is a coupling sequence. In some embodiments, W comprises an RNA or DNA sequence. In some embodiments, W comprises (A)n, (T)n, (U)n, (a)n, or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 50 (SEQ ID NO: 118). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 20 (SEQ ID NO: 119) or 3 to 15 (SEQ ID NO: 120).

[0303] In some embodiments, the conjugate of formula (IV) comprises the structure of 1-1, 1-2, 1-5, 1-6, 1-9, 1-10, 1-11, or 1-12 as shown in Table 1.

[0304] In some embodiments of Formula (A)-(I), (Ia)-(II), (IIa)-(IIc), (III)-(IIId), (IIIe)-(IIId), (IIIe)-(IIId), or (IV), wherein the “one or more linkers” mentioned in the box of the foregoing formulae comprise a structure selected from the group consisting of: wherein each linker is independent. In some embodiments of Formula (I)-(la)-(la), (Ib)-(lb), (II)-(IIa)-(IIb), (III)-(IIIc), (IIId)-(IIIe)-(IIId), or (IV), wherein each of the linkers independently has -(L 1 ) k1 -(L 2 ) k2 -(L 3 ) k3 -(L 4 ) k4 - structure, wherein each of k1, k2, k3 and k4 is independently 0, 1 or 2, and L 1 , L 2 , L 3 and L 4 Each of which is independently selected from oxo, ester, amide, amino, C1-C3 alkylene and -(CH2-CH2-O) 1-3 -. In some embodiments, the sum of k1, k2, k3, and k4 is an integer greater than or equal to 1. In some embodiments, the sum of k1, k2, k3, and k4 is an integer greater than or equal to 2. As will be appreciated by one of ordinary skill in the art, "N" refers to nitrogen and Refers to the attachment point.

[0305] In some embodiments of Formula (A)-(II), (Ia)-(IIb), (IIb)-(IIc), (III), (IIIa)-(IIIb), (IIIc)-(IIId), (IIIe)-(IIIe), or (IV), wherein each of the linkers independently has -(L 1 ) k1 -(L 2 ) k2 -(L 3 ) k3 -(L 4 ) k4 - structure, in which each of k1, k2, k3 and k4 is independently 0, 1 or 2, and L 1 , L 2 , L 3 and L4 Independently selected from -O-, -S-, S(=O) 1-2 -, -C(=O)-, -C(=S)-, -NR L -, -OC(=O)-, -C(=O)O-, -OC(=O)O-, -C(=O)NR L -、-OC(=O)NR L -、-NR L C(=O)-、-NR L C(=O)NR L -、-P(=O)R L -、-NR L S(=O)(=NR L )-、-NR L S(=O)2-、-S(=O)2NR L -, -N=N-, -(CH2-CH2-O) 1-6 -, straight chain or branched chain C 1-6 Alkylene, linear or branched C 2-6 Alkenylene, straight chain or branched C 2-6 Alkyne, C3-C8 cycloalkylene, C2-C7 heterocycloalkylene, C6-C 10 Arylene and C5-C9 heteroarylene, wherein alkylene, alkenylene, alkynylene, cycloalkylene, cycloalkylene, arylene or heteroarylene is substituted or unsubstituted, and wherein each R L R is independently H, D, cyano, halogen, substituted or unsubstituted C1-C6 alkyl, -CD3, -OCH3, -OCD3, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C1-C6 heteroalkyl, substituted or unsubstituted C3-C8 cycloalkyl, substituted or unsubstituted C2-C7 heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. In some embodiments, each R L are independently H, substituted or unsubstituted C1-C6 alkyl, -OCH3, substituted or unsubstituted C1-C6 haloalkyl, substituted or unsubstituted C1-C6 heteroalkyl, substituted or unsubstituted C3-C8 cycloalkyl, or substituted or unsubstituted C2-C7 heterocycloalkyl.

[0306] In some embodiments of Formula (A)-(I), (Ia)-(Ib), (II), (IIa)-(IIb), (IIc)-(III), (IIId)-(IIIe), (IIId)-(IIIe), or (IV), each of the linkers independently comprises a structure selected from:

[0307] wherein each of p, q, m, and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, each of p, q, m, and n is independently 0, 1, 2, 3, 4, or 5.

[0308] In some embodiments of Formula (A)-(I), (Ia)-(Ib), (II), (IIa)-(IIb), (IIc)-(III), (IIId)-(IIIe), (IIId)-(IIIe), or (IV), wherein the “one or more linkers” mentioned in the box of the aforementioned formulae comprise the following structure:

[0309]

[0310]

[0311] wherein each of p, q, m, and n is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 13, 15, 16, 17, 18, 19, or 20. In some embodiments, each of p, q, m, and n is independently 0, 1, 2, 3, 4, or 5.

[0312] In some embodiments of Formula (A)-(I), (Ia)-(Ib), (II), (IIa)-(IIb), (IIc)-(III), (IIIa)-(IIIb), (IIIc)-(IIId), (IIIe)-(IIIe), or (IV), W comprises one or more modified DNA or RNA bases. The nucleobase may comprise any chemical modification as described herein. In some embodiments, the nucleobase comprises a 2'-OH or 2'-OMe modification. For example, W may comprise one or more 2'-OMe-modified adenine, cytosine, guanine, and uracil, referred to as (a), (c), (g), or (u). In some embodiments, the modified RNA (e.g., gRNA or mRNA) comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50, or more modified nucleobases. In some embodiments, the modified RNA comprises one or more modified core bases near the 5' end, near the 3' end or in the middle of the sequence. The modified core bases in the modified RNA can be continuous or discontinuous. In some embodiments, the modified RNA comprises one or more 2'-OMe modifications dispersed along the length of the sequence. In some embodiments, the modified RNA comprises one or more 2'OH modifications dispersed along the length of the sequence. In some embodiments, the modified RNA comprises alternating 2'-OH and 2'OMe modifications. In some embodiments, W comprises (A)n, (T)n, (U)n, (a)n or (u)n, wherein n is an integer not less than 3, wherein a is 2'-O-methyladenosine (2'-OMe A), and wherein u is 2'-O-methyluridine (2'-OMe-U). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 50 (SEQ ID NO: 118). In some embodiments, W comprises (u)n, wherein n is an integer from 3 to 20 (SEQ ID NO: 119) or 3 to 15 (SEQ ID NO: 120). In some embodiments, W comprises one or more nucleotide sequences complementary to the coupling sequence. In some embodiments, W comprises one or more guanines or cytidines. In some embodiments, W comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 50 or more guanines or cytidines. In some embodiments, one or more guanines or cytidines are complementary to one or more cytidines or guanines in the coupling sequence. In some embodiments, the guanine or cytidine is at the end of W or the coupling sequence. Without wishing to be bound by any theory, it is expected that guanine-cytidine pairing forms a "GC lock" or "CG lock", which will increase binding affinity.The guanines and / or cytidines in the W or coupling sequence may or may not be consecutive and may contain any of the chemical modifications described herein, such as 2'-OMe or 2'-OH modifications.

[0313] Receptor-targeted conjugates

[0314] The key to achieving nucleic acid-based treatment is to safely and effectively deliver payload to specific cell types and tissues. Lipid nanoparticles (LNPs) represent currently the most advanced non-viral drug delivery technology platform. LNP physically can pass through blood vessels and arrive at hepatocytes [Am.J.Pathol.2010,176,14-21]. It has also been revealed that apolipoprotein E (ApoE) protein is attached to LNP after PEG-lipids diffuse from the LNP surface, and it has a near-neutral charge in blood flow, and acts as an endogenous ligand for hepatocytes, which express low-density lipoprotein receptors (LDLr) [Mol.Ther., 2010,18,1357-1364]. Therefore, it is envisioned that two key factors controlling the effective liver delivery of LNP are: 1) the PEG-lipids on the LNP surface effectively fall off in serum, and 2) the ApoE attached to LNP. The above-mentioned endogenous ApoE-mediated LDLr-dependent LNP delivery route is not an effective way to achieve LNP-based liver gene delivery in the LDLr-deficient patient population.

[0315] In one aspect, LNPs are described herein that include receptor-targeted conjugates. In certain aspects, receptor-targeted conjugates are described herein. LNPs with targeted conjugates are constructed to have receptor-targeting moieties on the surface or periphery of the particle. In one aspect, low mol% receptor-targeted conjugates are used while constructing targeted LNPs to achieve a low surface density of the targeting moiety on the surface / periphery of the particle. In another aspect, high mol% receptor-targeted conjugates are used while constructing targeted LNPs to achieve a high surface density of the targeting moiety on the surface / periphery of the particle. In another aspect, a desired mol% receptor-targeted conjugate is used to achieve a surface density range of the targeting moiety on the surface / periphery of the particle. In some embodiments, the receptor-targeted conjugate comprises a targeting moiety (or ligand), a linker, and a lipophilic moiety connected to the targeting moiety. In some embodiments, the receptor-targeting moiety (or ligand) targets a lectin receptor. In some embodiments, the lectin receptor is an asialoglycoprotein receptor (ASGPR). In some embodiments, the receptor-targeting moiety is GalNAc or a GalNAc derivative targeting ASGPR. In one aspect, the receptor-targeted conjugate comprises one GalNAc moiety or a derivative thereof. In another aspect, the receptor-targeted conjugate comprises two GalNAc moieties or a derivative thereof. In another aspect, the receptor-targeted conjugate comprises three GalNAc moieties or a derivative thereof. In another aspect, the receptor-targeted conjugate is lipophilic. In some embodiments, the receptor-targeted conjugate comprises one or more GalNAc moieties and one or more lipid moieties, i.e., GalNAc-lipid. In some embodiments, the receptor-targeted conjugate is GalNAc-lipid.

[0316] The present invention provides tissue-specific and effective LNPs for delivery to hepatocytes in a manner independent of LDLr. The trivalent GalNAc moieties developed in the present invention are attached to hydrophobic glycerol-based dialkyl lipid chains, sterols (e.g., cholesterol), and hydrophobic α-tocopherol through different PEG-spacers. These GalNAc-conjugated lipids are then formulated with various excipients to produce LNPs carrying custom-designed GalNAc ligands with low to high surface densities to target the asialoglycoprotein receptor (ASGPR), which is highly expressed on the surface of hepatocytes.

[0317] The ligands on the surface of the engineered LNP promote tissue-specific uptake mediated by ASGPR into hepatocytes. Different GalNAc-LNPs are constructed to avoid ApoE binding and enable GalNAc-ASGPR to interact to promote clathrin-mediated uptake into hepatocytes. By using the PEG-lipids described herein in combination with GalNAc-lipids with different PEG-tethers to regulate PEG shedding kinetics and regulate the net surface charge density of the GalNAc-LNP particles, a GalNAc-LNP lacking endogenous ApoE binding characteristics is produced, thereby specifically delivering particles carrying RNA payloads to hepatocytes in LDLR-deficient preclinical animal models at a safe and effective dose. Dose optimization in preclinical animal models has further promoted the introduction of GalNAc-LNP (or LNP) into clinical development to treat LDLR-deficient patient populations, thereby triggering genome editing at a therapeutically feasible, safe and effective dose.

[0318] Thus, in one aspect, disclosed herein is a receptor-targeted conjugate comprising a compound of formula (V):

[0319]

[0320] in,

[0321] Multiple A groups collectively comprise a receptor targeting ligand;

[0322] L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 Each of which is independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O- or -O[(P=O)S - ]O-or bond;

[0323] L 11 is substituted or unsubstituted -(CH2CH2O) n -, substituted or unsubstituted -(OCH2CH2) n -, substituted or unsubstituted -(CH2) n - or key;

[0324] Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0325] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0326] m is an integer selected from 1 to 10; and

[0327] n is an integer selected from 1 to 200.

[0328] In some embodiments, the receptor-targeted conjugate comprises a compound of Formula (V):

[0329]

[0330] in,

[0331] Multiple A groups collectively comprise a receptor targeting ligand;

[0332] L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 Each of which is independently substituted or unsubstituted C1-C 12Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -OR-N(OR 1 )-;

[0333] L 11 is substituted or unsubstituted -(CH2CH2O) n -, or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0334] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0335] m is an integer selected from 1 to 10; and

[0336] n is an integer selected from 1 to 200.

[0337] In some embodiments, L 11 -(CH2CH2O) n -or-(OCH2CH2) n -.

[0338] In some embodiments of the compound of Formula (V), A binds to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, A comprises one or more N-acetylgalactosamine (GalNAc) or a GalNAc derivative.

[0339] In some embodiments of the compound of Formula (V), A is N-acetylgalactosamine (GalNAc) or a derivative thereof. In some embodiments, A is GalNAc. In some embodiments, A is or comprises galactose.

[0340] In some embodiments of the compound of Formula (V), L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 In some embodiments of the compound of Formula (V), L 1 , L 4 and L 7 are each independently substituted or unsubstituted C2-C6 alkylene. In some embodiments of the compound of formula (V), L 1 , L 4 and L 7 Each is a C4 alkylene group.

[0341] In some embodiments of the compound of Formula (V), L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -or-C(=O)NR 1 C(=O)-. In some embodiments of the compound of Formula (V), L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -or-NR 1 C(=O)-. In some embodiments of the compound of Formula (V), L 2 , L 5 and L 8 Each is -C(=O)NH-.

[0342] In some embodiments of the compound of Formula (V), L 3 , L 6 and L 9 are each independently substituted or unsubstituted C1-C 12 In some embodiments of the compound of Formula (V), each L 3is a substituted or unsubstituted C2-C6 alkylene. In some embodiments of the compound of formula (V), L 3 In some embodiments of the compound of formula (V), L 6 and L 9 are each independently substituted or unsubstituted C2-C 10 In some embodiments of the compound of Formula (V), L 6 and L 9 are each independently substituted or unsubstituted C2-C6 alkylene. In some embodiments of the compound of formula (V), L 6 and L 9 Each is a C3 alkylene group.

[0343] In some embodiments of the compound of Formula (V), R 1 is H. In some embodiments, R 1 is a substituted or unsubstituted C1-C6 alkyl group. 1 It is a methyl group.

[0344] In another aspect, disclosed herein is a receptor-targeted conjugate comprising a compound of formula (VI):

[0345]

[0346] in,

[0347] Multiple A groups collectively comprise a receptor targeting ligand;

[0348] L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 Each of which is independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1)-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O-or bond;

[0349] L 11 is substituted or unsubstituted -(CH2CH2O) n -, substituted or unsubstituted -(OCH2CH2) n -, substituted or unsubstituted -(CH2) n - or key;

[0350] Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0351] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0352] m is an integer selected from 1 to 10; and

[0353] n is an integer selected from 1 to 200.

[0354] In some embodiments, disclosed herein is a receptor-targeted conjugate comprising a compound of formula (VI):

[0355]

[0356] in,

[0357] Multiple A groups collectively comprise a receptor targeting ligand;

[0358] L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L10 and L 12 Each of which is independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -OR-N(OR 1 )-;

[0359] L 11 is substituted or unsubstituted -(CH2CH2O) n -, or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl;

[0360] R is a lipid, nucleic acid, amino acid, protein or lipid nanoparticle;

[0361] m is an integer selected from 1 to 10; and

[0362] n is an integer selected from 1 to 200.

[0363] In some embodiments, L 11 -(CH2CH2O) n -or-(OCH2CH2) n -.

[0364] In some embodiments of the compound of formula (VI), A binds to a lectin. In some embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In some embodiments, A comprises one or more N-acetylgalactosamine (GalNAc) or a GalNAc derivative.

[0365] In some embodiments of the compound of Formula (VI), A is N-acetylgalactosamine (GalNAc) or a derivative thereof. In some embodiments, A is GalNAc.

[0366] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 Alkylene, or substituted or unsubstituted C1-C 12 Heteroalkylene.

[0367] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 Heteroalkylene.

[0368] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 Each independently is a substituted or unsubstituted C1-C 12 Heteroalkylene.

[0369] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 Each independently is -(CH2CH2O) p1 -(CH2) q1 -; wherein p1 is 1-8; and q1 is 1-6.

[0370] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 Each is -(CH2CH2O)3-(CH2)2-.

[0371] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 Alkylene.

[0372] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 Each is independently a substituted or unsubstituted C2-C6 alkylene group.

[0373] In some embodiments of the compound of Formula (VI), L 1 , L 4 and L 7 Each is a C4 alkylene group.

[0374] In some embodiments of the compound of Formula (VI), L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -or-C(=O)NR 1 C(=O).

[0375] In some embodiments of the compound of Formula (VI), L 2 , L 5 and L 8 Each is independently -C(=O)NR 1 -or-NR 1 C(=O)-.

[0376] In some embodiments of the compound of Formula (VI), L 2 , L 5 and L 8 Each is -NHC(=O)-.

[0377] In some embodiments of the compound of Formula (VI), L 2 , L 5 and L 8 Each is -C(=O)NH-.

[0378] In some embodiments of the compound of Formula (VI), L 3 , L 6 and L 9 are each independently substituted or unsubstituted C1-C 12 Heteroalkylene.

[0379] In some embodiments of the compound of Formula (VI), L 3 , L6 and L 9 Each independently is a substituted or unsubstituted C1-C 12 Heteroalkylene.

[0380] In some embodiments of the compound of Formula (VI), L 3 , L 6 and L 9 Each independently is -(CH2CH2O) p2 -(CH2CH2CH2O) q2 -; wherein p2 is 1-8; and q2 is 1-6. In some embodiments, p2 is 1. In some embodiments, p2 is 2. In some embodiments, p2 is 3. In some embodiments, p2 is 4. In some embodiments, p2 is 5. In some embodiments, p2 is 6. In some embodiments, p2 is 7. In some embodiments, p2 is 8. In some embodiments, q2 is 1. In some embodiments, q2 is 2. In some embodiments, q2 is 3. In some embodiments, q2 is 4. In some embodiments, q2 is 5. In some embodiments, q2 is 6.

[0381] In some embodiments of the compound of Formula (VI), L 3 , L 6 and L 9 Each is -(CH2CH2O)-(CH2CH2CH2O)-.

[0382] In some embodiments of the compound of Formula (VI), L 3 , L 6 and L 9 Each independently is -(CH2CH2CH2O) q3 -; wherein q3 is 1-8. In some embodiments, q3 is 1. In some embodiments, q3 is 2. In some embodiments, q3 is 3. In some embodiments, q3 is 4. In some embodiments, q3 is 5. In some embodiments, q3 is 6. In some embodiments, q3 is 7. In some embodiments, q3 is 8.

[0383] In some embodiments of the compound of Formula (VI), L 3 , L 6 and L 9 Each is -(CH2CH2CH2O)2-.

[0384] In some embodiments, the compound of Formula (VI) has the structure of Formula (VIa):

[0385]

[0386]

[0387] in

[0388] Each q4 is 1-10.

[0389] In some embodiments of the compound of Formula (VIb), q4 is 1-8. In some embodiments, q4 is 1-4. In some embodiments, q4 is 1-3. In some embodiments, q4 is 1. In some embodiments, q4 is 2. In some embodiments, q4 is 3. In some embodiments, q4 is 4. In some embodiments, q4 is 5.

[0390] In some embodiments of the compound of Formula (V) or Formula (VI), L 10 is substituted or unsubstituted C1-C 12 In some embodiments, L 10 is a substituted or unsubstituted C1-C4 alkylene group. 10 It is a C2 alkylene group.

[0391] In some embodiments, the compound of Formula (VI) has the structure of Formula (VIb):

[0392]

[0393] in,

[0394] r is 1-4.

[0395] In some embodiments of compounds of Formula (VIb), r is 1, 2, or 3. In some embodiments, r is 1 or 2. In some embodiments, r is 2 or 3. In some embodiments, r is 1. In some embodiments, r is 2. In some embodiments, r is 3. In some embodiments, r is 4.

[0396] In some embodiments of the compound of Formula (V), Formula (VI), Formula (Via), or Formula (VIb), L 11 -(OCH2CH2) n-. In some embodiments, n is 1-100. In some embodiments, n is 2-50. In some embodiments, n is 10-50. In some embodiments, n is 20-50. In some embodiments, n is 30-50. In some embodiments, n is 40-50. In some embodiments, n is 2, 12, 37, or 45. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10. In some embodiments, n is 11. In some embodiments, n is 12. In some embodiments, n is 13. In some embodiments, n is 14. In some embodiments, n is 15. In some embodiments, n is 16. In some embodiments, n is 17. In some embodiments, n is 18. In some embodiments, n is 19. In some embodiments, n is 20. In some embodiments, n is 21. In some embodiments, n is 22. In some embodiments, n is 23. In some embodiments, n is 24. In some embodiments, n is 25. In some embodiments, n is 26. In some embodiments, n is 27. In some embodiments, n is 28. In some embodiments, n is 29. In some embodiments, n is 30. In some embodiments, n is 31. In some embodiments, n is 32. In some embodiments, n is 33. In some embodiments, n is 34. In some embodiments, n is 35. In some embodiments, n is 36. In some embodiments, n is 37. In some embodiments, n is 38. In some embodiments, n is 39. In some embodiments, n is 40. In some embodiments, n is 41. In some embodiments, n is 42. In some embodiments, n is 43. In some embodiments, n is 44. In some embodiments, n is 45. In some embodiments, n is 46. In some embodiments, n is 47. In some embodiments, n is 48. In some embodiments, n is 49. In some embodiments, n is 50. In some embodiments, n is at least 1. In some embodiments, n is at least 2. In some embodiments, n is at least 3. In some embodiments, n is at least 4. In some embodiments, n is at least 5. In some embodiments, n is at least 6. In some embodiments, n is at least 7. In some embodiments, n is at least 8. In some embodiments, n is at least 9. In some embodiments, n is at least 10. In some embodiments, n is at least 11. In some embodiments, n is at least 12.In some embodiments, n is at least 13. In some embodiments, n is at least 14. In some embodiments, n is at least 15. In some embodiments, n is at least 16. In some embodiments, n is at least 17. In some embodiments, n is at least 18. In some embodiments, n is at least 19. In some embodiments, n is at least 20. In some embodiments, n is at least 21. In some embodiments, n is at least 22. In some embodiments, n is at least 23. In some embodiments, n is at least 24. In some embodiments, n is at least 25. In some embodiments, n is at least 26. In some embodiments, n is at least 27. In some embodiments, n is at least 28. In some embodiments, n is at least 29. In some embodiments, n is at least 30. In some embodiments, n is at least 31. In some embodiments, n is at least 32. In some embodiments, n is at least 33. In some embodiments, n is at least 34. In some embodiments, n is at least 35. In some embodiments, n is at least 36. In some embodiments, n is at least 37. In some embodiments, n is at least 38. In some embodiments, n is at least 39. In some embodiments, n is at least 40. In some embodiments, n is at least 41. In some embodiments, n is at least 42. In some embodiments, n is at least 43. In some embodiments, n is at least 44. In some embodiments, n is at least 45. In some embodiments, n is at least 46. In some embodiments, n is at least 47. In some embodiments, n is at least 48. In some embodiments, n is at least 49. In some embodiments, n is at most 2. In some embodiments, n is at most 3. In some embodiments, n is at most 4. In some embodiments, n is at most 5. In some embodiments, n is at most 6. In some embodiments, n is at most 7. In some embodiments, n is at most 8. In some embodiments, n is at most 9. In some embodiments, n is at most 10. In some embodiments, n is at most 11. In some embodiments, n is at most 12. In some embodiments, n is at most 13. In some embodiments, n is at most 14. In some embodiments, n is at most 15. In some embodiments, n is at most 16. In some embodiments, n is at most 17. In some embodiments, n is at most 18. In some embodiments, n is at most 19. In some embodiments, n is at most 20. In some embodiments, n is at most 21. In some embodiments, n is at most 22. In some embodiments, n is at most 23. In some embodiments, n is at most 24. In some embodiments, n is at most 25. In some embodiments, n is at most 26. In some embodiments, n is at most 27.In some embodiments, n is at most 28. In some embodiments, n is at most 29. In some embodiments, n is at most 30. In some embodiments, n is at most 31. In some embodiments, n is at most 32. In some embodiments, n is at most 33. In some embodiments, n is at most 34. In some embodiments, n is at most 35. In some embodiments, n is at most 36. In some embodiments, n is at most 37. In some embodiments, n is at most 38. In some embodiments, n is at most 39. In some embodiments, n is at most 40. In some embodiments, n is at most 41. In some embodiments, n is at most 42. In some embodiments, n is at most 43. In some embodiments, n is at most 44. In some embodiments, n is at most 45. In some embodiments, n is at most 46. In some embodiments, n is at most 47. In some embodiments, n is at most 48. In some embodiments, n is at most 49. In some embodiments, n is up to 50.

[0397] In some embodiments of the compound of Formula (V), Formula (VI), Formula (Via), or Formula (VIb), L 12 is -O-, -C(=O)O-, -C(=O)NR 1 -、-NR 1 C(=O)- or -NR 1 C(=O)O-. In some embodiments, L 12 -C(=O)O- or -NR 1 C(=O)O-. In some embodiments, L 12 is -C(=O)O-. In some embodiments, L 12 is -NHC(=O)O-. In some embodiments, L 12 It is -NHC(=O)-.

[0398] In some embodiments of the compound of Formula (VI), Formula (VIa), or Formula (VIb), R 1 is H. In some embodiments, R 1 is a substituted or unsubstituted C1-C6 alkyl group. 1 It is a methyl group.

[0399] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 1 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 1 is substituted or unsubstituted C1-C 12 In some embodiments, L 1 is substituted or unsubstituted C1-C 12 In some embodiments, L 1 is substituted or unsubstituted C2-C 12 In some embodiments, L 1 is substituted or unsubstituted C2-C 12 In some embodiments, L 1 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 1 In some embodiments, L 1 In some embodiments, L 1 is -S(=O)-. In some embodiments, L 1 is -S(=O)2-. In some embodiments, L 1 -S(=O)(=NR 1 )-. In some embodiments, L 1 is -C(=O)-. In some embodiments, L 1 -C(=N-OR1 )-. In some embodiments, L 1 is -C(=O)O-. In some embodiments, L 1 is OC(=O)-. In some embodiments, L 1 is -C(=O)C(=O)-. In some embodiments, L 1 -C(=O)NR 1 -. In some embodiments, L 1 -NR 1 C(=O)-. In some embodiments, L 1 -OC(=O)NR 1 -. In some embodiments, L 1 -NR 1 C(=O)O-. In some embodiments, L 1 -NR 1 C(=O)NR 1 -. In some embodiments, L 1 -C(=O)NR 1 C(=O)-. In some embodiments, L 1 -S(=O)2NR 1 -. In some embodiments, L 1 -NR 1 S(=O)2-. In some embodiments, L 1 -NR 1 -. In some embodiments, L 1 -N(OR 1 )-. In some embodiments, L 1 -O[(P=O)O - ]O-. In some embodiments, L 1 -O[(P=O)S - ]O-. In some embodiments, L 1 is the key.

[0400] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 2 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 2 is substituted or unsubstituted C1-C 12 In some embodiments, L 2 is substituted or unsubstituted C1-C 12 In some embodiments, L 2 is substituted or unsubstituted C2-C 12 In some embodiments, L 2 is substituted or unsubstituted C2-C 12 In some embodiments, L 2 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 2 In some embodiments, L 2 In some embodiments, L 2 is -S(=O)-. In some embodiments, L 2 is -S(=O)2-. In some embodiments, L 2 -S(=O)(=NR 1 )-. In some embodiments, L 2 is -C(=O)-. In some embodiments, L 2 -C(=N-OR 1 )-. In some embodiments, L 2 is -C(=O)O-. In some embodiments, L 2 is OC(=O)-. In some embodiments, L 2is -C(=O)C(=O)-. In some embodiments, L 2 -C(=O)NR 1 -. In some embodiments, L 2 -NR 1 C(=O)-. In some embodiments, L 2 is -NRHC(=O)-. In some embodiments, L 2 -OC(=O)NR 1 -. In some embodiments, L 2 -NR 1 C(=O)O-. In some embodiments, L 2 -NR 1 C(=O)NR 1 -. In some embodiments, L 2 -C(=O)NR 1 C(=O)-. In some embodiments, L 2 -S(=O)2NR 1 -. In some embodiments, L 2 -NR 1 S(=O)2-. In some embodiments, L 2 -NR 1 -. In some embodiments, L 2 -N(OR 1 )-. In some embodiments, L 2 -O[(P=O)O - ]O-. In some embodiments, L 2 -O[(P=O)S - ]O-. In some embodiments, L 2 is the key.

[0401] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 3 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1)-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 3 is substituted or unsubstituted C1-C 12 In some embodiments, L 3 For unsubstituted C 3-4 In some embodiments, L 3 For unsubstituted C 1-4 In some embodiments, L 3 is substituted or unsubstituted C1-C 12 In some embodiments, L 3 is substituted or unsubstituted C2-C 12 In some embodiments, L 3 is substituted or unsubstituted C2-C 12 In some embodiments, L 3 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 3 In some embodiments, L 3 In some embodiments, L 3 is -S(=O)-. In some embodiments, L 3 is -S(=O)2-. In some embodiments, L 3 -S(=O)(=NR 1 )-. In some embodiments, L 3 is -C(=O)-. In some embodiments, L 3 -C(=N-OR 1 )-. In some embodiments, L 3is -C(=O)O-. In some embodiments, L 3 is OC(=O)-. In some embodiments, L 3 is -C(=O)C(=O)-. In some embodiments, L 3 -C(=O)NR 1 -. In some embodiments, L 3 -NR 1 C(=O)-. In some embodiments, L 3 -OC(=O)NR 1 -. In some embodiments, L 3 -NR 1 C(=O)O-. In some embodiments, L 3 -NR 1 C(=O)NR 1 -. In some embodiments, L 3 -C(=O)NR 1 C(=O)-. In some embodiments, L 3 -S(=O)2NR 1 -. In some embodiments, L 3 -NR 1 S(=O)2-. In some embodiments, L 3 -NR 1 -. In some embodiments, L 3 -N(OR 1 )-. In some embodiments, L 3 -O[(P=O)O - ]O-. In some embodiments, L 3 -O[(P=O)S - ]O-. In some embodiments, L 3 is the key.

[0402] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 4 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 4 is substituted or unsubstituted C1-C 12 In some embodiments, L 4 is an unsubstituted C4 alkylene. 4 is substituted or unsubstituted C1-C 12 In some embodiments, L 4 is substituted or unsubstituted C2-C 12 In some embodiments, L 4 is substituted or unsubstituted C2-C 12 In some embodiments, L 4 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 4 In some embodiments, L 4 In some embodiments, L 4 is -S(=O)-. In some embodiments, L 4 is -S(=O)2-. In some embodiments, L 4 -S(=O)(=NR 1 )-. In some embodiments, L 4 is -C(=O)-. In some embodiments, L 4 -C(=N-OR 1 )-. In some embodiments, L 4 is -C(=O)O-. In some embodiments, L 4 is OC(=O)-. In some embodiments, L 4is -C(=O)C(=O)-. In some embodiments, L 4 -C(=O)NR 1 -. In some embodiments, L 4 -NR 1 C(=O)-. In some embodiments, L 4 -OC(=O)NR 1 -. In some embodiments, L 4 -NR 1 C(=O)O-. In some embodiments, L 4 -NR 1 C(=O)NR 1 -. In some embodiments, L 4 -C(=O)NR 1 C(=O)-. In some embodiments, L 4 -S(=O)2NR 1 -. In some embodiments, L 4 -NR 1 S(=O)2-. In some embodiments, L 4 -NR 1 -. In some embodiments, L 4 -N(OR 1 )-. In some embodiments, L 4 -O[(P=O)O - ]O-. In some embodiments, L 4 -O[(P=O)S - ]O-. In some embodiments, L 4 is the key.

[0403] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 5 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1-、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 5 is substituted or unsubstituted C1-C 12 In some embodiments, L 5 is substituted or unsubstituted C1-C 12 In some embodiments, L 5 is substituted or unsubstituted C2-C 12 In some embodiments, L 5 is substituted or unsubstituted C2-C 12 In some embodiments, L 5 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 5 In some embodiments, L 5 In some embodiments, L 5 is -S(=O)-. In some embodiments, L 5 is -S(=O)2-. In some embodiments, L 5 -S(=O)(=NR 1 )-. In some embodiments, L 5 is -C(=O)-. In some embodiments, L 5 -C(=N-OR 1 )-. In some embodiments, L 5 is -C(=O)O-. In some embodiments, L 5 is OC(=O)-. In some embodiments, L 5 is -C(=O)C(=O)-. In some embodiments, L 5 -C(=O)NR 1 -. In some embodiments, L 5 -NR 1C(=O)-. In some embodiments, L 2 is -NRHC(=O)-. In some embodiments, L 5 -OC(=O)NR 1 -. In some embodiments, L 5 -NR 1 C(=O)O-. In some embodiments, L 5 -NR 1 C(=O)NR 1 -. In some embodiments, L 5 -C(=O)NR 1 C(=O)-. In some embodiments, L 5 -S(=O)2NR 1 -. In some embodiments, L 5 -NR 1 S(=O)2-. In some embodiments, L 5 -NR 1 -. In some embodiments, L 5 -N(OR 1 )-. In some embodiments, L 5 -O[(P=O)O - ]O-. In some embodiments, L 5 -O[(P=O)S - ]O-. In some embodiments, L 5 is the key.

[0404] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 6 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 6 is substituted or unsubstituted C1-C 12 In some embodiments, L 6 For unsubstituted C 3-4 In some embodiments, L 6 For unsubstituted C 1-4 In some embodiments, L 6 is substituted or unsubstituted C1-C 12 In some embodiments, L 6 is substituted or unsubstituted C2-C 12 In some embodiments, L 6 is substituted or unsubstituted C2-C 12 In some embodiments, L 6 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 6 In some embodiments, L 6 In some embodiments, L 6 is -S(=O)-. In some embodiments, L 6 is -S(=O)2-. In some embodiments, L 6 -S(=O)(=NR 1 )-. In some embodiments, L 6 is -C(=O)-. In some embodiments, L 6 -C(=N-OR 1 )-. In some embodiments, L 6 is -C(=O)O-. In some embodiments, L 6 is OC(=O)-. In some embodiments, L 6 is -C(=O)C(=O)-. In some embodiments, L 6 -C(=O)NR 1 -. In some embodiments, L6 -NR 1 C(=O)-. In some embodiments, L 6 -OC(=O)NR 1 -. In some embodiments, L 6 -NR 1 C(=O)O-. In some embodiments, L 6 -NR 1 C(=O)NR 1 -. In some embodiments, L 6 -C(=O)NR 1 C(=O)-. In some embodiments, L 6 -S(=O)2NR 1 -. In some embodiments, L 6 -NR 1 S(=O)2-. In some embodiments, L 6 -NR 1 -. In some embodiments, L 6 -N(OR 1 )-. In some embodiments, L 6 -O[(P=O)O - ]O-. In some embodiments, L 6 -O[(P=O)S - ]O-. In some embodiments, L 6 is the key.

[0405] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 7 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 7 is substituted or unsubstituted C1-C 12 In some embodiments, L 7 is an unsubstituted C4 alkylene. 7 is substituted or unsubstituted C1-C 12 In some embodiments, L 7 is substituted or unsubstituted C2-C 12 In some embodiments, L 7 is substituted or unsubstituted C2-C 12 In some embodiments, L 7 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 7 In some embodiments, L 7 In some embodiments, L 7 is -S(=O)-. In some embodiments, L 7 is -S(=O)2-. In some embodiments, L 7 -S(=O)(=NR 1 )-. In some embodiments, L 7 is -C(=O)-. In some embodiments, L 7 -C(=N-OR 1 )-. In some embodiments, L 7 is -C(=O)O-. In some embodiments, L 7 is OC(=O)-. In some embodiments, L 7 is -C(=O)C(=O)-. In some embodiments, L 7 -C(=O)NR 1 -. In some embodiments, L 7 -NR 1 C(=O)-. In some embodiments, L 7 -OC(=O)NR1 -. In some embodiments, L 7 -NR 1 C(=O)O-. In some embodiments, L 7 -NR 1 C(=O)NR 1 -. In some embodiments, L 7 -C(=O)NR 1 C(=O)-. In some embodiments, L 7 -S(=O)2NR 1 -. In some embodiments, L 7 -NR 1 S(=O)2-. In some embodiments, L 7 -NR 1 -. In some embodiments, L 7 -N(OR 1 )-. In some embodiments, L 7 -O[(P=O)O - ]O-. In some embodiments, L 7 -O[(P=O)S - ]O-. In some embodiments, L 7 is the key.

[0406] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 8 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 8 is substituted or unsubstituted C1-C 12 In some embodiments, L 8 is substituted or unsubstituted C1-C 12 In some embodiments, L 8 is substituted or unsubstituted C2-C 12 In some embodiments, L 8 is substituted or unsubstituted C2-C 12 In some embodiments, L 8 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 8 In some embodiments, L 8 In some embodiments, L 8 is -S(=O)-. In some embodiments, L 8 is -S(=O)2-. In some embodiments, L 8 -S(=O)(=NR 1 )-. In some embodiments, L 8 is -C(=O)-. In some embodiments, L 8 -C(=N-OR 1 )-. In some embodiments, L 8 is -C(=O)O-. In some embodiments, L 8 is OC(=O)-. In some embodiments, L 8 is -C(=O)C(=O)-. In some embodiments, L 8 -C(=O)NR 1 -. In some embodiments, L 8 -NR 1 C(=O)-. In some embodiments, L 8 -OC(=O)NR 1 -. In some embodiments, L 8 -NR 1 C(=O)O-. In some embodiments, L 2is -NRHC(=O)-. In some embodiments, L 8 -NR 1 C(=O)NR 1 -. In some embodiments, L 8 -C(=O)NR 1 C(=O)-. In some embodiments, L 8 -S(=O)2NR 1 -. In some embodiments, L 8 -NR 1 S(=O)2-. In some embodiments, L 8 -NR 1 -. In some embodiments, L 8 -N(OR 1 )-. In some embodiments, L 8 -O[(P=O)O - ]O-. In some embodiments, L 8 -O[(P=O)S - ]O-. In some embodiments, L 8 is the key.

[0407] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 9 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 9 is substituted or unsubstituted C1-C 12 In some embodiments, L 9 For unsubstituted C 3-4 In some embodiments, L 9 For unsubstituted C 1-4 In some embodiments, L 9 is substituted or unsubstituted C1-C 12 In some embodiments, L 9 is substituted or unsubstituted C2-C 12 In some embodiments, L 9 is substituted or unsubstituted C2-C 12 In some embodiments, L 9 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 9 In some embodiments, L 9 In some embodiments, L 9 is -S(=O)-. In some embodiments, L 9 is -S(=O)2-. In some embodiments, L 9 -S(=O)(=NR 1 )-. In some embodiments, L 9 is -C(=O)-. In some embodiments, L 9 -C(=N-OR 1 )-. In some embodiments, L 9 is -C(=O)O-. In some embodiments, L 9 is OC(=O)-. In some embodiments, L 9 is -C(=O)C(=O)-. In some embodiments, L 9 -C(=O)NR 1 -. In some embodiments, L 9 -NR 1 C(=O)-. In some embodiments, L 9 -OC(=O)NR 1 -. In some embodiments, L 9 -NR 1C(=O)O-. In some embodiments, L 9 -NR 1 C(=O)NR 1 -. In some embodiments, L 9 -C(=O)NR 1 C(=O)-. In some embodiments, L 9 -S(=O)2NR 1 -. In some embodiments, L 9 -NR 1 S(=O)2-. In some embodiments, L 9 -NR 1 -. In some embodiments, L 9 -N(OR 1 )-. In some embodiments, L 9 -O[(P=O)O - ]O-. In some embodiments, L 9 -O[(P=O)S - ]O-. In some embodiments, L 9 is the key.

[0408] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 10 is substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 10 is substituted or unsubstituted C1-C 12 In some embodiments, L 10 is substituted or unsubstituted C1-C 12 In some embodiments, L 10 is substituted or unsubstituted C2-C 12 In some embodiments, L 10 is substituted or unsubstituted C2-C 12 In some embodiments, L 10 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 10 In some embodiments, L 10 In some embodiments, L 10 is -S(=O)-. In some embodiments, L 10 is -S(=O)2-. In some embodiments, L 10 -S(=O)(=NR 1 )-. In some embodiments, L 10 is -C(=O)-. In some embodiments, L 10 -C(=N-OR 1 )-. In some embodiments, L 10 is -C(=O)O-. In some embodiments, L 10 is OC(=O)-. In some embodiments, L 10 is -C(=O)C(=O)-. In some embodiments, L 10 -C(=O)NR 1 -. In some embodiments, L 10 -NR 1 C(=O)-. In some embodiments, L 10 -OC(=O)NR 1 -. In some embodiments, L 10 -NR 1 C(=O)O-. In some embodiments, L 10 -NR 1 C(=O)NR 1 -. In some embodiments, L 10-C(=O)NR 1 C(=O)-. In some embodiments, L 10 -S(=O)2NR 1 -. In some embodiments, L 10 -NR 1 S(=O)2-. In some embodiments, L 10 -NR 1 -. In some embodiments, L 10 -N(OR 1 )-. In some embodiments, L 10 -O[(P=O)O - ]O-. In some embodiments, L 10 -O[(P=O)S - ]O-. In some embodiments, L 10 is a substituted or unsubstituted C1-C6 alkylene group. 10 is a substituted or unsubstituted C1-C3 alkylene group. 10 is a substituted or unsubstituted C2-C3 alkylene group. 10 In some embodiments, L 10 is the key.

[0409] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 11 is substituted or unsubstituted -(CH2CH2O) n -, substituted or unsubstituted -(OCH2CH2) n -, substituted or unsubstituted -(CH2) n - or a bond. In some embodiments, L 11 is substituted or unsubstituted -(CH2CH2O) n -. In some embodiments, L 11 is substituted or unsubstituted -(OCH2CH2) n -. In some embodiments, L 11 is substituted or unsubstituted -(CH2) n -. In some embodiments, L 11 In some embodiments, n is from 30 to 50. In some embodiments, n is from 30 to 40. In some embodiments, n is from 40 to 50.

[0410] According to the aforementioned formula, in some embodiments of the compound of formula (V) or (VI), L 12 is substituted or unsubstituted C1-C 12Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR 1 )-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)NR 1 -、-NR 1 C(=O)-, -OC(=O)NR 1 -、-NR 1 C(=O)O-、-NR 1 C(=O)NR 1 -, -C(=O)NR 1 C(=O)-, -S(=O)2NR 1 -、-NR 1 S(=O)2-、-NR 1 -、-N(OR 1 )-、-O[(P=O)O - ]O-、-O[(P=O)S - ]O- or a bond. In some embodiments, L 12 is substituted or unsubstituted C1-C 12 In some embodiments, L 12 is substituted or unsubstituted C1-C 12 In some embodiments, L 12 is substituted or unsubstituted C2-C 12 In some embodiments, L 12 is substituted or unsubstituted C2-C 12 In some embodiments, L 12 -(CH2CH2O) m -or-(OCH2CH2) m -. In some embodiments, L 12 In some embodiments, L 12 In some embodiments, L 12 is -S(=O)-. In some embodiments, L 12 is -S(=O)2-. In some embodiments, L 12 -S(=O)(=NR1 )-. In some embodiments, L 12 is -C(=O)-. In some embodiments, L 12 -C(=N-OR 1 )-. In some embodiments, L 12 is -C(=O)O-. In some embodiments, L 12 is OC(=O)-. In some embodiments, L 12 is -C(=O)C(=O)-. In some embodiments, L 12 -C(=O)NR 1 -. In some embodiments, L 12 -NR 1 C(=O)-. In some embodiments, L 12 -OC(=O)NR 1 -. In some embodiments, L 12 -NR 1 C(=O)O-. In some embodiments, L 12 -NR 1 C(=O)NR 1 -. In some embodiments, L 12 -C(=O)NR 1 C(=O)-. In some embodiments, L 12 -S(=O)2NR 1 -. In some embodiments, L 12 -NR 1 S(=O)2-. In some embodiments, L 12 -NR 1 -. In some embodiments, L 12 -N(OR 1 )-. In some embodiments, L 12 -O[(P=O)O - ]O-. In some embodiments, L 12 -O[(P=O)S - ]O-. In some embodiments, L 12 is a substituted or unsubstituted C1-C6 alkylene group. 12 is a substituted or unsubstituted C1-C3 alkylene group. 12 is a substituted or unsubstituted C2-C3 alkylene group. 12 In some embodiments of the compound of formula (V) or (VI), L 12 -NR 1C(=O)O-. In some embodiments, L 12 In some embodiments, L 12 is an organic molecule residue that inserts the group R. In some embodiments, L 12 Can interact with base pair ions / electrostatically or covalently bond to base pair. Some non-limiting examples of organic molecule residues inserting group R can include berberine, ethidium bromide, daunomycin, thalidomide, doxorubicin (adriamycin), aflatoxin B1, amsacrine, acridine (e.g., proflavine, quinacrine, acridine orange, pyrazoloacridine), acridine yellow, aminonafide, 1,10-phenanthroline, metal cations with polycyclic aromatic ligands (e.g., metals, such as Rh (III); ligands, such as Ir (III), bipyridine, terpyridine), bleomycin, actinomycin D and ellipticine.

[0411] In some embodiments of the compound of Formula (V) or (VI), m is an integer selected from 1 to 10. In some embodiments, m is selected from 1 to 3. In some embodiments, m is selected from 1 to 5. In some embodiments, m is selected from 3 to 8. In some embodiments, m is selected from 2 to 5. In some embodiments, m is selected from 5 to 10. In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3.

[0412] In some embodiments of the compound of Formula (V) or (VI), n is an integer selected from 1 to 200. In some embodiments, n is selected from 1 to 20. In some embodiments, n is selected from 1 to 50. In some embodiments, n is selected from 1 to 100. In some embodiments, n is selected from 50 to 100. In some embodiments, n is selected from 25 to 50. In some embodiments, n is selected from 30 to 40. In some embodiments, n is selected from 25 to 75. In some embodiments, n is selected from 100 to 200. In some embodiments, n is selected from 50 to 150. In some embodiments, n is selected from 150 to 200.

[0413] In some embodiments of the compound of Formula (VI), Formula (VIa), or Formula (VIb), m is an integer selected from 1 to 10. In some embodiments, m is selected from 1 to 3. In some embodiments, m is selected from 1 to 5. In some embodiments, m is selected from 3 to 8. In some embodiments, m is selected from 2 to 5. In some embodiments, m is selected from 5 to 10. In some embodiments, m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3.

[0414] In some embodiments of the compound of Formula (VI), Formula (VIa), or Formula (VIb), n is an integer selected from 1 to 200. In some embodiments, n is selected from 1 to 20. In some embodiments, n is selected from 1 to 50. In some embodiments, n is selected from 1 to 100. In some embodiments, n is selected from 50 to 100. In some embodiments, n is selected from 25 to 50. In some embodiments, n is selected from 30 to 40. In some embodiments, n is selected from 25 to 75. In some embodiments, n is selected from 100 to 200. In some embodiments, n is selected from 50 to 150. In some embodiments, n is selected from 150 to 200.

[0415] In some embodiments of the compound of Formula (V), Formula (VI), Formula (VIa), or Formula (VIb), each R 1 are independently H or -CH3. In some embodiments, R 1 H

[0416] In some embodiments of the compounds of Formula (V), (VI), (VIa), or (VIb), R comprises one or more of a fatty alcohol, a fatty acid, a glycerolipid, a glycerophospholipid, a sphingolipid, a glycolipid, a polyketide, a sterol lipid, and a prenol lipid. In some embodiments, R comprises one or more fatty alcohols. In some embodiments, each fatty alcohol is independently a saturated, monounsaturated, or polyunsaturated fatty alcohol. In some embodiments, the fatty alcohol comprises one or more C2-C 26 Fatty alcohol. In some embodiments, the fatty alcohol comprises two or more C2-C 26 Fatty alcohol. In some embodiments, each fatty alcohol is a C12, C14, C16, C18, C20 or C22 fatty alcohol. In some embodiments, each fatty alcohol is independently docosahexaenol, eicosapentaenol, oleyl alcohol, stearyl alcohol, (9Z, 12Z)-octadeca-9,12-dien-1-yl alcohol, (Z)-docosa-13-en-1-yl alcohol, docosanol, (E)-octadeca-9-en-1-yl alcohol, eicosanol, (9Z, 12Z, 15Z)-octadeca-9,12,15-trien-1-yl alcohol or palmityl alcohol. In some embodiments, each fatty alcohol is stearyl alcohol. In some embodiments, R includes one or more sterol lipids. In some embodiments, R includes one or more of vitamins. In some embodiments, each vitamin is independently vitamin A, vitamin D, vitamin E or vitamin K.

[0417] In some embodiments, the R group provided in Formula (V), Formula (VI), Formula (Via), or Formula (VIb) comprises a payload as described herein. In some embodiments, the R group provided in Formula (V), Formula (VI), Formula (Via), or Formula (VIb) comprises a lipid.

[0418] In some embodiments, the R group provided in Formula (V), Formula (VI), Formula (VIa) or Formula (VIb) comprises a nucleic acid. In some embodiments, the nucleic acid is a single-stranded nucleic acid. In some embodiments, the single-stranded nucleic acid is DNA. In some embodiments, the single-stranded nucleic acid is RNA. In some embodiments, the nucleic acid is a double-stranded nucleic acid. In some embodiments, the double-stranded nucleic acid is DNA. In some embodiments, the double-stranded nucleic acid is RNA. In some embodiments, the double-stranded nucleic acid is a DNA-RNA hybrid. In some embodiments, the nucleic acid is a messenger RNA (mRNA), a microRNA (microRNA), an asymmetric interfering RNA (aiRNA), a small hairpin RNA (shRNA) or a Dicer-substrate dsRNA. In some embodiments, the nucleic acid is an mRNA. In some embodiments, R includes an mRNA molecule encoding a Cas nuclease, i.e., a Cas nuclease mRNA. In some embodiments, R includes one or more guide RNAs or nucleic acids encoding guide RNAs. In some embodiments, R includes a template nucleic acid for repair or recombination. In some embodiments, R includes an mRNA encoding a gene editor nuclease. In some embodiments, R includes an mRNA encoding a base editor nuclease. In some embodiments, R comprises an mRNA encoding a restriction endonuclease. In some embodiments, R comprises a zinc finger nuclease or a TALEN nuclease. In some embodiments, R comprises a guide RNA. In some embodiments, the gRNA hybridizes to a gene selected from PCSK9, ANGPTL3, APOC3, LPA, APOB, MTP, ANGPTL4, ANGPTL8, APOA5, APOE, LDLR, IDOL, NPC1L1, ASGR1, TM6SF2, GALNT2, GCKR, LPL, MLXIPL, SORT1, TRIB1, MARC1, ABCG5, and ABCG8. In some embodiments, the gRNA hybridizes to PCSK9. In some embodiments, the gRNA hybridizes to ANGPTL3. In some embodiments, R comprises a guide RNA sequence as described herein. In some embodiments, R comprises a coupling sequence as described herein. In some embodiments, R comprises an mRNA, a guide RNA, an siRNA, an antisense oligonucleotide, a microRNA, a decoy RNA, or an aptamer. In some embodiments, when R is a nucleic acid, L 12 The group R may be inserted or bonded to the group R.

[0419] In some embodiments, the R groups provided in Formula (V), Formula (VI), Formula (VIa) or Formula (VIb) comprise amino acids. In some embodiments, the amino acids are natural amino acids. In some embodiments, the amino acids are amino acids other than the 20 standard amino acids. The amino acids may be modified.

[0420] In some embodiments, the R group provided in Formula (V), Formula (VI), Formula (VIa), or Formula (VIb) comprises a protein. In some embodiments, the protein is an Argonaute protein. In some embodiments, the protein is a Cas protein. In some embodiments, the protein is an RNP.

[0421] In some embodiments, the R group provided in Formula (V), Formula (VI), Formula (Via), or Formula (VIb) comprises a lipid nanoparticle.

[0422] It should be understood that L 12 The bond between R and R can be a covalent bond, a hydrogen bond, an intermolecular or an intramolecular interaction.

[0423] In some embodiments of the compound of Formula (V), Formula (VI), Formula (Via), or Formula (VIb), A is In some embodiments of the compound of Formula (V), Formula (VI), Formula (Via), or Formula (VIb), A is galactose.

[0424] In some embodiments, the receptor-targeted conjugate described herein is a GalNAc-conjugated lipid having the structure given in Table 4.

[0425] Table 4. Exemplary GalNAc-conjugated lipids

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432]

[0433]

[0434]

[0435]

[0436]

[0437]

[0438]

[0439]

[0440] Unless otherwise indicated, each asymmetric carbon in Table 4 represents racemic, R, and S configurations. As shown in Table 4, each of n, p, and q is independently 0 or an integer from 1 to 200. In some embodiments, each of n, p, and q in Table 4 is independently 0 or an integer from 1 to 100. In some embodiments, each of n, p, and q in Table 4 is independently 0 or an integer from 1 to 50. In some embodiments, each of n, p, and q in Table 4 is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 13, 15, 16, 17, 18, 19, or 20. In some embodiments, each of n, p, and q in Table 4 is independently 0, 1, 2, 3, 4, or 5. In some embodiments, each of n, p, and q in Table 4 is independently 0, 1, 2, or 3. In some embodiments, each of n, p, and q in Table 4 is independently 1 or 2. In some embodiments, n is 1-60, and each of p and q in Table 4 is independently 1-9. In some embodiments, exemplary GalNAc-conjugated lipids ID Nos. 1001, 1011, 1015, 1020, 1025, 1030, 1037, 1040, 1041, 1045, 1050, 1055, 1060, 1061, 1062, 1063, 1064, 1065, 1066, 1067, and 1082 in Table 4 have n=1, 11, 36, or 44. In some embodiments of the exemplary GalNAc-conjugated lipids in Table 4, n is 1 to 100. In some embodiments, n is 1 to 50. In some embodiments, n is 25 to 50. In some embodiments, n is 1 to 10. In some embodiments, n is 1 to 5. In some embodiments, n is 1 to 50. In some embodiments, n is 25 to 75. In some embodiments, n is 100 to 150. In some embodiments, n is 1. In some embodiments, n is 11. In some embodiments, n is 36. In some embodiments, n is 44. In some embodiments, n is 40 to 50. In some embodiments, n is 30 to 40. In some embodiments of the exemplary GalNAc-conjugated lipids of Table 4, p is 1 to 100. In some embodiments, p is 1 to 50. In some embodiments, p is 25 to 50. In some embodiments, p is 1 to 10. In some embodiments, p is 1 to 5. In some embodiments, p is 1 to 50. In some embodiments, p is 25 to 75. In some embodiments, p is 100 to 150. In some embodiments, p is 40 to 50. In some embodiments, p is 30 to 40. In some embodiments of the exemplary GalNAc-conjugated lipids of Table 4, q is 1 to 100. In some embodiments, q is 1 to 50. In some embodiments, q is 25 to 50.In some embodiments, q is 1 to 10. In some embodiments, q is 1 to 5. In some embodiments, q is 1 to 50. In some embodiments, q is 25 to 75. In some embodiments, q is 100 to 150. In some embodiments, q is 40 to 50. In some embodiments, q is 30 to 40.

[0441] Lipid nanoparticle (LNP) compositions

[0442] On the one hand, disclosed herein are lipid nanoparticle compositions comprising receptor-targeted conjugates as described herein. In some embodiments, disclosed herein are lipid nanoparticle compositions comprising (i) a payload (e.g., a therapeutic agent) or a target of interest, and (ii) a receptor-targeted conjugate as described herein. In some embodiments, disclosed herein are lipid nanoparticle compositions comprising (i) one or more nucleic acid molecule entities (i.e., nucleic acids, such as mRNA and gRNA), and (ii) a receptor-targeted conjugate as described herein. In some embodiments, the nanoparticle compositions described herein comprise two or more receptor-targeted conjugates, which may be the same or different. In some embodiments, one or more nucleic acid molecule entities comprise nucleic acids as described herein. In some embodiments, one or more nucleic acid molecule entities comprise single guide RNA (sgRNA) or guide RNA (gRNA) targeting a pathogenic gene of interest produced in a hepatocyte. In some embodiments, one or more nucleic acid molecule entities comprise mRNA encoding a Cas nuclease. In some embodiments, at least one of the one or more nucleic acid molecule entities comprises a chemical modification, e.g., a chemical modification as described herein. In some embodiments, the chemical modification is a 2'-F modification, a phosphorothioate internucleotide linkage modification, an acyclic nucleotide, LNA, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-fluoro, 2'-ON-methylacetamido (2'-O-NMA), 2'-O-dimethylaminoethoxyethyl (2'-O-DMAEOE), 2'-O-aminopropyl (2'-O-AP), 4'-O-methyl, or 2'-ara-F modification. In some embodiments, the chemical modification is a 2'-O-methyl modification.

[0443] In some embodiments, the receptor-targeted conjugate comprises from about 0.001 mol% to about 20 mol% of the total lipid content present in a nanoparticle composition described herein. In some embodiments, the receptor-targeted conjugate comprises from about 0.01 mol% to about 1 mol% of the total lipid content present in a nanoparticle composition described herein. In some embodiments, the receptor-targeted conjugate comprises from about 0.001 mol%, about 0.005 mol%, about 0.01 mol%, about 0.02 mol%, about 0.03 mol%, about 0.04 mol%, about 0.05 mol%, about 0.06 mol%, about 0.07 mol%, about 0.08 mol%, or about 0.09 mol% to about 1 mol%, about 1.5 mol%, about 2 mol%, about 5 mol%, about 10 mol%, or about 20 mol% of the total lipid content present in a nanoparticle composition described herein. In some embodiments, the receptor targeted conjugate comprises about 0.001 mol%, about 0.005 mol%, about 0.01 mol%, about 0.02 mol%, about 0.03 mol%, about 0.04 mol%, or about 0.05 mol% to about 0.06 mol%, about 0.07 mol%, about 0.08 mol%, about 0.09 mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 5 mol%, about 10 mol%, or about 20 mol% of the total lipid content present in the nanoparticle compositions described herein. In some embodiments, the receptor targeted conjugate comprises about 0.01 mol%, about 0.02 mol%, about 0.03 mol%, about 0.04 mol%, about 0.05 mol%, about 0.06 mol%, about 0.07 mol%, about 0.08 mol%, about 0.09 mol%, about 0.1 mol%, about 0.2 mol%, about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, about 0.1 mol%, about 0.2 mol%, about 0.3 mol%, about 0.4 ...8 mol%, about 0.9 mol%...

Claims

1. A compound of formula (V): in, Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

2. The compound according to claim 1, wherein L 1 , L 4 and L 7 are each independently substituted or unsubstituted C1-C 12 Alkylene; L 2 , L 5 and L 8 Each is independently -C(=O)N(R 1 )-or-N(R 1 )C(=O)-, where R 1 is H or -CH3; L 3 , L 6 and L 9 Each is independently a substituted or unsubstituted C2-C6 alkylene group; L 10 -(CH2) 1-3 -, -CH2CH2O- or -CH2O-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -, and n is an integer selected from 1 to 50; L 12 is -NHC(=O)O- or -NHC(=O)-; and R comprises one or more of fatty alcohols, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides, sterols, sterol lipids or vitamins.

3. A compound according to claim 1 or 2, wherein L 1 , L 3 , L 4 and L 7 They are -(CH2)4- respectively.

4. A compound according to any one of claims 1 to 3, wherein L 2 , L 5 and L 8 Each is -C(=O)NH.

5. A compound according to any one of claims 1 to 4, wherein L 6 and L 9 Each is -(CH2)3-.

6. A compound according to any one of claims 1 to 5, wherein L 10 It is -(CH2)2-.

7. A compound according to any one of claims 1 to 6, wherein L 11 -(OCH2CH2) n -.

8. A compound according to any one of claims 1 to 7, wherein n is 33, 34, 35, 36, 37, 38 or 39.

9. The compound according to any one of claims 1 to 8, wherein R comprises a glycerolipid.

10. A compound according to any one of claims 1 to 9, wherein L 12 It is -NHC(=O)- or -NHC(=O)O-.

11. The compound according to any one of claims 1 to 10, wherein the plurality of A groups comprises a lectin receptor targeting ligand, the lectin receptor is an asialoglycoprotein receptor (ASGPR), and the plurality of A groups comprises N-acetylgalactosamine, galactose, or a combination thereof.

12. A compound according to any one of claims 1 to 11, wherein each A group is 13. A compound according to claim 1, wherein: a. Multiple A groups contain lectin receptor targeting ligands; B L 1 , L 3 , L 4 and L 7 Each of which contains -(CH2)4-; cL 2 , L 5 and L 8 Each of which contains -C(=O)NH-; dL 6 and L 9 Each of which contains -(CH2)3-; eL 10 -(CH2) 1-3 -, -CH2CH2O- or -CH2O-; f 11 -(CH2CH2O) n -or-(OCH2CH2) n -, wherein n is an integer selected from 1 to 50; g 12 is -NH(CO)O- or -NHC(=O)-; and hR is selected from dialkylglycerol, diacylglycerol, sterol, containing C 10 -C 30 C 10 -C 30 branched chain alkyl or tocopherol of carbon atoms.

14. The compound according to claim 1, wherein the compound is Where p and q are 2, and n is 33-39.

15. The compound according to claim 1, wherein the compound is Where p and q are 2, and n is 34.

16. The compound according to claim 1, wherein the compound is Where p and q are 2, and n is 35.

17. The compound according to claim 1, wherein the compound is 18. A nanoparticle comprising a compound according to any one of claims 1 to 17.

19. A lipid nanoparticle comprising the compound according to any one of claims 1-17.

20. A formulation comprising nanoparticles, wherein the nanoparticles comprise a compound of formula (V): in, L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; n is an integer selected from 1 to 200; and Each of the A groups is N-acetylgalactosamine, galactose, or a combination thereof.

21. The formulation according to claim 20, wherein L 1 , L 4 and L 7 Each is independently a substituted or unsubstituted C2-C6 alkylene group; L 2 , L 5 and L 8 Each is independently -C(=O)N(R 1 )-or-N(R 1 )C(=O)-, where R 1 is H or -CH3; L 3 , L 6 and L 9 Each is independently a substituted or unsubstituted C2-C6 alkylene group; L 10 -(CH2) 1-3 -, -CH2CH2O- or -CH2O-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -, and n is an integer selected from 1 to 50; L 12 is -NHC(=O)O- or -NHC(=O)-; and R comprises one or more of fatty alcohols, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides, sterols, sterol lipids or vitamins.

22. A formulation according to claim 20 or 21, wherein L 1 , L 3 , L 4 and L 7 They are -(CH2)4- respectively.

23. A formulation according to any one of claims 20 to 22, wherein L 2 , L 5 and L 8 Each is -C(=O)NH.

24. A formulation according to any one of claims 20 to 23, wherein L 6 and L 9 Each is -(CH2)3-.

25. A formulation according to any one of claims 20 to 24, wherein L 10 It is -(CH2)2-.

26. A formulation according to any one of claims 20 to 25, wherein L 11 -(OCH2CH2) n -.

27. A formulation according to any one of claims 20 to 26, wherein n is 33, 34, 35, 36, 37, 38 or 39.

28. A formulation according to any one of claims 20 to 27, wherein R comprises a glycerolipid.

29. A formulation according to any one of claims 20 to 28, wherein L 12 It is -NHC(=O)-.

30. A formulation according to any one of claims 20 to 29, wherein each A group is 31. The formulation according to claim 20, wherein: a. the plurality of A groups comprises a lectin receptor targeting ligand; B L 1 , L 3 , L 4 and L 7 Each of which contains -(CH2)4-; cL 2 , L 5 and L 8 Each of which contains -C(=O)NH-; dL 6 and L 9 Each of which contains -(CH2)3-; eL 10 -(CH2) 1-3 -, -CH2CH2O- or -CH2O-; f 11 -(CH2CH2O) n -or-(OCH2CH2) n -, wherein n is an integer selected from 1 to 50; g 12 is -NH(CO)O- or -NHC(=O)-; and hR is selected from dialkylglycerol, diacylglycerol, sterol, containing C 10 -C 30 C 10 -C 30 branched chain alkyl or tocopherol of carbon atoms.

32. The formulation according to claim 20, wherein the compound is Where p and q are 2, and n is 33-39.

33. The formulation according to claim 20, wherein the compound is Where p and q are 2, and n is 34.

34. The compound according to claim 20, wherein the compound is Where p and q are 2, and n is 35.

35. The formulation according to claim 20, wherein the compound is 36. The formulation according to claim 20, wherein the compound is Where p and q are 2, and n is 37.

37. The formulation according to claim 20, wherein the compound is Where p and q are 2, and n is 38.

38. The formulation according to claim 20, wherein the compound is Where p and q are 2, and n is 39.

39. The formulation according to any one of claims 20 to 38, wherein the amount of the compound in the nanoparticle is at most 10 mol% of the total amount of lipid in the nanoparticle.

40. The formulation according to any one of claims 20 to 39, wherein the amount of the compound in the nanoparticle is at most 5 mol% of the total amount of lipid in the nanoparticle.

41. The formulation according to any one of claims 20 to 40, wherein the amount of the compound in the nanoparticle is at most 2 mol% of the total amount of lipid in the nanoparticle.

42. The formulation according to any one of claims 20 to 41, wherein the amount of the compound in the nanoparticle is at most 1 mol% of the total amount of lipid in the nanoparticle.

43. The formulation according to any one of claims 20 to 42, wherein the amount of the compound in the nanoparticle is at most 0.5 mol% of the total amount of lipid in the nanoparticle.

44. The formulation according to any one of claims 20 to 43, wherein the amount of the compound in the nanoparticle is at most 0.1 mol% of the total amount of lipid in the nanoparticle.

45. The formulation according to any one of claims 20 to 44, wherein the amount of the compound in the nanoparticle is at most 0.001 mol% of the total amount of lipid in the nanoparticle.

46. ​​The formulation according to any one of claims 20 to 45, wherein the amount of the compound in the nanoparticle is at most 0.01 mol% of the total amount of lipid in the nanoparticle.

47. The formulation according to any one of claims 20 to 46, wherein the amount of the compound in the nanoparticle is at most 0.05 mol% of the total amount of lipid in the nanoparticle.

48. The formulation according to any one of claims 20 to 47, wherein the amount of the compound in the nanoparticle is at most 0.1 mol% of the total amount of lipid in the nanoparticle.

49. The formulation according to any one of claims 20 to 48, wherein the amount of the compound in the nanoparticle is at most 0.25 mol% of the total amount of lipid in the nanoparticle.

50. The formulation according to any one of claims 20-49, wherein the nanoparticles further comprise an excipient.

51. A formulation according to any one of claims 20-50, wherein the nanoparticles further comprise ionizable amino lipids.

52. The formulation according to any one of claims 20-51, wherein the nanoparticles further comprise a sterol.

53. A formulation according to claim 52, wherein the sterol comprises cholesterol.

54. A formulation according to any one of claims 20-53, wherein the nanoparticles further comprise a phospholipid.

55. A formulation according to claim 54, wherein the phospholipid comprises egg yolk phosphatidylcholine (EPC), distearoylphosphatidylcholine, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dipalmitoylphosphatidylcholine, dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 2-oleoyl-1-palmitoyl-sn-glycero-3-phosphocholine (POPC), dimyristoylphosphatidylcholine (DMPC), dioleoylphosphatidylcholine (DOPC), and any combination thereof.

56. The formulation of claim 54, wherein the phospholipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

57. A formulation according to any one of claims 20-56, wherein the nanoparticles further comprise stealth lipids.

58. A formulation according to claim 57, wherein the stealth lipid comprises a polyethylene glycol (PEG)-lipid.

59. A formulation according to claim 58, wherein the PEG-lipid has at least 40 ethylene glycol units.

60. The formulation according to claim 58, wherein the PEG-lipid has a number average molecular weight of about 750 Da to about 2500 Da.

61. A formulation according to claim 58, wherein the PEG-lipid comprises PEG-dilauroylglycerol, PEG-dimyristoylglycerol (PEG-DMG), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE), PEG-dipalmitoylglycerol, PEG-disterolglycerol, PEG-dilauroylglycinamide, PEG-dimyristoylglycinamide, PEG-dipalmitoylglycinamide, PEG-disterolglycinamide, PEG-cholesterol and PEG-DMB (3,4-di-tetradecanoylbenzyl-[ω]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]) or a combination thereof.

62. The formulation according to claim 58, wherein the PEG-lipid comprises or a combination thereof.

63. A formulation according to claim 57 or 58, wherein the stealth lipid comprises 64. A formulation according to any one of claims 20-63, wherein the nanoparticles further comprise an amino lipid.

65. A formulation according to claim 64, wherein the amino lipid comprises an ionizable lipid.

66. according to the preparation of claim 64, wherein said amino lipid comprises 67. according to the preparation of claim 64, wherein said amino lipid comprises 68. A formulation according to any one of claims 20-67, wherein the nanoparticles further comprise mRNA.

69. A formulation according to claim 68, wherein the mRNA encodes a gene editor.

70. A formulation according to claim 68 or 69, wherein the mRNA encodes a base editor.

71. A formulation according to any one of claims 68-70, wherein the mRNA encodes a deaminase.

72. A formulation according to any one of claims 68-71, wherein the mRNA encodes an adenine base editor.

73. A formulation according to any one of claims 68-72, wherein the mRNA encodes a nuclease.

74. A formulation according to any one of claims 68-73, wherein the mRNA encodes a Cas nuclease.

75. The formulation of any one of claims 68-74, wherein the mRNA encodes a Cas nuclease selected from the group consisting of Cas9, Cpf1, CasX, CasY, C2c1, and C2c3.

76. A formulation according to any one of claims 68-75, wherein the mRNA encodes a mutated Cas9 sequence.

77. The formulation of claim 76, wherein the mutated Cas9 sequence comprises a change selected from positions D10, E762, H840, N854, N863, H983, and D986 based on SEQ ID NO:

1.

78. The agent according to claim 76 or 77, wherein the mutated Cas9 sequence comprises a mutation selected from positions D10A, E762A, H840A, N863A, H983A and D986A based on SEQ ID NO:

1.

79. A formulation according to any one of claims 68-78, wherein the mRNA encodes a nickase.

80. The formulation according to any one of claims 68-79, wherein the mRNA encodes a nuclear localization signal (NLS).

81. The formulation according to claim 80, wherein the NLS comprises a signal of one of SEQ ID NOs: 3-6.

82. The formulation of any one of claims 20-81, wherein the nanoparticle further comprises a guidance polynucleotide.

83. The formulation according to claim 82, wherein the guide polynucleotide is a guide RNA.

84. A formulation according to claim 82 or 83, wherein the polynucleotide comprises a spacer sequence.

85. The formulation of any one of claims 82-84, wherein the guide polynucleotide comprises a tracr sequence.

86. A formulation according to claim 84 or 85, wherein the spacer sequence corresponds to the pro-spacer sequence on the PCSK9 gene.

87. The formulation of claim 86, wherein the protospacer sequence has at least 80% sequence identity with: CAGGTTCCATGGGATGCTCT(SEQ ID NO:104), GGCTGATGAGGCCGCACATG (SEQ ID NO: 105), CCCATACCTTGGAGCAACGG(SEQ ID NO:106), or CCCGCACCTTGGCGCAGCGG (SEQ ID NO: 110).

88. The formulation of any one of claims 82-87, wherein the guide polynucleotide comprises a polynucleotide sequence having at least 80% sequence identity to the nucleotide sequence of one of SEQ ID NOs: 121-125.

89. The formulation according to claim 84 or 85, wherein the spacer sequence corresponds to the protospacer sequence on the ANGPTL3 gene.

90. The formulation according to claims 84, 85 and 89, wherein the protospacer sequence has at least 80% sequence identity to GAGATACCTGAGTAACTTTC (SEQ ID NO: 111).

91. The formulation according to any one of claims 82-85, 89 and 90, wherein the polynucleotide comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO:

126.

92. The formulation of any one of claims 20-91, wherein the nanoparticle further comprises mRNA encoding a gene editor and a guide polynucleotide.

93. A formulation according to claim 92, wherein the gene editor achieves gene editing in a sequence located at a splice site of a target gene.

94. A formulation according to any one of claims 20-93, wherein the nanoparticles comprise amino lipids, stealth lipids, sterols and phospholipids.

95. A formulation according to claim 94, wherein: The amino lipids account for 1 mol% to 65 mol% of the total lipids present in the lipid nanoparticles. The stealth lipid accounts for 0.1 mol% to 10 mol% of the total lipids present in the lipid nanoparticles. The sterols constitute 20 mol% to 50 mol% of the total lipids present in the lipid nanoparticles, and The phospholipids account for 1 mol% to 20 mol% of the total lipids present in the lipid nanoparticles.

96. A formulation according to claim 94 or 95, wherein: The amino lipids account for 10 mol% to 60 mol% of the total lipids present in the lipid nanoparticles. The stealth lipids account for 0.1 mol% to 6 mol% of the total lipids present in the lipid nanoparticles. The sterol accounts for about 25 mol%, about 26 mol%, about 27 mol%, about 28 mol%, about 29 mol%, about 30 mol%, about 31 mol%, about 32 mol%, about 33 mol%, about 34 mol%, about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, or about 50 mol% of the total lipids present in the lipid nanoparticle, and The phospholipids account for 5 mol% to 15 mol% of the total lipids present in the lipid nanoparticles.

97. A formulation according to any one of claims 94-96, wherein: The amino lipids account for 40 mol% to 65 mol% of the total lipids present in the lipid nanoparticles. The stealth lipids account for 0.5 mol% to 5 mol% of the total lipids present in the lipid nanoparticles. The sterol accounts for about 30 mol%, about 31 mol%, about 32 mol%, about 33 mol%, about 34 mol%, about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, or about 50 mol% of the total lipids present in the lipid nanoparticle, and The phospholipids account for 8 mol% to 12 mol% of the total lipids present in the lipid nanoparticles.

98. A formulation according to any one of claims 94-97, wherein: The amino lipids account for about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, about 49 mol%, about 50 mol%, about 51 mol%, about 52 mol%, about 53 mol%, about 54 mol%, about 55 mol%, of the total lipids present in the lipid nanoparticles. The stealth lipids account for 1 mol% to 3 mol% of the total lipids present in the lipid nanoparticles. The sterol comprises about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, or about 50 mol% of the total lipid present in the lipid nanoparticle, and The phospholipids account for about 9 mol%, about 10 mol%, or about 11 mol% of the total lipids present in the lipid nanoparticles.

99. according to any one of claims 94-98, wherein the amino lipid comprises or a combination thereof, wherein the amino lipid comprises about 48 mol%, about 49 mol%, about 50 mol%, about 51 mol%, about 52 mol%, wherein the stealth lipid comprises or a combination thereof, wherein The stealth lipid comprises about 2.0 mol%, about 2.1 mol%, about 2.2 mol%, about 2.3 mol%, about 2.4 mol%, about 2.5 mol%, about 2.6 mol%, about 2.7 mol%, about 2.8 mol%, about 2.9 mol%, or about 3.0 mol%, The sterol comprises about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol%, or about 41 mol% of the total lipids present in the lipid nanoparticle, and The phospholipid comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), wherein the phospholipid accounts for about 9 mol % of the total lipids present in the lipid nanoparticle.

100. The formulation of claim 92, wherein the weight ratio of the guide RNA to the mRNA is 10:1 to 1:

10.

101. The formulation of claim 92, wherein the weight ratio of the guide RNA to the mRNA is 5:1 to 1:

5.

102. The formulation of claim 92, wherein the weight ratio of the guide RNA to the mRNA is 3:1 to 1:

3.

103. The formulation of claim 92, wherein the weight ratio of the guide RNA to the mRNA is 2:1 to 1:

2.

104. The formulation of claim 92, wherein the weight ratio of the guide RNA to the mRNA is about 1:

1.

105. The formulation according to any one of claims 20-104, wherein the lipid nanoparticles comprise a stereoisomer, a racemic mixture of stereoisomers or a salt of the compound of formula (V).

106. A formulation comprising nanoparticles, wherein the nanoparticles comprise: a) is selected from compounds having the following structure: wherein p and q are 2, and n is 33-39 or any combination thereof, and optionally where p and q are 2, and n is 34, Where p and q are 2, and n is 35, and any combination thereof, wherein the compound accounts for 0.001 mol% to 0.5 mol% of the total lipids in the lipid nanoparticle; b) an amino lipid selected from the group consisting of: and any combination thereof, wherein the amino lipid comprises about 48 mol%, about 49 mol%, about 50 mol%, about 51 mol%, or about 52 mol%, c) Stealth lipids comprising or any combination thereof, wherein the stealth lipid comprises about 2.0 mol%, about 2.1 mol%, about 2.2 mol%, about 2.3 mol%, about 2.4 mol%, about 2.5 mol%, about 2.6 mol%, about 2.7 mol%, about 2.8 mol%, about 2.9 mol% or about 3.0 mol%, d) cholesterol, wherein the cholesterol accounts for about 35 mol%, about 36 mol%, about 37 mol%, about 38 mol%, about 39 mol%, about 40 mol% or about 41 mol% of the total lipids present in the lipid nanoparticle, e) a phospholipid selected from the group consisting of egg yolk phosphatidylcholine (EPC), distearoylphosphatidylcholine, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dipalmitoylphosphatidylcholine, dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 2-oleoyl-1-palmitoyl-sn-glycero-3-phosphocholine (POPC), dimyristoylphosphatidylcholine (DMPC), dioleoylphosphatidylcholine (DOPC), and any combination thereof, and wherein the phospholipids account for about 9.0 mol%, about 10 mol%, or about 11 mol% of the total lipids in the lipid nanoparticles.

107. A formulation according to claim 106, wherein the nanoparticles further comprise a guide RNA and an mRNA encoding a gene editor, wherein the weight ratio between the guide RNA and the mRNA is about 1:

1.

108. A receptor-targeted conjugate comprising a compound of formula (V): in, Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

109. Use of a formulation comprising nanoparticles in the preparation of a medicament for treating a disease or condition in a subject, the nanoparticles comprising a compound of formula (V): in: Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

110. Use of a lipid nanoparticle comprising a payload comprising one or more pharmaceutically active agents in the preparation of a medicament for reducing the risk of coronary artery disease in a subject in need thereof, wherein the payload comprises one or more pharmaceutically active agents, and the lipid nanoparticle comprises a receptor-targeted conjugate of formula (V): in: Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

111. A method of delivering a nucleic acid into a cell, the method comprising contacting the cell with a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise a compound of formula (V): in: Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

112. A method of producing a polypeptide of interest in a cell, the method comprising contacting the cell with a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise a compound of formula (V): in: Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

113. Use of a pharmaceutical composition comprising nanoparticles in the preparation of a medicament for delivering a nucleic acid molecule entity to the liver of a subject, wherein the nanoparticles comprise a compound of formula (V): in: Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n - or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R includes lipids, nucleic acids, amino acids, proteins, or lipid nanoparticles; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

114. A method for preparing a formulation comprising GalNAc-lipid nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid active agents, (ii) a lipid excipient comprising a sterol or a derivative thereof, a phospholipid, a stealth lipid, and an amino lipid, and (iii) a GalNAc-lipid receptor targeting conjugate, the method comprising: a. providing a first solution comprising the one or more nucleic acid-active agents in an aqueous buffer; b. providing a second solution comprising (i) the lipid excipient and (ii) at least a portion of the receptor-targeted conjugate in a water-miscible organic solvent; c. mixing the first solution and the second solution; d. incubating the mixture of the first solution and the second solution to form GalNAc-lipid nanoparticles; and e. Optionally performing one or more of dilution, buffer exchange, concentration, filtration, and GalNAc-lipid nanoparticle evaluation processes.

115. A method for preparing a formulation comprising GalNAc-lipid nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid active agents, (ii) a lipid excipient comprising a sterol or a derivative thereof, a phospholipid, a stealth lipid, and an amino lipid, and (iii) a GalNAc-lipid receptor targeting conjugate, the method comprising: a. providing a first solution comprising the one or more nucleic acid-active agents in an aqueous buffer; b. providing a second solution comprising (i) the lipid excipient and (ii) at least a portion of the receptor-targeted conjugate in a water-miscible organic solvent; c. mixing the first solution and the second solution; as well as d. diluting the mixture of the first solution and the second solution by adding an aqueous buffer.

116. The method according to claim 115, wherein the water-soluble organic solvent comprises ethanol.

117. The method according to claim 115 or 116, wherein the method further comprises incubating a mixture of the first solution and the second solution.

118. The method according to any one of claims 115-117, wherein the method further comprises performing one or more dilution, buffer exchange, concentration, filtration and GalNAc-lipid nanoparticle evaluation processes.

119. The method according to any one of claims 115 to 118, wherein mixing the mixture of the first solution and the second solution in step c is performed in a cross mixer.

120. The method according to any one of claims 115 to 119, wherein in step d, diluting the mixture of the first solution and the second solution by adding an aqueous buffer is performed in a T-mixer.

121. A method for preparing a formulation comprising GalNAc-lipid nanoparticles, wherein the nanoparticles comprise (i) one or more nucleic acid molecule entities, (ii) a lipid excipient comprising one or more sterols or derivatives thereof, phospholipids, stealth lipids or amino lipids, and (iii) one or more GalNAc-lipid receptor targeting conjugates, the method comprising: a. providing a first solution comprising one or more nucleic acid molecule entities in an aqueous buffer; b. providing a second solution comprising at least one of the one or more lipid excipients in a water-soluble organic solvent; c. providing a third solution comprising at least a portion of the receptor targeting conjugate; d. mixing the first solution, the second solution, and the third solution in one or more mixing chambers, wherein each solution is introduced separately into the one or more mixing chambers via an inlet; e. incubating the mixture of the first solution, the second solution and the third solution to form GalNAc-lipid nanoparticles; and f. Optionally performing one or more of dilution, buffer exchange, concentration, filtration, and GalNAc-lipid nanoparticle evaluation processes.

122. A receptor-targeted conjugate comprising a compound of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

123. Use of a formulation comprising nanoparticles in the preparation of a medicament for treating a disease or condition in a subject, the nanoparticles comprising a compound of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

124. Use of a lipid nanoparticle comprising a payload comprising one or more pharmaceutically active agents in the preparation of a medicament for reducing the risk of coronary artery disease in a subject in need thereof, wherein the payload comprises one or more pharmaceutically active agents, and the lipid nanoparticle comprises a receptor-targeted conjugate of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

125. A method of delivering a nucleic acid into a cell, the method comprising contacting the cell with a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise a compound of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

126. A method of producing a polypeptide of interest in a cell, the method comprising contacting the cell with a pharmaceutical composition comprising nanoparticles, wherein the nanoparticles comprise a compound of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

127. Use of a pharmaceutical composition comprising nanoparticles in the preparation of a medicament for delivering a nucleic acid molecule entity to the liver of a subject, wherein the nanoparticles comprise a compound of formula (VI): in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

128. A nucleotide conjugate comprising: (a) nucleic acids, and (b) a targeting moiety linked to the nucleic acid in (a), wherein the targeting moiety comprises the structure of Table 1.

129. A nucleotide conjugate comprising: (a) nucleic acids, and (b) a targeting moiety attached to the nucleic acid in (a), wherein the targeting moiety comprises a coupling sequence that hybridizes to the nucleic acid in (a).

130. A nucleotide conjugate comprising a structure of formula (IV) Wherein each X is independently H or a protecting group, R A is -OX or -NHAc, Y is O or S, and W represents (a) (i) a single guide RNA and a nuclease mRNA, (ii) dual guide RNAs and a nuclease mRNA, (iii) a single guide RNA and an RNP, or (iv) dual guide RNAs and an RNP; or (b) Coupling sequence.

131. The use or method according to any one of claims 110, 114, 115-120 and 124, wherein the active agent comprises mRNA.

132. The use or method according to claim 131, wherein the mRNA encodes a gene editor.

133. The use or method according to claim 131 or 132, wherein the mRNA encodes a base editor.

134. The use or method according to any one of claims 131 to 133, wherein the mRNA encodes a deaminase.

135. The use or method according to any one of claims 131-134, wherein the mRNA encodes an adenine base editor.

136. The use or method according to any one of claims 131 to 135, wherein the mRNA encodes a nuclease.

137. The use or method according to any one of claims 131 to 136, wherein the mRNA encodes a Cas nuclease.

138. The use or method according to any one of claims 131 to 137, wherein the mRNA encodes a Cas nuclease selected from the group consisting of Cas9, Cpf1, CasX, CasY, C2c1 and C2c3.

139. The use or method according to any one of claims 131 to 138, wherein the mRNA encodes a mutated Cas9 sequence.

140. The use or method according to claim 139, wherein the mutated Cas9 sequence comprises a change selected from positions D10, E762, H840, N854, N863, H983 and D986 based on SEQ ID NO:

1.

141. The use or method according to claim 139 or 140, wherein the mutated Cas9 sequence comprises a mutation selected from positions D10A, E762A, H840A, N863A, H983A and D986A based on SEQ ID NO:

1.

142. The use or method according to any one of claims 131-141, wherein the mRNA encodes a nickase.

143. The use or method according to any one of claims 131-142, wherein the mRNA encodes a nuclear localization signal (NLS).

144. The use or method according to claim 143, wherein the NLS comprises a signal according to one of SEQ ID NOs: 3-6.

145. The use or method according to any one of claims 110, 114, 115-120, 124 and 131-144, wherein the active agent comprises a guide polynucleotide.

146. The use or method according to any one of claims 110, 114, 115-120, 124 and 131-145, wherein the guide polynucleotide is a guide RNA.

147. The use or method according to claim 145 or 146, wherein the polynucleotide comprises a spacer sequence.

148. The use or method according to any one of claims 145 to 147, wherein the guide polynucleotide comprises a tracr sequence.

149. The use or method according to claim 147 or 148, wherein the spacer sequence corresponds to the protospacer sequence on the PCSK9 gene.

150. The use or method according to claim 149, wherein the protospacer sequence has at least 80% sequence identity with: CAGGTTCCATGGGATGCTCT(SEQ ID NO:104), GGCTGATGAGGCCGCACATG (SEQ ID NO: 105), CCCATACCTTGGAGCAACGG(SEQ ID NO:106), or CCCGCACCTTGGCGCAGCGG (SEQ ID NO: 110).

151. The use or method according to any one of claims 145-150, wherein the guide polynucleotide comprises a polynucleotide sequence having at least 80% sequence identity to the nucleotide sequence of one of SEQ ID NOs: 121-125.

152. The use or method according to claim 147 or 148, wherein the spacer sequence corresponds to the protospacer sequence on the ANGPTL3 gene.

153. The use or method according to claim 152, wherein the protospacer sequence has at least 80% sequence identity to GAGATACCTGAGTAACTTTC (SEQ ID NO: 111).

154. The use or method according to any one of claims 145-148, 152 and 153, wherein the polynucleotide comprises a polynucleotide sequence having at least 80% sequence identity to SEQ ID NO:

126.

155. The use or method according to any one of claims 110, 114, 115-120 and 124, wherein the active agent comprises mRNA encoding a gene editor and a guide polynucleotide.

156. The use or method according to claim 155, wherein the gene editor achieves gene editing in a sequence located at a splice site of a target gene.

157. A formulation comprising nanoparticles, wherein the nanoparticles comprise GalNAc-conjugated lipids and a gene editing system, and wherein the gene editing system comprises mRNA and guide RNA.

158. A formulation according to claim 157, wherein the nanoparticles further comprise the following excipients: (i) ionizable amino lipids, (ii) PEG-lipids, (iii) cholesterol, and (iv) phospholipids.

159. A formulation according to claim 158, wherein the ionizable amino lipids comprise 1 mol% to 65 mol% of the total lipids present in the nanoparticles.

160. A formulation according to claim 158, wherein the ionizable amino lipid comprises 10 mol% to 60 mol% of the total lipid present in the nanoparticle.

161. A formulation according to claim 158, wherein the ionizable amino lipids comprise 40 mol% to 65 mol% of the total lipids present in the nanoparticles.

162. A formulation according to claim 158, wherein the ionizable amino lipids comprise 50±15 mol% of the total lipids present in the nanoparticles.

163. A formulation according to claim 158, wherein the ionizable amino lipids constitute 50±10 mol% of the total lipids present in the nanoparticles.

164. A formulation according to claim 158, wherein the ionizable amino lipids comprise 50±5 mol% of the total lipids present in the nanoparticles.

165. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid comprises 0.1 mol% to 10 mol% of the total lipid present in the nanoparticle.

166. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid comprises 0.1 mol% to 6 mol% of the total lipid present in the nanoparticle.

167. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid comprises 0.5 mol% to 5 mol% of the total lipid present in the nanoparticle.

168. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid constitutes 3±1 mol% of the total lipid present in the nanoparticle.

169. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid constitutes 3±0.5 mol% of the total lipid present in the nanoparticle.

170. A formulation according to any one of claims 158 to 164, wherein the PEG-lipid constitutes 3±0.3 mol% of the total lipid present in the nanoparticle.

171. A formulation according to any one of claims 158 to 170, wherein the cholesterol comprises 20 mol% to 50 mol% of the total lipids present in the nanoparticles.

172. A formulation according to any one of claims 158 to 170, wherein the cholesterol comprises 38±10 mol% of the total lipids present in the nanoparticles.

173. A formulation according to any one of claims 158 to 170, wherein the cholesterol comprises 38±5 mol% of the total lipids present in the nanoparticles.

174. A formulation according to any one of claims 158 to 170, wherein the cholesterol comprises 38±2 mol% of the total lipids present in the nanoparticles.

175. A formulation according to any one of claims 158 to 174, wherein the phospholipids comprise 1 mol% to 20 mol% of the total lipids present in the nanoparticles.

176. A formulation according to any one of claims 158 to 174, wherein the phospholipids comprise 5 mol% to 15 mol% of the total lipids present in the nanoparticles.

177. A formulation according to any one of claims 158 to 174, wherein the phospholipids comprise 8 mol% to 12 mol% of the total lipids present in the nanoparticles.

178. A formulation according to any one of claims 158 to 174, wherein the phospholipids constitute 9±3 mol% of the total lipids present in the nanoparticles.

179. A formulation according to any one of claims 158 to 174, wherein the phospholipids constitute 9±2 mol% of the total lipids present in the nanoparticles.

180. A formulation according to any one of claims 158 to 174, wherein the phospholipids constitute 9±1 mol% of the total lipids present in the nanoparticles.

181. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids comprise 0.001 mol% to 20 mol% of the total lipids present in the nanoparticles.

182. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids comprise 0.002 mol% to 5 mol% of the total lipids present in the nanoparticles.

183. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipid comprises 0.005 mol% to 1 mol% of the total lipid present in the nanoparticle.

184. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids comprise 0.01 mol% to 0.1 mol% of the total lipids present in the nanoparticles.

185. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids account for 0.05±0.15 mol% of the total lipids present in the nanoparticles.

186. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids account for 0.05±0.1 mol% of the total lipids present in the nanoparticles.

187. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids account for 0.05±0.05 mol% of the total lipids present in the nanoparticles.

188. A formulation according to any one of claims 158 to 180, wherein the GalNAc-conjugated lipids account for 0.05±0.01 mol% of the total lipids present in the nanoparticles.

189. A formulation according to any one of claims 158-188, wherein the ionizable amino lipid comprises: or any combination thereof; The PEG-lipid comprises: or any combination thereof; The phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dimyristoylphosphatidylcholine (DMPC), or any combination thereof; and The GalNAc-lipid comprises: wherein p and q are 2, and n is 33-39 or any combination thereof.

190. A formulation according to any one of claims 158-188, wherein the ionizable amino lipid comprises: or any combination thereof; The PEG-lipid comprises: or any combination thereof; The phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dimyristoylphosphatidylcholine (DMPC), or any combination thereof; and The GalNAc-lipid comprises: where p and q are 2, and n is 34, Where p and q are 2, and n is 35, or any combination thereof.

191. A formulation according to any one of claims 157 to 189, wherein the mRNA encodes a Cas9 nickase, a Cas9 nuclease or a base editor.

192. The formulation of any one of claims 157 to 191, wherein the gRNA comprises a single guide RNA comprising (i) a tracr region comprising a binding backbone and (ii) a spacer corresponding to a protospacer on a gene.

193. A preparation according to claim 192, wherein the gene is PCSK9.

194. A formulation according to claim 193, wherein the gRNA comprises a sequence having at least 85% sequence identity with one of GA055, GA010, GA255-GA257, GA292 and GA097.

195. A formulation according to claim 193, wherein the gRNA comprises a sequence having at least 95% sequence identity to one of GA055, GA010, GA255-GA257, GA292 and GA097.

196. A formulation according to claim 192 or 193, wherein the spacer comprises a sequence having at least 85% sequence identity with: csasgsGUUCCAUGGGAUGCUCU (nucleotides 1-20 of SEQ ID NO: 121); gsgscsUGAUGAGGCCGCACAUG (nucleotides 1-20 of SEQ ID NO: 122); cscscsAUACCUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 123); cscscsAUACUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 124); or cscscsGCACCUUGGCGCAGCGG (nucleotides 1-20 of SEQ ID NO: 125).

197. The formulation of claim 192 or 193, wherein the spacer comprises a sequence having at least 95% sequence identity to: csasgsGUUCCAUGGGAUGCUCU (nucleotides 1-20 of SEQ ID NO: 121); gsgscsUGAUGAGGCCGCACAUG (nucleotides 1-20 of SEQ ID NO: 122); cscscsAUACCUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 123); cscscsAUACUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 124); or cscscsGCACCUUGGCGCAGCGG (nucleotides 1-20 of SEQ ID NO: 125).

198. The formulation according to claim 192, wherein the gene is ANGPTL3.

199. A formulation according to claim 198, wherein the gRNA comprises a sequence having at least 85% sequence identity with one of GA258-GA260.

200. A formulation according to claim 198, wherein the gRNA comprises a sequence having at least 95% sequence identity with one of GA258-GA260.

201. The formulation of claim 198, wherein the spacer comprises a sequence having at least 85% sequence identity to gsasgsAUACCUGAGUAACUUUC (nucleotides 1-20 of SEQ ID NO: 126).

202. The formulation of claim 198, wherein the spacer comprises a sequence having at least 95% sequence identity to gsasgsAUACCUGAGUAACUUUC (nucleotides 1-20 of SEQ ID NO: 126).

203. The agent of claim 192, wherein the tracr region comprises a nucleotide base sequence, wherein the nucleotide base sequence has at least 85% sequence identity to a functional portion of the nucleotide base sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (a nucleotide base sequence of nucleotides 21-80 of SEQ ID NO: 121, 122, 123, 124, 125 or 126), wherein the capital A, G and C represent adenine, guanine and cytosine, respectively, and wherein the capital U represents uracil or thymine.

204. The agent of claim 192, wherein the tracr region comprises a nucleotide base sequence, wherein the nucleotide base sequence has at least 95% sequence identity to a functional portion of the nucleotide base sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (a nucleotide base sequence of nucleotides 21-80 of SEQ ID NO: 121, 122, 123, 124, 125 or 126), wherein the capital A, G and C represent adenine, guanine and cytosine, respectively, and wherein the capital U represents uracil or thymine.

205. The formulation of claim 192, wherein the tracr region has at least 85% sequence identity to the following chemically modified sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUsususu (nucleotides 21-100 of GA292), GUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCGUUAUCAacuugaaaaaguggcaccgagucggugcusususu (nucleotides 21-100 of GA010), gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggCUaGUCcGUUAucAAcuuGaaaaaguGgcaccgAgUCggugcusususu (nucleotides 21-100 of GA255 or GA259), gUUUUAGagcuagaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuugaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA055, GA256, GA259, or GA097), and gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuuGaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA257 or GA260) Wherein 1) uppercase A, U, G and C represent adenine, uracil, guanine and cytosine, respectively; 2) lowercase a, u, g and c represent 2'-O-methyl modified adenine, uracil, guanine and cytosine, respectively, and 3) lowercase s represents a phosphorothioate (PS) bond.

206. The formulation of claim 192, wherein the tracr region has at least 95% sequence identity to the following chemically modified sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUsususu (nucleotides 21-100 of GA292), GUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCGUUAUCAacuugaaaaaguggcaccgagucggugcusususu (nucleotides 21-100 of GA010), gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggCUaGUCcGUUAucAAcuuGaaaaaguGgcaccgAgUCggugcusususu (nucleotides 21-100 of GA255 or GA259), gUUUUAGagcuagaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuugaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA055, GA256, GA259, or GA097), and gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuuGaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA257 or GA260) Wherein 1) uppercase A, U, G and C represent adenine, uracil, guanine and cytosine, respectively; 2) lowercase a, u, g and c represent 2'-O-methyl modified adenine, uracil, guanine and cytosine, respectively, and 3) lowercase s represents a phosphorothioate (PS) bond.

207. The formulation according to any one of claims 157 to 206, wherein the formulation is formulated for administration to a patient via intravenous infusion.

208. A formulation according to any one of claims 157 to 207, wherein the nanoparticles have an average diameter of 30 to 150 nm.

209. A formulation according to any one of claims 157 to 207, wherein the average diameter of the nanoparticles is 65±30 nm.

210. A formulation according to any one of claims 157 to 207, wherein the average diameter of the nanoparticles is 65±20 nm.

211. A formulation according to any one of claims 157 to 207, wherein the average diameter of the nanoparticles is 65±15 nm.

212. A formulation according to any one of claims 157 to 211, wherein the polydispersity index (PDI) of the nanoparticles is no higher than 0.

2.

213. A formulation according to any one of claims 157 to 212, wherein the nanoparticles have RNA encapsulation equal to or greater than 85%.

214. A formulation according to any one of claims 157 to 212, wherein the nanoparticles have RNA encapsulation equal to or greater than 90%.

215. A formulation according to any one of claims 157 to 212, wherein the nanoparticles have RNA encapsulation equal to or greater than 95%.

216. A formulation according to any one of claims 157-215, wherein the mRNA and gRNA are in the same nanoparticle.

217. Use of a formulation according to any one of claims 157-216 in the preparation of a medicament for treating a disease or condition in a subject.

218. Use of a formulation according to any one of claims 157-216 in the preparation of a medicament for treating a disease or condition in a subject, wherein the formulation comprises nanoparticles, wherein the nanoparticles comprise GalNAc-conjugated lipids and a gene editing system, and wherein the gene editing system comprises mRNA, guide RNA, or both.

219. Use according to claim 218, wherein the disease or condition is heterozygous familial hypercholesterolemia (HeFH).

220. Use according to claim 218, wherein the disease or condition is homozygous familial hypercholesterolemia (HoFH).

221. The use according to claim 218, wherein the disease or condition is clinical atherosclerotic cardiovascular disease (ASCVD).

222. The use according to claim 218, wherein the disease or condition is low density lipoprotein receptor (LDLR) deficient.

223. Use according to claim 218, wherein the disease or condition is coronary artery disease.

224. The use according to claim 218, wherein the subject is in need of lowering low-density lipoprotein cholesterol (LDL-C).

225. Use of a formulation according to any one of claims 157-216 in the preparation of a medicament for in vivo gene editing in a subject, wherein the formulation comprises nanoparticles, wherein the nanoparticles comprise GalNAc-conjugated lipids and a gene editing system, and wherein the gene editing system comprises mRNA, guide RNA, or both.

226. Use of a formulation according to any one of claims 157-216 in the preparation of a medicament for reducing the risk of coronary artery disease in a subject in need thereof.

227. Use of a formulation according to any one of claims 157-216 in the preparation of a medicament for reducing the risk of coronary artery disease in a subject in need thereof, wherein the formulation comprises nanoparticles, wherein the nanoparticles comprise GalNAc-conjugated lipids and a gene editing system, and wherein the gene editing system comprises mRNA, guide RNA, or both.

228. The use according to any one of claims 217-227, wherein the nanoparticles further comprise the following excipients: (i) ionizable amino lipids, (ii) PEG-lipids, (iii) cholesterol, and (iv) phospholipids.

229. Use according to claim 228, wherein the ionizable amino lipids constitute 1 mol% to 65 mol% of the total lipids present in the nanoparticles.

230. Use according to claim 228, wherein the ionizable amino lipids constitute 10 mol% to 60 mol% of the total lipids present in the nanoparticles.

231. The use according to claim 228, wherein the ionizable amino lipids comprise 40 mol% to 65 mol% of the total lipids present in the nanoparticles.

232. Use according to claim 228, wherein the ionizable amino lipids constitute 50±15 mol% of the total lipids present in the nanoparticles.

233. Use according to claim 228, wherein the ionizable amino lipids constitute 50±10 mol% of the total lipids present in the nanoparticles.

234. Use according to claim 228, wherein the ionizable amino lipids constitute 50±5 mol% of the total lipids present in the nanoparticles.

235. Use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 0.1 mol% to 10 mol% of the total lipid present in the nanoparticle.

236. Use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 0.1 mol% to 6 mol% of the total lipid present in the nanoparticle.

237. Use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 0.5 mol% to 5 mol% of the total lipid present in the nanoparticle.

238. Use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 3±1 mol% of the total lipid present in the nanoparticle.

239. Use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 3±0.5 mol% of the total lipid present in the nanoparticle.

240. The use according to any one of claims 228 to 234, wherein the PEG-lipid constitutes 3±0.3 mol% of the total lipid present in the nanoparticle.

241. The use according to any one of claims 228 to 240, wherein the cholesterol constitutes 20 mol% to 50 mol% of the total lipids present in the nanoparticle.

242. Use according to any one of claims 228 to 240, wherein the cholesterol constitutes 38±10 mol% of the total lipids present in the nanoparticles.

243. Use according to any one of claims 228 to 240, wherein the cholesterol constitutes 38±5 mol% of the total lipids present in the nanoparticles.

244. Use according to any one of claims 228 to 240, wherein the cholesterol represents 38±2 mol% of the total lipids present in the nanoparticles.

245. Use according to any one of claims 228 to 244, wherein the phospholipids represent 1 mol% to 20 mol% of the total lipids present in the nanoparticles.

246. Use according to any one of claims 228 to 244, wherein the phospholipids represent 5 mol% to 15 mol% of the total lipids present in the nanoparticles.

247. Use according to any one of claims 228 to 244, wherein the phospholipids represent 8 mol% to 12 mol% of the total lipids present in the nanoparticles.

248. Use according to any one of claims 228 to 244, wherein the phospholipids represent 9±3 mol% of the total lipids present in the nanoparticles.

249. Use according to any one of claims 228 to 244, wherein the phospholipids represent 9±2 mol% of the total lipids present in the nanoparticles.

250. Use according to any one of claims 228 to 244, wherein the phospholipids represent 9±1 mol% of the total lipids present in the nanoparticles.

251. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.001 mol% to 20 mol% of the total lipid present in the nanoparticle.

252. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.002 mol% to 5 mol% of the total lipid present in the nanoparticle.

253. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.005 mol% to 1 mol% of the total lipid present in the nanoparticle.

254. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.01 mol% to 0.1 mol% of the total lipid present in the nanoparticle.

255. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.05±0.15 mol% of the total lipid present in the nanoparticle.

256. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.05±0.1 mol% of the total lipid present in the nanoparticle.

257. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.05±0.05 mol% of the total lipid present in the nanoparticle.

258. The use according to any one of claims 228 to 250, wherein the GalNAc-conjugated lipid accounts for 0.05±0.01 mol% of the total lipid present in the nanoparticle.

259. The use according to any one of claims 228 to 258, wherein the ionizable amino lipid comprises: or any combination thereof; The PEG-lipid comprises: or any combination thereof; The phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dimyristoylphosphatidylcholine (DMPC), or any combination thereof; and The GalNAc-lipid comprises: wherein p and q are 2, and n is 33-39 or any combination thereof.

260. The use according to any one of claims 228-259, wherein the ionizable amino lipid comprises: or any combination thereof; The PEG-lipid comprises: or any combination thereof; The phospholipids include 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), dimyristoylphosphatidylcholine (DMPC), or any combination thereof; and The GalNAc-lipid comprises: where p and q are 2, and n is 34, Where p and q are 2, and n is 35, or any combination thereof.

261. The use according to any one of claims 228 to 259, wherein the mRNA encodes a Cas9 nickase, a Cas9 nuclease or a base editor.

262. The use according to any one of claims 228 to 262, wherein the gRNA comprises a single guide RNA comprising (i) a tracr region comprising a binding backbone and (ii) a spacer corresponding to a protospacer on a gene.

263. The use according to claim 262, wherein the gene is PCSK9.

264. The use according to claim 262, wherein the gRNA comprises a sequence having at least 85% sequence identity with one of GA055, GA010, GA255-GA257, GA292 and GA097.

265. The use according to claim 262, wherein the gRNA comprises a sequence having at least 95% sequence identity with one of GA055, GA010, GA255-GA257, GA292 and GA097.

266. The use according to claim 262 or 263, wherein the spacer comprises a sequence having at least 85% sequence identity with: csasgsGUUCCAUGGGAUGCUCU (nucleotides 1-20 of SEQ ID NO: 121); gsgscsUGAUGAGGCCGCACAUG (nucleotides 1-20 of SEQ ID NO: 122); cscscsAUACCUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 123); cscscsAUACUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 124); or cscscsGCACCUUGGCGCAGCGG (nucleotides 1-20 of SEQ ID NO: 125).

267. The use according to claim 262 or 263, wherein the spacer comprises a sequence having at least 95% sequence identity with: csasgsGUUCCAUGGGAUGCUCU (nucleotides 1-20 of SEQ ID NO: 121); gsgscsUGAUGAGGCCGCACAUG (nucleotides 1-20 of SEQ ID NO: 122); cscscsAUACCUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 123); cscscsAUACUUGGAGCAACGG (nucleotides 1-20 of SEQ ID NO: 124); or cscscsGCACCUUGGCGCAGCGG (nucleotides 1-20 of SEQ ID NO: 125).

268. The use according to claim 192, wherein the gene is ANGPTL3.

269. The use according to claim 268, wherein the gRNA comprises a sequence having at least 85% sequence identity with one of GA258-GA260.

270. The use according to claim 268, wherein the gRNA comprises a sequence having at least 95% sequence identity with one of GA258-GA260.

271. The use according to claim 262, wherein the spacer comprises a sequence having at least 85% sequence identity to gsasgsAUACCUGAGUAACUUUC (nucleotides 1-20 of SEQ ID NO: 126).

272. The use according to claim 262, wherein the spacer comprises a sequence having at least 95% sequence identity to gsasgsAUACCUGAGUAACUUUC (nucleotides 1-20 of SEQ ID NO: 126).

273. The use according to claim 262, wherein the tracr region comprises a nucleotide base sequence, wherein the nucleotide base sequence has at least 85% sequence identity with a functional portion of the nucleotide base sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (nucleotide base sequence of nucleotides 21-80 of SEQ ID NO: 121, 122, 123, 124, 125 or 126), wherein the capital A, G and C represent adenine, guanine and cytosine, respectively, and wherein the capital U represents uracil or thymine.

274. The use according to claim 262, wherein the tracr region comprises a nucleotide base sequence, wherein the nucleotide base sequence has at least 95% sequence identity with a functional portion of the nucleotide base sequence of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (a nucleotide base sequence of nucleotides 21-80 of SEQ ID NO: 121, 122, 123, 124, 125 or 126), wherein the capital A, G and C represent adenine, guanine and cytosine, respectively, and wherein the capital U represents uracil or thymine.

275. The use according to claim 262, wherein the tracr region has at least 85% sequence identity to the following chemically modified sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUsususu (nucleotides 21-100 of GA292), GUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCG UUAUCAacuugaaaaaguggcaccgagucggugcusususu (nucleotides 21-100 of GA010), gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggCUaGUCcGUUAucAAcuuGaaaaaguGgcaccgAgUCggugcusususu (nucleotides 21-100 of GA255 or GA258), gUUUUAGagcuagaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuugaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA055, GA256, GA259, or GA097), and gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuuGaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA257 or GA260) Wherein 1) uppercase A, U, G and C represent adenine, uracil, guanine and cytosine, respectively; 2) lowercase a, u, g and c represent 2'-O-methyl modified adenine, uracil, guanine and cytosine, respectively, and 3) lowercase s represents a phosphorothioate (PS) bond.

276. The use according to claim 262, wherein the tracr region has at least 95% sequence identity to the following chemically modified sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUsususu (nucleotides 21-100 of GA292), GUUUUAGAgcuagaaauagcAAGUUAAAAUAAGGCUAGUCCGUUAUCAacuugaaaaaguggcaccgagucggugcusususu (nucleotides 21-100 of GA010), gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggCUaGUCcGUUAucAAcuuGaaaaaguGgcaccgAgUCggugcusususu (nucleotides 21-100 of GA255 or GA258), gUUUUAGagcuagaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuugaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA055, GA256, GA259, or GA097), and gUUUUAGagcuaGaaauagcaaGUUaAaAuAaggcuaGUccGUUAucAAcuuGaaaaagugGcaccgagucggugcusususu (nucleotides 21-100 of GA257 or GA260) Wherein 1) uppercase A, U, G and C represent adenine, uracil, guanine and cytosine, respectively; 2) lowercase a, u, g and c represent 2'-O-methyl modified adenine, uracil, guanine and cytosine, respectively, and 3) lowercase s represents a phosphorothioate (PS) bond.

277. The use according to any one of claims 217 to 276, wherein the average diameter of the nanoparticles is 30 to 150 nm.

278. The use according to any one of claims 217 to 276, wherein the average diameter of the nanoparticles is 65±30 nm.

279. The use according to any one of claims 217 to 276, wherein the average diameter of the nanoparticles is 65±20 nm.

280. The use according to any one of claims 217 to 276, wherein the average diameter of the nanoparticles is 65±15 nm.

281. The use according to any one of claims 217 to 280, wherein the polydispersity index (PDI) of the nanoparticles is no higher than 0.

2.

282. The use according to any one of claims 217 to 281, wherein the nanoparticles have an RNA encapsulation equal to or higher than 85%.

283. The use according to any one of claims 217 to 281, wherein the nanoparticles have an RNA encapsulation equal to or higher than 90%.

284. The use according to any one of claims 217 to 281, wherein the nanoparticles have RNA encapsulation equal to or higher than 95%.

285. The use according to any one of claims 217 to 284, wherein the mRNA and gRNA are in the same nanoparticle.

286. The use according to any one of claims 217 to 284, wherein the mRNA and gRNA are in different nanoparticles.

287. A formulation comprising a compound selected from the following formula: wherein each X is independently H or a protecting group, and W represents an active agent or a conjugated sequence; wherein each X is independently H or a protecting group, Z is a modified or unmodified C5 or C6 monosaccharide, and W represents an active agent or a conjugated sequence; wherein each X is independently H or a protecting group, Z is a modified or unmodified C5 or C6 monosaccharide, and W represents an active agent or a conjugated sequence; Wherein each X is independently H or a protecting group, R A is -OX or -NHAc, Y is O or S, and W represents an active agent or a conjugated sequence; in, Multiple A groups together comprise a receptor targeting ligand; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 Each of which is independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 is substituted or unsubstituted -(CH2CH2O) n -, or substituted or unsubstituted -(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R comprises or is a lipid, a nucleic acid, an amino acid, a protein, or a lipid nanoparticle; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200; as well as in, A is the receptor targeting moiety; L 1 , L 2 , L 3 , L 4 , L 5 , L 6 , L 7 , L 8 , L 9 , L 10 and L 12 are each independently substituted or unsubstituted C1-C 12 Alkylene, substituted or unsubstituted C1-C 12 Heteroalkylene, substituted or unsubstituted C2-C 12 Alkenylene, substituted or unsubstituted C2-C 12 Alkynylidene, -(CH2CH2O) m -、-(OCH2CH2) m -, -O-, -S-, -S(=O)-, -S(=O)2-, -S(=O)(=N(R 1 ))-、-C(=O)-、-C(=N-OR 1 )-, -C(=O)O-, -OC(=O)-, -C(=O)C(=O)-, -C(=O)N(R 1 )-、-N(R 1 )C(=O)-、-OC(=O)N(R 1 )-、-N(R 1 )C(=O)O-、-N(R 1 )C(=O)N(R 1 )-、-C(=O)N(R 1 )C(=O)-、-S(=O)2N(R 1 )-、-N(R 1 )S(=O)2-、-N(R 1 )-OR-N(OR 1 )-; L 11 -(CH2CH2O) n -or-(OCH2CH2) n -; Each R 1 are independently H, or substituted or unsubstituted C1-C6 alkyl; R is a lipophilic organic residue; m is an integer selected from 1 to 10; and n is an integer selected from 1 to 200.

288. A formulation according to claim 287, wherein the formulation is a lipid nanoparticle formulation.

289. A compound having the structure of formula (I), (II), (III), (IV), (V) or (VI) or a salt thereof.

Images