Application of Aspartate Aminotransferase Gene AspAT10 in Improving Nitrogen Utilization Efficiency in Poplars
By overexpressing the aspartate aminotransferase gene AspAT10 in poplar, the nitrogen metabolism pathway was optimized, which solved the problem of improper nitrogen fertilizer use in poplar, achieved efficient growth and nitrogen utilization under nitrogen stress, and improved the growth performance and ecological health of poplar.
Patent Information
- Application Number
- CN202410897367.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-05
- Publication Date
- 2025-10-28
- Estimated Expiration
- 2044-07-05
AI Technical Summary
The lack of standardized guidance on the use of nitrogen fertilizer for poplar trees in current technology leads to insufficient or excessive fertilizer input, which affects the environment and health. At the same time, poplar trees have low growth efficiency under nitrogen stress, and it is necessary to improve nitrogen utilization through genetic modification.
An overexpression vector for the aspartate transaminase gene AspAT10 was constructed and transformed into poplar trees using Agrobacterium tumefaciens-mediated transformation to achieve overexpression of the AspAT10 gene in poplar, thereby optimizing nitrogen metabolism pathways and improving nitrogen utilization.
Under low-nitrogen and high-nitrogen environments, it can significantly improve the carbon and nitrogen content and nitrogen use efficiency of poplar trees, reduce nitrogen fertilizer input, improve the ecological environment, and enhance poplar productivity and quality.
Smart Images

Figure HDA0004929393070000011 
Figure HDA0004929393070000012 
Figure HDA0004929393070000021
Abstract
Description
Technical Field
[0001] This invention relates to the application of the aspartate transaminase gene AspAT10 in improving nitrogen use efficiency in poplar trees, and belongs to the field of forestry breeding technology. Background Technology
[0002] Poplar is a deciduous woody plant belonging to the genus *Populus* of the family Salicaceae in the class Dicotyledonous plant of the phylum Angiosperm. It is characterized by rapid growth, high yield, and strong environmental adaptability, and is widely used in ecological protection, urban greening, industry, and fiber production. Poplar is also a preferred perennial plant for bioenergy feedstock production. Furthermore, the whole genome of poplar has been sequenced; its small genome makes it easy to manipulate. Moreover, poplar has the ability to reproduce asexually and is a natural host for *Agrobacterium tumefaciens*, facilitating genetic transformation of plants using *Agrobacterium tumefaciens*-mediated transformation, and it has been used as a model plant for forest genetic engineering research. 84K poplar (*Populus alba* x *Populus glandulosa*) is a new generation of white poplar variety, characterized by easy rooting, rapid growth in seedlings and saplings, good wood quality, strong wind resistance, and wide adaptability. It also exhibits strong stress tolerance and has significant application value in vegetation restoration, soil erosion prevention, and saline-alkali land remediation.
[0003] Poplar trees' rapid growth makes them highly demanding of soil nutrients. When planting poplar trees in nutrient-poor, arid, or sandy soils where water and fertilizer balance is difficult to maintain, timely fertilization is necessary to ensure their survival rate. Among various nutrient supplements, nitrogen fertilizer has a significant impact on poplar growth and development. Within a certain nitrogen concentration range, applying nitrogen is beneficial for increasing poplar biomass and photosynthetic rate. However, the use of nitrogen fertilizer in my country has long lacked standardized guidance. Whether to apply nitrogen fertilizer and the amount used are usually determined by farmers' subjective will. This leads to problems such as insufficient or excessive fertilizer application, mismatch between fertilizer input and plant needs, and ecological damage and land degradation caused by fertilizer production and runoff. In addition, some nitrogen fertilizer may be released into the air to form pollutants such as ammonia, or leak into drinking water, affecting human health. Controlling fertilizer input or conducting genetic improvement breeding are currently the main means to solve the fertilizer utilization problems faced by poplar forests. Previous studies have found that overexpression of the ammonium transporter gene PtrAMT1 in Populus tomentosa affects the activity of nitrogen metabolism-related enzymes, as well as the content of soluble proteins and soluble sugars; overexpression of glutamine synthase GS1 promotes efficient nitrogen utilization and plant growth. This indicates that nitrogen metabolism in poplar can be enhanced through gene-level modification, thereby improving its growth, development, and stress resistance. However, nitrogen metabolism in plants is influenced by a variety of factors, involving numerous genes with diverse functions. Current research in forest tree genetics and breeding has only explored a small number of genes in depth, and the functions of many more genes remain to be discovered, especially those related to the regulation of plant nitrogen metabolism. Research on their regulatory functions and mechanisms is particularly important. Optimizing nitrogen metabolism pathways to promote efficient growth of poplar under nitrogen stress (low and high nitrogen) environments is expected to improve nitrogen use efficiency, reduce the adverse environmental impacts of nitrogen fertilizer input, enhance poplar productivity and quality, and improve the health and balance of the ecosystem.
[0004] Aspartate aminotransferase (AspAT; EC 2.6.1.1), also known as glutamic-oxaloacetic transaminase (GOT), is widely found in plants, microorganisms, and animals. It is a 5'-pyridoxal (PLP)-dependent aminotransferase. Under the catalysis of AspAT, aspartate (Asp) and α-ketoglutarate (2-OG) are reversibly converted into glutamate (Glu) and oxaloacetic acid (OAA). In plants, AspAT not only participates in important metabolic regulation, such as the tricarboxylic acid cycle, amino acid catabolism, linking carbon and nitrogen metabolism, redox reactions, and the TOR pathway, but also participates in various stress responses. Under abiotic stress, nitrogen nutrient status affects the transcriptional accumulation of AspAT in crops and the AspAT enzyme activity in different cellular components. Nitrogen-free and high-nitrogen treatments significantly upregulate the expression of mitochondrial ZmAspAT1.3 and plastid ZmAspAT / PAT. (RA, et al. 2009). Furthermore, plant hormone signals may crosstalk with nitrogen signals, which can also significantly affect the transcriptional level of AspAT. Exogenous jasmonic acid treatment of *Populus nigra* significantly induced the expression of aspartate transaminase (AAT2)-like AspAT (BABST BA, et al. 2009). Exogenous GABA treatment of *Arabidopsis thaliana* under low carbon conditions had a strong inducing effect on AtASP2 in *Arabidopsis thaliana* (ALBERT B, et al. 2014). In addition, under drought stress, Northern Blot analysis revealed a decrease in the abundance of PvAspAT-2 in soybean root nodules (SILVENTE S, et al. 2003), while under salt and drought stress, the transcriptional level of AspAT3 in *Arabidopsis thaliana* increased after 10–24 h (SEKI M, et al. 2002). In biotic stress experiments, transgenic Arabidopsis thaliana overexpressing AspAT2 exhibited more lesions upon infection with Botrytiscinerea, and the transcript of this gene increased during infection (BRAUC S, et al. 2011). Silencing PsAAT3 in Phytophthora soybean reduced the pathogenicity of soybean plants and affected growth under nitrogen starvation conditions, indicating that PsAAT3 is involved in pathogenicity and nitrogen utilization during infection (WANG R, et al. 2016). Bioinformatics analysis of AspAT gene expression patterns revealed differential expression of different AspAT-encoded genes under stress (BRAUC S, et al. 2011). PlantCARE analysis of the upstream 1.5kb cis-acting element sequences of 10 isoenzyme genes in the poplar AspAT family revealed multiple stress response elements, including those for low temperature, drought, hypoxia, and biotic stress (SU T, et al. 2019), suggesting that AspAT may be involved in the regulation of multiple stresses in poplar. In summary, AspAT is a key metabolic hub, interconnected with multiple metabolic pathways, including C and N metabolism, which are crucial for plant nutrition, energy, and stress responses. However, research on AspAT in plants is still relatively limited, and its biological functions and mechanisms of action require further investigation. Summary of the Invention
[0005] Purpose of the invention: The purpose of this invention is to provide an application of the aspartate transaminase gene AspAT10 in improving nitrogen utilization in poplar trees, which can increase the total carbon and nitrogen content and NUE in poplar trees under nitrogen stress.
[0006] Technical solution: This invention provides the application of the aspartate transaminase gene AspAT10 in improving nitrogen utilization in poplar trees.
[0007] This invention also provides the application of the aspartate transaminase gene AspAT10 overexpression vector in improving nitrogen utilization in poplar trees.
[0008] Furthermore, the original vector for the Aspartate transaminase gene AspAT10 overexpression vector is the pRI101 vector.
[0009] Furthermore, the nucleotide sequences of the specific primers used to construct the overexpression vector are shown in SEQ ID NO. 1-2.
[0010] Furthermore, the poplar variety is 84K poplar.
[0011] The present invention also provides a method for obtaining poplar plants with high nitrogen utilization efficiency, the method comprising incorporating the aspartate transaminase gene AspAT10 or an overexpression vector containing the gene into the poplar plant.
[0012] Further, the specific steps of the method include: transforming the overexpression vector containing the aspartate transaminase gene AspAT10 into competent Agrobacterium tumefaciens cells to obtain positive bacteria; cutting off mature and healthy leaves or stem segments of wild-type plants, making wounds, infecting them with positive bacteria, culturing until bacteria appear on the edge of the leaves or stem segments, and then performing multiple rounds of screening using a culture medium containing antibiotics; transferring the newly grown callus tissue into a differentiation medium for differentiation; after emergence, transferring the poplar seedlings to a rooting medium, and culturing for 5-10 days to obtain transgenic poplar plants with high nitrogen utilization.
[0013] The present invention also provides a method for identifying poplar plants with high nitrogen utilization efficiency obtained by the above method, and determining whether the plant contains the aspartate transaminase gene AspAT10.
[0014] Furthermore, the nucleotide sequences of the specific primers used for identification are shown in SEQ ID NO. 3-4.
[0015] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: This invention utilizes the PtAspAT10 gene of Populus tomentosa to construct an overexpression vector for this gene and transgenic poplar seedlings containing the overexpression vector. Compared with the wild type, the AspAT10 overexpression material shows significant differences in rooting time, fresh weight, root length, and plant height. Furthermore, it can significantly increase the carbon and nitrogen content and NUE in the material even under low nitrogen conditions. This demonstrates that the PtAspAT10 gene participates in the plant growth process and is an important gene related to nitrogen metabolism, with broad application prospects in crop germplasm resource improvement and genetic breeding. It provides high-quality genetic resources and a scientific basis for how to efficiently and environmentally improve the nitrogen use efficiency of poplar trees to reduce nitrogen fertilizer input and protect the ecological environment in plant breeding research. Attached Figure Description
[0016] Figure 1 Cloning and vector construction of the PtAspAT10 gene. PtAspAT10 cloning verification (A). Schematic diagram of the pRI101-PtAspAT10 plasmid (B). Verification of pRI101-PtAspAT10 plasmid transformation into E. coli DH5α (C). Quality detection of plasmid extracted from positive DH5α colonies (D). Verification of pRI101-PtAspAT10 plasmid double enzyme digestion products (E).
[0017] Validation of Agrobacterium GV3101 transformed with pRI101-PtAspAT10 plasmid (F). (Where, product: PtAspAT10 cloned with specific primers; N: no cDNA template; M: DNA Marker 1kb ladder. Ndel / BamHI digestion: pRI101-PtAspAT10 vector linearized using NdeI and BamHI double restriction sites; Control: pRI101-PtAspAT10 plasmid without restriction enzyme digestion; RB and LB: right and left boundaries of T-DNA; CaMV35S: 35S promoter of cauliflower mosaic virus (CaMV); EGFP: enhanced green fluorescent protein; NPTII: encoding Kan gene; NOS: NOS terminator; 1-8 in Figure C: 8 randomly selected E. coli DH5α colonies transformed with pRI101-PtAspAT10 plasmid; 1-2 in Figure F: 2 Agrobacterium GV3101 colonies transformed with pRI101-PtAspAT10 plasmid).
[0018] Figure 2 Different stages of PtAspAT10 overexpression of 84K transformation. Co-culture (A), screening (B), differentiation (C), seedling (D), and mature seedling (E) stages. 84K morphology under UV light (E) (F).
[0019] Figure 3 Phenotypic characteristics of OEAspAT10 and WT under nitrogen treatment. Morphology of OEAspAT10 and WT under LN(A), NN(B), and HN(C). Phenotypic diagram (D). Rooting time (E), fresh weight (F), plant height (G), and root length (H) of OEAspAT10 and WT under LN, NN, and HN. Different letters on the bar chart represent significant differences between different treatments after one-way ANOVA and Duncan's test (P≤0.05).
[0020] Figure 4The total nitrogen (A) and total carbon (B) contents, as well as NUtE (C) and NUpE (D) contents of OEAspAT10 and WT under nitrogen treatment. Different letters on the bar chart represent significant differences between different treatments after one-way ANOVA and Duncan's test (P ≤ 0.05). Detailed Implementation
[0021] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0022] Example 1: Cloning and Vector Construction of the PtAspAT10 Gene
[0023] Based on the PtAspAT10 gene sequence (GenBank accession number: PNS93336.1) from the Populus tomentosa genome database provided by NCBI, and by adding homologous arms of plasmids to the 5' ends of primers, gene-specific primers were designed (PtAspAT10 Forward: CTTCACTGTTGATACATATGGAGTCTTCTTCTGTGTTTG (SEQ ID NO.1) and PtAspAT10 Reverse: CCTTGCTCACCATGGATCCGCCAACACGGGTAACAG (SEQ ID NO.2)). These primers were then applied using Takara Bio's... Max DNA Polymerase's high-fidelity PCR amplification kit obtained full-length cDNA through PCR amplification and product purification. Results showed the purified product was 1230 bp in length, with a single, uncontaminated band, consistent with the expected size. The negative control (N) showed no band. Figure 1 A) PCR reaction system: 25 μl PrimeSTAR Max Premix (2×), 10-15 pmol primers, 100-200 ng cDNA template, add ddH2O to bring the volume to 50 μl. PCR reaction conditions: 98℃ pre-denaturation for 2 min, 98℃ for 10 sec, 55℃ for 5-15 sec, 72℃ for 15 sec for a total of 30-35 cycles. Extension at 72℃ for 5 min. The template was extracted poplar cDNA.
[0024] The pRI101 vector (V1033-G, Sinogenesci) with NdeI and BamHI double restriction sites was linearized, and the target gene (the above 1230bp PCR purified product) was ligated to the linearized pRI101 vector purified product using a seamless cloning method. Figure 1B). The ligation product was transformed into *E. coli* competent cells DH5α, and the recombinant plasmid was identified by colony PCR using Vazyme's 2×Rapid Taq Master Mix rapid PCR solution. Specific primers were selected (P35: GTGCGTCATCCTTACGTCAGT (SEQ ID NO. 3) and EGFPN3: CTGGTCGAGCTGGACGGCGA CG (SEQ ID NO. 4)). The PCR reaction system was: 10 μl 2×Rapid Taq Master Mix, 10-15 pmol primers, 0.1-10 ng template, and ddH2O added to bring the volume to 20 μl. PCR reaction conditions: 95℃ pre-denaturation for 3 min, 95℃ for 15 sec, 60℃ for 15 sec, 72℃ for 10 sec for 30-35 cycles, followed by extension at 72℃ for 5 min. PCR results ( Figure 1 C) shows that all eight colonies (1-8) produced bands after PCR, with a band size of 1412 bp, consistent with the size of the gene to be detected. The negative control (N) showed no band, confirming that all detected colonies were positive. Plasmids were extracted using a plasmid miniprep kit (DP103, Tiangen Biotech) and detected by agarose gel electrophoresis. The results ( Figure 1 D) shows that the plasmid bands are clear and the extraction purity is good. Enzyme digestion analysis using NdeI and BamHI revealed double bands of 1223bp and 11111bp on agarose gel electrophoresis. Figure 1 E), consistent with the expected size, indicating that the target gene has been recombined into the plasmid. The plasmid was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The correctly sequenced pRI101-PtAspAT10 plasmid was transformed into Agrobacterium tumefaciens GV3101 using the heat shock method. Two days later, the transformed plates showed a large number of single colonies without contamination. Two single colonies were randomly selected and PCR verification was performed using specific primers (SEQ ID NO. 3-4). The target gene band was 1412 bp (…). Figure 1 F) indicates that the recombinant plasmid has been successfully transformed into Agrobacterium GV3101.
[0025] Example 2: Construction of 84K Young cells overexpressing PtAspAT10
[0026] (1) Take out the Agrobacterium tumefaciens GV3101 glycerol bacteria prepared in Example 1 from the -80℃ freezer and spread it on a culture medium plate for activation.
[0027] (2) Pick a single colony and put it into LB liquid medium (add 50 mg / L kanamycin (Kan) and 25 mg / L rifampicin Rif), and incubate overnight in a shaker at 28°C and 220 rpm in the dark.
[0028] (3) OD 600 Collect bacterial cells when the OD value is 0.8-1.4. Resuspend the bacterial culture in resuspending medium (woody plant culture medium WPM + 20 g / L sucrose + 1 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D) + 0.1 mg / L kinetin (KT), pH 5.6) and dilute to OD. 600 The pH value is 0.6-0.8, and the sample is left to stand at room temperature for 1 hour.
[0029] (4) Select 84K tissue culture seedlings that have grown in rooting medium for one month, cut off mature and healthy leaves and stem segments, and gently make wounds with a scalpel. Soak them in the infection solution prepared in step (3) above for 10-15 minutes, shaking occasionally.
[0030] (5) Wipe the bacterial solution off the surface of the leaves and stem segments with filter paper, and spread it evenly on the co-culture medium (WPM + 20 g / L sucrose + 100 μM acetylsalicylic acid (AS), pH 6.0). Figure 2 A) Incubate in the dark for 2-3 days until bacteria appear on the edges of leaves and stem segments.
[0031] (6) Cut the leaves into 2-4cm pieces 2 The cells were placed on selection medium (WPM + 20 g / L sucrose + 1 mg / L 2,4-D + 0.1 mg / L KT + 300 mg / L termethin (Tim) + 10 mg / L Kan, pH 6.0) and cultured in the dark for about 14 days until callus growth occurred. Figure 2 B) Cut off the callus along the leaf edge and transfer it to a new selection medium. Subculture once every 4-5 days until callus with a diameter of about 0.5 cm grows. This stage takes about 30 days.
[0032] (7) Transfer callus tissue to differentiation medium (WPM + 20 g / L sucrose + 0.5 mg / L 6-benzylaminopurine (6-BA) + 0.1 mg / L naphthaleneacetic acid (NAA) + 300 mg / L Tim + 10 mg / L Kan, pH 6.0), and subculture every 14 days. During this period, the callus will turn green (or red) and harden ( Figure 2 C).
[0033] (8) After the small buds have grown to 1-2cm ( Figure 2D) Place the seedlings in rooting medium (1 / 2 MS + 10 g / L sucrose + 200 mg / L Tim + 10 mg / L Kan, pH 6.0) and root in about one week. After obtaining seedlings, terminal buds can be cut and placed in rooting medium for subculture, or stem segments can be cut and placed in differentiation medium (MS + 25 g / L sucrose + 0.1 mg / L 6-BA + 0.1 mg / L NAA + 200 mg / L Tim + 10 mg / L Kan, pH 6.0) for differentiation to ensure sufficient transgenic material. The seedlings obtained at this time are 84K poplar OEAspAT10 overexpressing PtAspAT10.
[0034] Under normal conditions, there is no significant difference in phenotype between OEAspAT10 and WT (wild-type 84K poplar), making them indistinguishable. Figure 2 E). Under ultraviolet light, the WT plant on the right appears entirely red due to the red fluorescence emitted by chlorophyll, while the OEAspAT10 plant, carrying the GFP gene, exhibits a distinct green fluorescence under ultraviolet light. Figure 2 F). This method was used to initially screen out positive plants that overexpressed the transgene.
[0035] Nitrogen stress treatment was applied to plants overexpressing 384K Populus PtAspAT10.
[0036] Nitrogen-containing rooting medium was prepared as follows: Nitrogen-free MS powder was mixed with 10 g / L sucrose, followed by different concentrations of nitrogen. Water was added to bring the volume to 1 L, and the pH was adjusted to 5.9-6.0. 8 g / L agar was added, and the mixture was autoclaved and then evenly poured into culture flasks. One-month-old OEAspAT10 positive seedlings and WT seedlings were selected from the rooting medium, and their terminal buds were cut and inserted into rooting media with different nitrogen concentrations. Three nitrogen treatment gradients were established: LN (0.25 mM KNO3 + 0.25 mM NH4Cl), NN (1 mM KNO3 + 1 mM NH4Cl), and HN (5 mM KNO3 + 5 mM NH4Cl), with 16 h light (25℃) / 8 h darkness (20℃) incubation. One OEAspAT10 seedling (T4) and one WT seedling were inserted into each culture flask to observe phenotypic differences. At least 6 plants were used for each treatment level, and the entire experiment was repeated 3 times. Results are as follows: Figure 3 As shown in AC, OEAspAT10 leaves appear light pink and stem segments green under fluorescence, while WT leaves and stem segments are both red, indicating normal AspAT10 expression in the transgenic plants. A comparison of rooting times between WT and OEAspAT10 plants revealed that OEAspAT10 rooted in 5-6 days, generally 7 days earlier than WT. Figure 3 E). Based on a comprehensive observation of the overall plant morphology and root length, at 10 days, the roots of OEAspAT10 appeared green under ultraviolet light. In NN ( Figure 3B) The root length and plant height of OEAspAT10 are not significantly different from those of WT. However, in LN ( Figure 3 A) and HN( Figure 3 Under condition C), the root length of OEAspAT10 was significantly greater than that of WT. At 22 days, compared to WT, the fresh weight of OEAspAT10 increased by 20.54%, 4.59%, and 15.31% under the three nitrogen concentrations; the root length increased by 188.24%, 40.17%, and 91.23%; and the plant height increased by 45.20%, 9.59%, and 15.32%, respectively. Figure 3 EG). The above results demonstrate that the fresh weight, root length, and plant height of OEAspAT10 are significantly higher than those of WT under the same nitrogen concentration, especially under LN and HN conditions, the difference between OEAspAT10 and WT is even greater.
[0037] Example 4: Effect of nitrogen treatment on the carbon and nitrogen content of OEAspAT10
[0038] To investigate the effects of the PtAspAT10 gene on nitrogen status and nitrogen use efficiency (NUE) in 84K plants under different nitrogen concentrations, we measured the total carbon and total nitrogen contents of OEAspAT10 and WT (culture process as in Example 3, testing seedlings after 22 days of culture), and calculated the nitrogen uptake efficiency (NUpE) and nitrogen conversion efficiency (NUtE). (NUpE = total nitrogen in plants / nitrogen supply, NUtE = dry weight of plants / nitrogen supply).
[0039] result( Figure 4 The results show that the total carbon and total nitrogen content of 84K increases with increasing nitrogen concentration at different nitrogen concentrations. At the same nitrogen concentration, the total carbon content of OEAspAT10(T4) increased by 22.15%, 8.52%, and 13.79% compared to WT, while the total nitrogen content increased by 16.57%, 20.38%, and 16.93%, respectively. Overall, the total carbon and total nitrogen content of OEAspAT10 are greater than those of WT. Compared to WT at the same nitrogen concentration, the NUpE of OEAspAT10 increased by 84.06%, 51.27%, and 87.62%, respectively, while the NUtE increased by 34.49%, 6.98%, and 32.66%, respectively.
Claims
1. Aspartate transaminase gene AspAT10 Its application in improving nitrogen utilization efficiency in poplar trees is characterized by, The aspartate transaminase gene AspAT10 The GenBank login number is PNS93336.
1.
2. Aspartate transaminase gene AspAT10 The application of overexpression vectors in improving nitrogen use efficiency in poplar trees is characterized by, The aspartate transaminase gene AspAT10 The GenBank login number is PNS93336.
1.
3. The application according to claim 2, characterized in that, The original vector for the Aspartate transaminase gene AspAT10 overexpression vector was the pRI101 vector.
4. The application according to claim 2, characterized in that, The nucleotide sequences of the specific primers used to construct the overexpression vector are shown in SEQ ID NO.1~2.
5. The application according to any one of claims 1 or 2, characterized in that, The poplar variety mentioned is 84K poplar.
6. A method for obtaining poplar plants with high nitrogen utilization efficiency, characterized in that, The method involves overexpressing the aspartate transaminase gene in poplar plants. AspAT10 The aspartate transaminase gene AspAT10 The GenBank login number is PNS93336.
1.
7. The method according to claim 6, characterized in that, The specific steps of the method include: [the process involves] containing the aspartate transaminase gene... AspAT10 The overexpression vector was transformed into competent Agrobacterium tumefaciens cells to obtain positive bacteria. Mature and healthy leaves or stem segments of wild-type plants were cut off, wounds were made, and positive bacteria were used to infect the plants. The plants were cultured until bacteria appeared on the edges of the leaves or stem segments. Then, multiple rounds of screening were carried out using a culture medium containing antibiotics. The newly grown callus tissue was transferred to a differentiation medium for differentiation. After emergence, the poplar seedlings were transferred to a rooting medium and cultured for 5-10 days to obtain transgenic poplar plants with high nitrogen utilization.
Citation Information
Patent Citations
Auxin response factor gene for regulating and controlling adventitious root development of poplar and application thereof
CN104975029A
Construction method of agrobacterium rhizogenes mediated transgenic poplar and application of construction method
CN111621518A