Saccharomyces cerevisiae and application thereof in fermentation production of ethanol

Abstract

The invention relates to the technical field of microorganisms, in particular to a saccharomyces cerevisiae strain and application thereof in fermentation production of ethanol. The saccharomyces cerevisiae strain is resistant to low temperature, high sugar, ethanol and low in pH, a sugar solution with the fermentation concentration larger than 300 g / L is fermented at the temperature of 10-22 DEG C, the high fermentation alcohol content can be achieved in a shorter time, the fermentation speed is high, the fermentation period is short, the residual sugar content is lower, and the problem that in an existing alcohol fermentation technology, high-concentration sugar water is fermented at the low temperature, and the fermentation time is short is effectively solved. The fermentation speed is slow, the fermentation efficiency is low, and the production cost is high.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to a strain of brewer's yeast and application thereof in ethanol fermentation. Background Art

[0002] Blended alcoholic beverages are made by mixing or reprocessing fermented alcoholic beverages, distilled alcoholic beverages, edible alcoholic beverages, etc., with edible raw materials and auxiliary materials added. They are low in alcohol content and have a variety of tastes, making them very popular among young consumers. In recent years, the market size has shown a steady growth trend, and the global blended alcoholic beverage market will be worth billions of dollars by 2025. In order to achieve the coordination and stability of the taste, blended alcoholic beverages often require fragrant and clean distilled alcoholic beverages to bring out the characteristics of the added flavoring materials, so as to achieve the purpose of blending multiple flavors into one and in harmony. Compared with fruit wine, wine, beer, and even milk wine, alcohol fermented with sugar water is more suitable as the base wine for blended alcoholic beverages directly, because it has a pure flavor and no foreign fragrance, and it is not easy to destroy the unique flavor and style of the blended alcoholic beverage or produce unpleasant feelings.

[0003] However, in the current technology of preparing alcohol from sugar water, the European and Russian markets need to ferment alcohol at low temperature (fermentation temperature <22°C) due to climatic reasons. In the existing technology of fermenting alcohol from sugar water at low temperature, the concentration of sugar water is generally around 150g / L~290g / L. When the fermentation temperature is less than 22°C, the fermentation time is often greater than 72h. Therefore, the existing technology generally has the problems of low fermentation sugar concentration, long fermentation time, incomplete fermentation in a short time, low fermentation alcohol content (generally 14~16%), high residual sugar, low production efficiency, and long production time, which greatly increases production costs. Therefore, it is urgent to provide a yeast strain that can quickly ferment high-concentration sugar water to produce high alcohol content under low temperature conditions to improve production efficiency. Summary of the invention

[0004] In view of this, the present invention provides a strain of brewer's yeast and its application in the production of ethanol by fermentation. The strain is resistant to low temperature, high sugar and low pH, can ferment a sugar solution with a concentration greater than 300g / L under the condition of 10℃-22℃, can reach a higher fermentation alcohol content in a shorter time, has the advantages of fast fermentation speed, short cycle and low residual sugar, and solves the problems of too slow fermentation speed, low fermentation efficiency, long fermentation cycle and high cost in the prior art of producing alcohol by low-temperature fermentation of high-concentration sugar water.

[0005] The present invention provides a Saccharomyces cerevisiae strain MP-8, which is isolated from a certain wine lees and has been deposited in the China Center for Type Culture Collection on June 14, 2024, with a strain deposit number of CCTCC NO: M20241232. Its ITS rDNA sequence is shown in SEQ ID NO: 1.

[0006] Experiments have shown that the strain MP-8 is resistant to low temperature, high sugar, ethanol and low pH. Using this strain to ferment high-concentration sugar solutions to produce alcohol has a fast fermentation speed, a short fermentation cycle, a high fermentation alcohol content and a low production cost.

[0007] The present invention also provides a microbial fermentation agent, including at least one of the saccharomyces cerevisiae strain MP-8 or its culture, metabolites, exosomes, and fermentation products.

[0008] The present invention has no particular limitation on the form of the microbial fermentation agent, and any common form in the art may be used, such as solid preparations, liquid preparations, semi-solid preparations, etc. In a specific embodiment of the present invention, the microbial fermentation agent is a solid preparation, i.e., dry yeast of Saccharomyces cerevisiae strain MP-8.

[0009] The present invention also provides the use of the brewer's yeast strain MP-8 or the microbial fermentation agent in fermenting and producing ethanol or improving the alcohol content of wine products.

[0010] The present invention also provides a method for producing ethanol by fermentation, comprising: adding MP-8 or the microbial fermentation agent to a high-sugar solution and fermenting.

[0011] In the method of the present invention, the mass volume ratio of the dry weight of the brewer's yeast strain or the microbial fermentation agent to the high sugar solution is 0.1% to 2% g / ml, preferably 0.5% to 1%, specifically 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, or 1.0%.

[0012] In the method of the present invention, the fermentation is a high-sugar fermentation; the sugar concentration of the high sugar is less than 400 g / L, including but not limited to this concentration. In some specific embodiments of the present invention, the sugar concentration of the high sugar is 300-360 g / L, specifically 300 g / L, 310 g / L, 320 g / L, 330 g / L, 340 g / L, 350 g / L, 360 g / L.

[0013] Furthermore, the fermentation is a low-temperature fermentation, and the low temperature is 10-38°C, preferably 10-22°C, specifically 10°C, 11°C, 12°C, 13°C, 14°C, 15°C, 16°C, 17°C, 18°C, 19°C, 20°C, 21°C, and 22°C.

[0014] Furthermore, the fermentation time is ≤120h, preferably 48h-120h, specifically 48h, 60h, 72h, 84h, 96h, 108h, 120h.

[0015] In the method of the present invention, the aqueous sugar solution also includes urea and a fermentation promoter.

[0016] In some embodiments, the concentration of urea in the sugar solution is 1g / L-5g / L, specifically 1g / L, 1.5g / L, 2g / L, 2.5g / L (i.e., 2.5‰), 3g / L, 3.5g / L, 4g / L, 4.5g / L, 5g / L. In the present invention, the concentration of the fermentation promoter is 0.2-0.8g / L, specifically 0.2g / L, 0.3g / L, 0.4g / L, 0.5g / L, 0.6g / L, 0.7g / L, 0.8g / L. The present invention has no particular restrictions on the specific types of fermentation promoters, and any common fermentation promoter used in the field for ethanol production can be used; in a specific embodiment of the present invention, the fermentation promoter is NutrienFast, an Angel Yeast nutritional product.

[0017] The brewer's yeast strain MP-8 provided by the present invention can ferment a sugar solution with a concentration greater than 300 g / L under the condition of 10° C.-22° C., can reach a higher fermentation alcohol content in a shorter time, has a faster fermentation speed, a shorter cycle, and lower residual sugar, thereby solving the problems of slow fermentation speed, low fermentation efficiency, and high production cost in the existing alcohol fermentation technology when fermenting high-concentration sugar water at low temperature, and is suitable for industrial fermentation production of various wine products.

[0018] Biological Deposit Description

[0019] Saccharomyces cerevisiae MP-8 was deposited in the China Center for Type Culture Collection on June 14, 2024, at Wuhan University, Wuhan, China, with the deposit number being CCTCC NO:M20241232. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 1. The process flow chart of the preparation of dry yeast is shown;

[0021] Figure 2 The process flow chart of producing alcohol by fermentation of the present invention is shown. DETAILED DESCRIPTION

[0022] The present invention provides a strain of brewer's yeast and its application in fermentation production of ethanol. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0023] The Saccharomyces cerevisiae strain MP-8 provided by the present invention has been deposited in the China Center for Type Culture Collection on June 14, 2024, and the strain deposit number is CCTCC NO: M20241232. Its ITS rDNA sequence is shown in SEQ ID NO: 1.

[0024] The sequence of SEQ ID NO: 1 is as follows:

[0025] TTTTGAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTAC

[0026] TGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAG

[0027] TGCGCGGTCGTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGT

[0028] GAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACA

[0029] ACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGA

[0030] GCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATCTATTCATTA

[0031] AATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTA

[0032] AAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCA

[0033] GCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAAT

[0034] CTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTG

[0035] AGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTT

[0036] GGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAA

[0037] GAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTTAG

[0038] GTTTTACCAACTGCGGCTAATCTTTTTTTATACTGAGCGTATTGGAACGTT

[0039] ATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACC

[0040] TCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGA

[0041] GGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGC

[0042] AAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTG

[0043] GAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGA

[0044] CGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTA

[0045] AAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGT

[0046] GGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACA

[0047] AGTACAGTGATGGAAGAAAGAATGAAAAGAACTTTGAAAAGAGAGTGAAAAA

[0048] GTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACACATGGTGTTT

[0049] TGTGCCCTCTGCTCCTTGTGGGTAGGGGAATTCCGATTTCACTGGGCCA

[0050] GCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGG

[0051] TAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCG

[0052] ACGTAAGTCAAGGA.

[0053] Another object of the present invention is to provide the use of the above-mentioned strain in the production of ethanol (or alcohol) by fermentation.

[0054] The present invention also provides a method for producing ethanol by fermentation using the strain MP-8 of the present invention, comprising: adding MP-8 or the microbial fermentation agent to a high-sugar solution for fermentation. The method specifically comprises the following steps:

[0055] Step 1: prepare a sugar solution with high sugar concentration, add 2.5‰ (w / v) urea and fermentation promoter;

[0056] Step 2: Add a certain amount of dry yeast made from strain MP-8 and stir thoroughly to dissolve the dry yeast completely;

[0057] Step 3: Place it in an incubator at a certain temperature, stir it two to three times a day, measure the specific gravity and sugar content every 24 hours, and measure the fermentation alcohol content after 72 hours of fermentation.

[0058] In the first step, the sugar solution is selected from sucrose or glucose, and the fermentable sugar concentration is less than 400 g / L, preferably 320 g / L-360 g / L.

[0059] In the second step, the amount of yeast added is 0.1%-2% based on the mass volume content of dry weight to fermentation liquid volume, and preferably the amount of yeast added is 0.5%-1%.

[0060] In the third step, the fermentation temperature is 10°C-38°C, preferably 15-22°C, and the fermentation time is within 120 hours, preferably 72 hours.

[0061] The present invention does not impose any particular restrictions on the method for preparing dry yeast from strain MP-8, and any common method in the art may be used. Figure 1 Made by the process shown.

[0062] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0063] The present invention will be further described below in conjunction with embodiments:

[0064] Example 1

[0065] Several yeast strains were isolated from soil samples of natural wine cellars in Yibin, Sichuan, and then screened for ethanol resistance and high sugar tolerance. Finally, a yeast strain that can tolerate 30% sucrose and 10%-15% ethanol was selected. This strain was used to study the production of alcohol by low-temperature fermentation of high-concentration sugar water. It was found that the strain had a fast fermentation speed and strong alcohol production ability. It was identified as a brewer's yeast strain by molecular biology and named MP-8.

[0066] The specific separation and purification method is as follows: take 0.5g of the koji block, add sterile water in accordance with the solid-liquid ratio of 1:100, 1:1000, 1:10000 in turn for dilution, take 50μL of the dilution solution of different concentrations, and spread it on the solid culture medium (sucrose 8%, yeast extract 2%, magnesium sulfate 0.1%, potassium dihydrogen phosphate 0.1%, agar powder 2%, add 50μg / ml ampicillin) with a coating rod, and culture it in a 30℃ incubator for 1-3 days, pick a number of milky white, large and thick, smooth, moist, and sticky single colonies, and culture them on the solid culture medium by streaking, repeating 2 times, and obtain several pure strains of yeast. After the initial screening of ethanol resistance and high sugar resistance domestication, a strain with strong tolerance was selected, and the study of alcohol production by low-temperature fermentation of high-concentration sugar water found that its fermentation performance was outstanding. It was identified as a brewer's yeast strain by molecular biology and named MP-8.

[0067] The strain MP-8 of the present invention and the existing strains are used to ferment high-sugar solution at low temperature to produce alcohol. The fermentation method is shown in Figure 1 The process flow chart shown specifically includes the following steps:

[0068] Step 1: prepare a sugar solution with a high sugar concentration (300 g / L, 340 g / L, 350 g / L, 360 g / L), add 2.5‰ (w / v) urea and a fermentation promoter (Angel Nutritional Products NutrienFast, product batch number 240523061-1, 240523061-2, 240523061-3 or 240523061-4), so that the urea concentration is 2.5 g / L and the fermentation promoter concentration is 0.4 g / L;

[0069] Step 2: adding dry yeast prepared by 0.8%-1% strain (the strain of the present invention and the comparative strains 1-2, 0.1-2g dry yeast per 100ml sugar solution) to the prepared sugar solution, stirring well to dissolve the dry yeast completely;

[0070] Step 3: Place in a certain temperature incubator (purchased from Shanghai Yuejin Medical Instrument Co., Ltd.) for static culture at a temperature of 10°C, stir two to three times a day, measure specific gravity and sugar content every 24 hours, and measure fermentation alcohol content, residual sugar and specific gravity of fermentation liquid after 72 hours of fermentation. Among them, comparison strain 1 is high wine yeast with a preservation number of CCTCC NO: 2023130; comparison strain 2 comes from Angel wine yeast in the article "The effect of the addition period of fermentation nutrient NutrienFast on wine fermentation".

[0071] The sources of the above raw materials and equipment models are shown in Tables 1 to 2. The residual sugar content and specific gravity were measured using a density meter, and the fermentation alcohol content was measured as follows. The measurement results are shown in Tables 3 to 6.

[0072] Fermentation alcohol content determination method:

[0073] (1) Distillation

[0074] After the fermentation is finished, shake well, use a 100mL measuring cylinder to take 100mL of fermented mash and pour it into a 1000mL distillation flask, add 100-150mL of tap water into the distillation flask, add 2 drops of defoamer, and distill. Use a 100mL volumetric flask (add a cold water bath to control the distillate temperature below 25°C) to receive the distillate. When the distillate reaches about 95mL, stop distillation, remove it, dilute to 100mL, and shake well.

[0075] (2) Measuring alcohol content

[0076] Pour all the distillate into a clean, dry 100mL measuring cylinder, let it stand for a few minutes, wait for the bubbles in the wine to disappear, put in a clean and dry precision alcohol meter, and press it gently. After standing, observe the scale indication at the tangent point of the meniscus horizontally, and insert a thermometer to record the temperature. According to the measured temperature and the alcohol meter indication, convert it to the alcohol content at 20°C according to the "Alcohol Meter Temperature Concentration Conversion Table" shown in Appendix E of the national standard GBT20886.1-2021bz Quality Requirements for Yeast for Food Processing, and retain 1 decimal place. Repeat the test once more and take the higher value of the two times.

[0077] Table 1 Source of ingredients

[0078] Drug Name Model / Purity Distributors glucose Food Grade Sinopharm Chemical Reagents sucrose Food Grade Sinopharm Chemical Reagents Urea AR Xilong Chemical Industry Co., Ltd.

[0079] Table 2 Equipment information

[0080] Device Name Device Model Distributors Incubator HPX-Ⅱ-300 Shanghai Yuejin Medical Equipment Co., Ltd. Portable Density Meter DMA35 Anton Paar Multifunctional Ice Bath Distillation Apparatus Optima-W4 Ou Run

[0081] Table 3 Sugar content, specific gravity and fermentation alcohol content of fermentation under the conditions of initial sugar concentration of 300 g / L and culture temperature of 10°C

[0082]

[0083] Table 4 Sugar content, specific gravity and fermentation alcohol content under the conditions of initial sugar concentration of 340g / L and culture temperature of 17℃

[0084]

[0085] Table 5 Sugar content, specific gravity and fermentation alcohol content under the conditions of initial sugar concentration of 350g / L and culture temperature of 20℃

[0086]

[0087] Table 6 Sugar content, specific gravity and fermentation alcohol content under the conditions of initial sugar concentration of 360g / L and culture temperature of 21℃

[0088]

[0089]

[0090] The results showed that compared with the comparative strains 1 to 2, the initial sugar concentration was in the range of 300 g / L-360 g / L, and the fermentation temperature was in the range of 10°C-22°C. The strain of the present invention had a higher fermentation alcohol content, lower residual sugar and specific gravity at the same fermentation time of 72 hours (i.e., three days of fermentation), indicating that the strain of the present invention has the advantages of short fermentation time and high efficiency compared with the comparative strains 1 to 2.

[0091] Example 2

[0092] The difference between this fermentation method and the fermentation method of Example 1 is that the culture temperature is uniformly 20°C, the time when the fermentation of each strain ends is recorded, and the other fermentation conditions and determination methods are the same as those of Example 1. The alcohol content and residual sugar after fermentation are determined. The results are shown in Tables 7 to 9.

[0093] Table 7 Fermentation end time, alcohol content, residual sugar and specific gravity of different strains under the conditions of initial sugar concentration of 340 g / L and culture temperature of 20 °C

[0094]

[0095] The results showed that the strain of the present invention was fermented under the conditions of an initial sugar concentration of 340 g / L and a culture temperature of 20° C., and the fermentation was completed after 72 hours of culture, while the comparison strains 1 to 2 were close to the fermentation end point after 96 hours of fermentation.

[0096] Table 8 Fermentation results of different strains at an initial sugar concentration of 350 g / L and a culture temperature of 20 °C

[0097]

[0098]

[0099] As shown in Table 8, under the conditions of an initial sugar concentration of 350 g / L and a culture temperature of 20°C, the strain of the present invention fermented completely after 72 hours of culture, while the comparative strains 1 to 2 were close to the fermentation end point after 120 hours of fermentation. The fermentation end point is determined based on the specific gravity and residual sugar. Generally, the specific gravity is lower than 1.0 and the residual sugar is close to 0, which is considered to be the fermentation end point.

[0100] Table 9 Fermentation results of different strains at an initial sugar concentration of 360 g / L and a culture temperature of 20 °C

[0101]

[0102] As shown in Table 9, the fermentation of the strain of the present invention was completed after 72 hours of cultivation, while the comparative strains 1 to 2 were not completely fermented after 120 hours of fermentation.

[0103] The above results show that under the same fermentation conditions, compared with the control strains 1 to 2, the strain of the present invention has higher fermentation alcohol content, shorter fermentation time and lower residual sugar. This shows that the strain of the present invention has obvious advantages in low temperature resistance, sugar resistance and ethanol resistance, and is more suitable for low-temperature fermentation of sugar water to produce alcohol.

[0104] Example 3

[0105] The fermentation method of this embodiment differs from that of embodiment 1 in that the initial sugar concentration is 250 g / L, the culture temperature is 28° C., the pH is 3.5, and other fermentation conditions and determination methods refer to embodiment 1. The time when the fermentation of the two strains ends is recorded, and the residual sugar and alcohol content after fermentation are determined. The results are shown in the table below.

[0106] Table 10

[0107]

[0108] The above results show that under low pH conditions, compared with the control strain 1, the fermentation alcohol content of this strain is higher and the fermentation speed is faster, indicating that this strain has obvious advantages in tolerance to low pH.

[0109] Example 4

[0110] The brewer's yeast with the deposit number CCTCC M20231997 in patent CN117603826 was used as the comparison strain 3. The strain MP-8 of the present invention and the comparison strain 3 were fermented and cultured for 5 to 10 days according to the fermentation method of Example 8 in patent CN117603826. The alcohol content of the simulated grape juice with different sugar contents fermented by the strain of the present invention was determined after 5 days of fermentation. The determination method is shown in Example 1 of the present invention. The results are shown in Table 10.

[0111] Table 11

[0112]

[0113] The results showed that compared with the control strain 3, the fermentation alcohol content of the strain MP-8 of the present invention was higher, the fermentation time was shorter, the cost was lower, and it had higher economic benefits.

[0114] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Saccharomyces cerevisiae MP-8, characterized in that Its deposit number is CCTCCNO: M20241232.

2. A microbial fermentation agent, characterized in that: The method comprises at least one of the Saccharomyces cerevisiae strain or its culture, metabolites, exosomes and fermentation products as described in claim 1.

3. Use of the Saccharomyces cerevisiae strain MP-8 according to claim 1 or the microbial fermentation agent according to claim 2 in fermentation to produce ethanol or to increase the alcohol content of alcoholic products.

4. A method for producing ethanol by fermentation, characterized in that: The brewer's yeast strain according to claim 1 or the microbial fermentation agent according to claim 2 is inoculated into a high-sugar solution for fermentation.

5. The method according to claim 4, characterized in that The mass volume ratio of the dry weight of the saccharomyces cerevisiae strain or the microbial fermentation agent to the high-sugar solution is 0.1% to 2% g / ml, preferably 0.5% to 1%.

6. The method according to claim 4 or 5, characterized in that: The fermentation is a high-sugar fermentation; the sugar concentration of the high sugar is less than 400 g / L; preferably, the sugar concentration of the high sugar is 300-360 g / L.

7. The method according to any one of claims 4 to 6, characterized in that: The fermentation is low-temperature fermentation, and the temperature of the low temperature is 10-38°C.

8. The method according to claim 4, characterized in that The fermentation time is 48 to 120 hours, preferably 72 hours.

9. The method according to any one of claims 4 to 8, characterized in that: The aqueous sugar solution also includes urea and a fermentation accelerator.

10. The method according to claim 9, characterized in that In the sugar aqueous solution, the concentration of urea is 1 g / L to 5 g / L, and the concentration of the fermentation promoter is 0.2 to 0.8 g / L.

Images