5 'UTR sequences and uses thereof

Abstract

The invention belongs to the field of biological medicine, and particularly relates to a 5 'UTR sequence and application thereof. The technical problem to be solved by the invention is to improve the expression efficiency of mRNA drugs. According to the main technical scheme, four 5 'UTR sequences are provided, namely SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4; and a nucleic acid molecule comprising the 5 'UTR sequence. Compared with a 5 'UTR sequence optimized in the nature, the mRNA constructed by the 5' UTR has the advantages that the expression efficiency of a target gene is obviously improved; the preparation method is beneficial to reducing the administration dosage and administration frequency of the mRNA drug, reducing the cost of the mRNA drug and reducing the risk of adverse reaction after administration, and has a good application prospect in the industrial production of the mRNA drug.

Description

Technical Field

[0001] The invention belongs to the field of biomedicine and relates to a 5'UTR sequence and application thereof in preparing mRNA drugs. Background Art

[0002] In recent years, messenger RNA (mRNA) has attracted more and more attention from scientific research institutions as a new drug entity. In contrast to DNA-based gene therapy, mRNA generally does not have to be transported to the cell nucleus, but can be directly translated into protein in the cytoplasm. This makes mRNA safer in avoiding potential insertion mutations. As a result, mRNA therapy has gradually become a promising alternative for protein and peptide supplementation therapy for infectious diseases and various indications. mRNA drugs have a short R&D cycle and are easy to scale up. They can meet the needs of drug development and production in emergency situations. They have unique advantages and great application potential, and deserve further optimization research.

[0003] UTR (untranslated region) is a segment of the mRNA molecule, which is upstream of the start codon and downstream of the stop codon of the mRNA. It is a sequence that is not translated and does not encode protein, but has a translational regulatory function and is involved in regulating the stability and intracellular localization of mRNA. The UTR upstream of the start codon of the mRNA is called the 5'UTR.

[0004] mRNA generally has strong immunogenicity and limited stability, which affects its clinical applicability. Therefore, the stability of mRNA and the translation efficiency of mRNA are the focus of attention in this field, which largely determine two important parameters in clinical medication, the dosage and dosing interval of mRNA drugs. At present, the prior art discloses that some strategies are proven to be possible in both increasing stability and reducing the immune response triggered by mRNA administered to cells or organisms. For example, the use of chemically modified nucleotides; such as replacing only 25% of the uridine residues and cytidine residues with 2-thiouridine and 5-methyl-cytidine is sufficient to increase the stability of mRNA and reduce the activation of innate immunity triggered by mRNA administered externally in vitro.

[0005] The mRNA translation initiation process consists of recruiting ribosomes and scanning the start codon. Once the start codon is found, translation will continue. The 43S pre-translation initiation complex is composed of the 40S small subunit, eIF3, eIF1, eIF1A, eIF5, eIF2-GTP-met-tRNA. The eukaryotic translation initiation factor eIF4F is a protein complex that mediates the process of recruiting ribosomes to mRNA, including recognizing the cap structure (eIF4E), unwinding the 5'UTR secondary structure (eIF4A), bridging the ribosome and mRNA (eIF4G), interacting with PABP to cyclize mRNA from head to tail (eIF4G), and increasing the helicase activity of eIF4A (eIF4B). The binding of the 43S pre-translation initiation complex PIC (43S pre-initiation complex) and the eIF4F initiation factor complex is the main limiting factor for translation initiation. In addition to various factors inside and outside the cell that affect the translation initiation rate by controlling the activity of eIF4F, the secondary structure of the mRNA 5'UTR affects the ribosome recruitment process and the scanning process of the start codon. The secondary structure of mRNA has a significant effect on translation efficiency, especially near the start codon, because more stable RNA secondary structures require more energy to unfold before translation starts. The 5'UTR of some mRNAs contains a 12nt-long (CGG)4, forming a G-quadruplex (RG4) structure. The RG4 structure is the most stable structure of RNA currently confirmed. Existing evidence at the cellular level shows that RG4 will hinder the scanning of ribosomes and hinder the progress of translation.

[0006] Although some methods for increasing the stability of mRNA, reducing the immune response triggered by mRNA administered to cells or organisms, and improving expression efficiency (i.e., transcription and / or translation efficiency) have been disclosed in the prior art, since expression efficiency is a key parameter for the envisioned medical application, it determines, for example, the dosage and dosing interval of mRNA drugs, and ultimately determines the bioavailability of the end product (i.e., the encoded peptide or protein), and at the same time, improving expression efficiency can also further reduce the cost of producing mRNA drugs and increase the yield of produced mRNA molecules. Therefore, there is still a need for additional or alternative methods to improve expression efficiency. Summary of the invention

[0007] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. Therefore, the present invention provides a 5'UTR sequence, a nucleic acid molecule, a corresponding vector thereof, and a pharmaceutical composition comprising the nucleic acid molecule and the vector, which can be used for the prevention and treatment of diseases.

[0008] The first aspect of the present invention provides four 5'UTR sequences, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; wherein,

[0009] The specific sequence of SEQ ID NO: 1 is as follows:

[0010] SEQ ID NO: 1:

[0011] GGCAAATAATAGAAATAATAATTATTAACACAATTAAACACAACGTAACC;

[0012] The specific sequence of SEQ ID NO:2 is as follows:

[0013] SEQ ID NO: 2:

[0014] GACTGAACAATTCAAACATTACAAACATTACTAACAAACCACTAATCATC;

[0015] The specific sequence of SEQ ID NO:3 is as follows:

[0016] SEQ ID NO: 3:

[0017] GGATAATAACGGAAAATAATAGAAGTGATAACTATTAAACTTAATAAGAAG;

[0018] The specific sequence of SEQ ID NO:4 is as follows:

[0019] SEQ ID NO: 4:

[0020] CCGGGAATTTGTTGTAGTGAGTTTTGTTTAAGAGTTTGATAGTAAGAGTT.

[0021] Another aspect of the present invention provides a nucleic acid molecule comprising a 5'UTR sequence of one or more of the above SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4;

[0022] Further, the nucleic acid molecule comprises one or more 5'UTR sequences having more than 80% homology with the above SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and having the same or similar functions;

[0023] Furthermore, the nucleic acid molecule comprises one or more 5'UTR sequences that have more than 84% homology with the above 5'UTR sequence and have the same or similar functions.

[0024] Furthermore, the nucleic acid molecule contains one or more 5'UTR sequences that have more than 88% homology with the above 5'UTR sequence and have the same or similar functions.

[0025] Furthermore, the nucleic acid molecule contains one or more 5'UTR sequences that have more than 92% homology with the above 5'UTR sequence and have the same or similar functions.

[0026] Furthermore, the nucleic acid molecule contains one or more 5'UTR sequences that have more than 94% homology with the above 5'UTR sequence and have the same or similar functions.

[0027] Furthermore, the nucleic acid molecule contains one or more 5'UTR sequences that have more than 96% homology with the above 5'UTR sequence and have the same or similar functions.

[0028] Furthermore, the nucleic acid molecule contains one or more 5'UTR sequences that have more than 98% homology with the above 5'UTR sequence and have the same or similar functions.

[0029] Furthermore, the same or similar function is to enhance the stability of nucleic acid molecules and / or promote the expression of target genes in nucleic acid molecules.

[0030] Furthermore, the promoting the expression of the target gene in the nucleic acid molecule is promoting the transcription and / or translation of the target gene.

[0031] Furthermore, the nucleic acid molecule further comprises at least one of a promoter, a 3' non-coding region element (3'UTR element), a polyadenylation signal (PAS), and a polyadenylic acid tail (polyA);

[0032] Further, the promoter is T7 promoter, T3 promoter or SP6 promoter;

[0033] Further, the nucleic acid molecule is composed of a promoter, a 5' non-coding region element, an open reading frame, a 3' non-coding region element and a polyA connection;

[0034] Further, the 5' end of the nucleic acid molecule includes a start codon;

[0035] Furthermore, the nucleic acid molecule further comprises a signal peptide coding region at its 5' end;

[0036] In another aspect of the present invention, the present invention also provides the use of one or more 5'UTR sequences of the above-mentioned SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 sequences in promoting the expression of target genes;

[0037] Furthermore, the promoting the expression of the target gene is promoting the transcription and / or translation of the open reading frame of the target gene;

[0038] In another aspect of the present invention, the present invention also provides a vector containing the above-mentioned nucleic acid molecule;

[0039] Furthermore, the vector comprises at least one selected from a plasmid vector, an adenovirus vector, a lentivirus vector and an adeno-associated virus vector.

[0040] Further, in a specific embodiment of the present invention, the vector is a plasmid vector;

[0041] In another aspect of the present invention, the present invention further provides an mRNA; the mRNA or its template DNA contains one or more 5'UTR sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4;

[0042] Wherein, the target gene coding region in the open reading frame of the mRNA also contains a signal peptide coding region.

[0043] Wherein, the mRNA further contains a 3' untranslated region and / or a polyA sequence.

[0044] Furthermore, in the mRNA, the target gene coding region encodes an active protein and / or an active polypeptide.

[0045] Furthermore, the active protein is an antigen protein, and the active polypeptide is an antigen peptide.

[0046] In another aspect of the present invention, the present invention also provides a pharmaceutical composition; the pharmaceutical composition comprises at least one of the above-mentioned nucleic acid molecule, the above-mentioned vector, or the above-mentioned mRNA;

[0047] Wherein, the pharmaceutical composition further comprises one or more pharmaceutical carriers, diluents and / or excipients and / or one or more adjuvants;

[0048] In another aspect of the present invention, the present invention also provides a use of at least one of the above-mentioned 5'UTR sequence, the above-mentioned nucleic acid molecule, the above-mentioned vector, the above-mentioned mRNA or the above-mentioned pharmaceutical composition in the preparation of a preventive or therapeutic drug;

[0049] Furthermore, the preventive or therapeutic drug is a novel coronavirus vaccine drug;

[0050] The beneficial effect of the present invention is that: through a large amount of creative work, the present invention designs and screens four 5'UTR sequences, which can be connected to an open reading frame (ORF) to effectively improve the expression efficiency of the gene.

[0051] According to the embodiments of the present invention, compared with the 5'UTR sequence optimized in nature, the expression efficiency of the target gene is significantly improved by the mRNA constructed by the 5'UTR of the present invention, which is beneficial to reduce the dosage and frequency of administration of the mRNA drug.

[0052] The results of the examples of the present invention show that the four 5'UTRs of the present invention can effectively improve the expression efficiency of the target gene in the open reading frame (ORF), increase the expression amount of the target protein, and have good application prospects in vector construction and nucleic acid drug preparation.

[0053] In a specific embodiment, the mRNA drug containing the 5'UTR sequence of the present invention improves the expression efficiency, so it can help reduce the dosage of the mRNA drug and increase the dosing interval, thereby improving the bioavailability of the mRNA translation product. At the same time, it can also reduce the cost of producing mRNA drugs and increase the output of mRNA drugs, and has a good application prospect in the industrial production of mRNA drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 The plasmid map and mRNA integrity detection map of the 5'UTR sequence of the present invention in Example 1; wherein (A) is a plasmid map containing the 5'UTR sequence, and (B) is an eGFP-mRNA integrity detection map containing the 5'UTR;

[0055] Figure 2 Results of cell transfection of eGFP-mRNA of the 5'UTR of the present invention and correlation diagram with MRL: (A) linear correlation diagram between MRL of mRNA and fluorescence intensity; (B) transfection rate of HEK293T;

[0056] Figure 3 This is a bar graph of the COVID-19 mRNA vaccine particle size data prepared by the 5'UTR of the present invention;

[0057] Figure 4 This is a bar graph of the particle size potential data of the COVID-19 mRNA vaccine prepared by the 5'UTR of the present invention;

[0058] Figure 5Antibody titers of the COVID-19 mRNA vaccine prepared for the 5'UTR of the present invention: (A) immunization scheme; (B) antibody titer against the Delta variant; (C) antibody titer against the Omicron variant;

[0059] Figure 6 The expression level of the S protein in cells of the mRNA vaccine containing the new coronavirus S protein prepared by the 5'UTR of the present invention: (A) DC2.4 cells; (B) HEK293T cells;

[0060] Figure 7 The mRNA content graph of the COVID-19 mRNA vaccine prepared by the 5'UTR of the present invention, wherein (A) is the mRNA content graph of DC2.4 cells; (B) is the mRNA content graph of HEK293T cells;

[0061] Figure 8 The safety test results of the COVID-19 mRNA vaccine prepared by the 5'UTR of the present invention are shown in Figure 1; wherein (A) is the blood biochemical data; and (B) is the tissue section diagram. DETAILED DESCRIPTION

[0062] The implementation of the technical solution of the present invention is described in detail below through specific implementation methods.

[0063] In order to solve the technical problem of the present invention and improve the expression efficiency of mRNA, the m1Ψ-modified mRNA was translated and compared through the previous relevant research on the influence of 5'UTR on gene expression efficiency and a large amount of literature research and analysis, combined with computer-assisted technology, and optimized to obtain the above-mentioned SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, which have significantly improved the expression efficiency of the target gene.

[0064] During the optimization design process, computer-aided technology was used to predict the MRL values ​​of the above four 5'UTRs, and the results were 7.73, 7.69, 7.54, and 6.92, respectively;

[0065] Those skilled in the art know that the above sequences can be mutated by substitution, deletion and / or insertion, but can still obtain sequences with the same or similar functions.

[0066] Specifically:

[0067] By mutating one or more nucleotides, a sequence having at least 80% homology with the original sequence and having the same or similar function is obtained.

[0068] By mutation of one or more nucleotides, sequences with homology of more than 84% and having the same or similar functions are obtained;

[0069] By mutation of one or more nucleotides, sequences with homology of more than 88% and having the same or similar functions are obtained;

[0070] By mutation of one or more nucleotides, sequences with homology of more than 92% and having the same or similar functions are obtained;

[0071] By mutation of one or more nucleotides, sequences with homology of more than 94% and having the same or similar functions are obtained;

[0072] By mutation of one or more nucleotides, sequences with homology of more than 96% and having the same or similar functions are obtained;

[0073] By mutating one or more nucleotides, sequences with homology of more than 98% and the same or similar functions are obtained.

[0074] In a specific embodiment of the present invention, the mutation of the plurality of nucleotides is performed, and the number of mutated nucleotides is no more than 10; for example, it can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.

[0075] The mutation may be in the form of substitution, deletion and / or insertion mutation. As long as the nucleic acid molecule obtained by mutation can be used as a 5' non-translated region element and an open reading frame element to express the target gene, it is within the protection scope of the present invention.

[0076] In a specific embodiment of the present invention, the above-mentioned nucleic acid molecule of the present invention can be used to construct an expression vector to improve the expression efficiency of the expression vector. It is constructed between the promoter and the start codon in the expression frame of the expression vector. The coding region in the expression frame usually starts with the start codon at its 5' end and ends with the stop codon. Generally, the start codon is ATG (corresponding to AUG at the RNA level), and the stop codon is TAA, TAG or TGA (corresponding to UAA, UAG, or UGA at the RNA level). In addition to encoding proteins, a part of the coding region can be used as a regulatory sequence in the current mRNA. The target gene coding region encoding a polypeptide or protein used according to the present invention can also be called a coding sequence or CDS, which is composed of exons and encodes a polypeptide or protein. The two sides of the coding region in the mRNA are 5' untranslated regions (5'UTR) and 3' untranslated regions (3'UTR), which are also parts of exons. Moreover, the mRNA molecule may further include a so-called 5' cap and a polyadenylic acid tail. The 5' cap, 5' UTR, 3' UTR and poly(A) tail are all regions of the mRNA molecule that are not translated into protein or polypeptide.

[0077] "Polypeptide" and "protein" in the present invention include any kind of amino acid sequence, ie, a chain of two or more amino acids, each of which is linked by a peptide bond, and also includes fusion peptides and fusion proteins.

[0078] In addition, the nucleic acid molecule containing the 5'UTR sequence of the present invention can also be used to directly construct mRNA molecules to express target genes, especially target genes with therapeutic activity or immunostimulatory activity. In this case, the corresponding RNA is constructed before the translation start codon of the target gene of the mRNA molecule and after the 5'GAP. The above-mentioned target mRNA molecule can be directly synthesized artificially, or a template DNA can be constructed and obtained after expression through a vector.

[0079] In the above manner, the 5'UTR sequence of the present invention can be effectively used in the preparation of mRNA-related drugs. The mRNA containing the 5'UTR sequence of the present invention can be added with pharmaceutically acceptable excipients or auxiliary components to prepare mRNA drugs.

[0080] The auxiliary component can be a nanocarrier for carrying mRNA; the auxiliary material can be a commonly used injection buffer medium and a lyophilized or cryoprotectant. The nanocarrier can be a liposome, nanoparticle, microsphere, lipid nanocarrier, etc.

[0081] In some cases, the function of the target gene coding region, the encoded polypeptide / protein or its fragment is needed or beneficial in the cell or near the cell. The coding region can contain the sequence of the complete protein or its functional variant. In addition, the deoxyribonucleotide sequence of the coding region can encode a factor, inducer, regulator, stimulator or enzyme.

[0082] In some cases, the target gene coding region, the encoded polypeptide / protein or its fragment may compensate or supplement endogenous gene expression, especially in cases where the endogenous gene is defective or silent, resulting in the gene not expressing the product, the gene expression product is insufficient or defective or dysfunctional, such as a variety of metabolic and genetic diseases such as, for example, cystic fibrosis, hemophilia or muscular dystrophy. In some cases, the target gene coding region may encode a full-length antibody or a smaller antibody (e.g., a single-chain antibody) to confer immunity to the subject. Functional monoclonal antibodies or polyclonal antibodies may also be encoded, which can be used to target and / or inhibit biological targets. In other cases, the target gene coding region may encode polypeptides or proteins that can be used in genome editing technology. A variety of genome editing systems using different polypeptides or proteins are known in the art, i.e., for example, CRISPR-Cas systems, large-range nucleases, zinc finger nucleases (ZFNs) and nucleases (TALENs) based on transcription activator effectors.

[0083] In some cases, the target gene coding region, the encoded polypeptide / protein or its fragment may cause an immune response in vivo. For example, antigen presenting cells such as dendritic cells can be genetically modified so that they present antigens for vaccination purposes. Or the coding region encodes a cytokine. This may cause a tumor-specific immune response in a tumor. In addition, the DNA molecules of the present invention are transcribed and translated into mRNA and further into polypeptides or proteins, and transient genetically modified cells such as modified T-cells or precursors or stem cells or other cells for cell therapy can also be produced in vivo or ex vivo.

[0084] In conclusion, the 5'UTR sequence of the present invention and the nucleic acid molecule comprising the 5'UTR sequence can be widely used in the construction of expression vectors or mRNA molecules, and in particular, provide a new and effective option for the preparation of mRNA drugs.

[0085] The present invention is described in more detail below through the description of specific implementation modes, which should not be considered as limiting the present invention.

[0086] Although it has been reported that the untranslated region (UTR) in mRNA may play an important role in regulating both the stability of mRNA and the translation of mRNA, UTR can affect the initiation, elongation and termination of translation, and even the stability and intracellular localization of mRNA through its interaction with RNA binding proteins. However, the current research on UTR cis-regulatory elements is not thorough, and a large number of cis-regulatory elements and their functions are being discovered. In order to make up for the cognitive blind spots caused by the lack of research on cis-elements, those skilled in the art can use computational methods such as machine learning to help us rationally design efficient UTRs. However, such strategies are currently more used in UTR function research and are less commonly used in mRNA drug development.

[0087] abbreviation:

[0088] MFI mean fluorescence intensity

[0089] MRL average ribosome load

[0090] Example 1 In vitro evaluation of 5'UTR sequences

[0091] (1) The 5'UTR sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 of the present invention are used for mRNA encoding eGFP.

[0092] mRNA was transcribed in vitro using a linearized template, a 5' cap derivative and nucleoside triphosphates (m1Ψ instead of U) as raw materials with the help of T7 enzyme.

[0093] The specific operations are:

[0094] Plasmid transformation: Take the ordered plasmid powder and add sterile water to dissolve and mix thoroughly. Take out the DH5α competent E. coli from -80℃, thaw on ice, add the plasmid aqueous solution, incubate on ice for 30 minutes, place in a 42℃ metal bath for heat shock for 90s, incubate on ice for 5 minutes, and then spread the transformed competent E. coli cells on TB solid culture medium plates. After the coated plates are placed upright in a 37℃ bacterial incubator for 2 hours, invert the plates and culture for about 16 hours.

[0095] Pick up monoclonal colonies to amplify plasmids: pick up monoclonal colonies on the plate after plasmid transformation, add them to liquid TB culture medium, place the culture medium in a constant temperature shaking incubator, and culture at 37°C for 16 hours.

[0096] Plasmid extraction and purification: Use a plasmid extraction kit to extract and purify plasmids from bacterial solution. Take about 120mL of bacterial solution, use an ultra-high-speed centrifuge to centrifuge the bacterial solution at 10,000 rpm for 1 minute, discard the supernatant, and retain the bacteria. Add 8mL of solution P1 to the bacteria and use a vortex oscillator to thoroughly resuspend the bacteria. Then add 8mL of solution P2, mix gently, let stand at room temperature for 5 minutes, add 8mL of solution P4, mix gently until white flocculent solids, and let stand at room temperature for 10 minutes. Centrifuge the above bacterial solution at 10,000 rpm for 5 minutes to allow the white precipitate to adhere to the bottom and body of the bottle. Pour the supernatant carefully into filter CS1, filter, and retain the filtrate. Add 0.3 times the volume of isopropanol to the filtrate and mix it upside down. After treating the adsorption column CP6 with the equilibrium solution, take 10mL of the filtrate added with isopropanol to CP6, centrifuge at 10,000 rpm for 1 minute, discard the filtrate, and repeat the steps 1-2 times according to the volume of the filtrate. Add 10mL of rinse solution PW to the adsorption column CP6, centrifuge at 10,000 rpm for 1 minute, discard the waste liquid, and repeat once. Add 3mL of anhydrous ethanol to the adsorption column CP6, centrifuge at 10,000 rpm for 1 minute, and discard the waste liquid. Centrifuge the empty adsorption column CP6, centrifuge at 10,000 rpm for 1 minute, and discard the waste liquid. Open the cover of the adsorption column CP6, let it stand for 3 minutes, and dry the rinse solution. Place the adsorption column CP6 in a clean collection tube, add 1mL of ultrapure water to the middle part of the adsorption membrane of the adsorption column CP6, let it stand at room temperature for 5 minutes, then centrifuge at 10,000 rpm for 1 minute, and retain the filtrate. Repeat the above operation once. Transfer the eluted filtrate to a clean centrifuge tube and store it at -20℃.

[0097] Preparation and purification of transcription template: Take the plasmid aqueous solution, add 20 units of BsaI high-fidelity enzyme per microgram of plasmid, and then add 0.1 times the volume of 10× enzyme digestion buffer, mix well, and digest the plasmid for 1h. Prepare 50×TAE buffer according to Table 1 to prepare 0.8% agarose gel. Take agarose, 50×TAE buffer and ultrapure water in a conical flask, place it in a microwave to heat to melt the agarose, place it under running water to cool the agarose solution to about 55°C, pour the agarose solution into the mold and insert the comb, and wait for the agarose to cool completely. Place the agarose gel in the electrophoresis pool, prepare samples before and after enzyme digestion and load them, use 150mV voltage for electrophoresis for 10 minutes, and use a gel imaging analyzer to shoot the gel electrophoresis results. After confirming that the plasmid is completely digested by gel electrophoresis, add an equal volume of DNA extract to the digested system and vortex until milky white, centrifuge at 10,000 rpm for 2 minutes, and aspirate the supernatant into a clean EP tube to avoid aspirating the lower organic phase. Add 0.1 times the volume of 3M sodium acetate and 0.6 times the volume of isopropanol to the upper aqueous phase, and let stand at -20°C for 30 minutes. Centrifuge at 10,000 rpm for 2 minutes, discard the solution, and retain the white DNA precipitate. Prepare 70% ethanol using anhydrous ethanol and ultrapure water. Add 1 mL of 70% ethanol to the white precipitate, bounce the precipitate, centrifuge at 10,000 rpm for 2 minutes, discard the solution, retain the white precipitate, and repeat the operation once. Finally, add ultrapure water to dissolve.

[0098] Table 1: 50× TAE buffer recipe

[0099]

[0100] In vitro transcription of mRNA and purification: Take ATP, GTP, CTP, N1-methyl pseudouridine ribonucleoside triphosphate, 10× transcription buffer, CleanCap (5' cap analog), T7 transcriptase, RNase inhibitor and pyrophosphatase, add them in sequence according to the reaction system formula in Table 2, and transcribe at 37℃ for 6 hours. Add DNase and incubate at 37℃ for 1 hour to digest the transcription template. Add an equal volume of RNA extract to the transcription system solution, vortex it to milky white using a vortex machine, centrifuge it at 10,000 rpm for 1 minute, and retain the upper aqueous phase in a clean EP tube. Add 200μL of water to the lower solution, vortex it to milky white, centrifuge it at 10,000 rpm for 2 minutes, retain the upper aqueous phase, and repeat once. Add an equal volume of chloroform to the above aqueous phase and centrifuge it at 10,000 rpm for 2 minutes, and retain the upper aqueous phase. Add 5M ammonium acetate solution to the above aqueous phase, mix well, place it at -20℃ for 1 hour, centrifuge it at 10,000 rpm for 2 minutes, discard the supernatant and retain the white precipitate. Add 1 mL of 70% ethanol to the precipitate, centrifuge at 10,000 rpm for 1 minute, discard the supernatant and keep the precipitate, and repeat the operation once.

[0101] Table 2: 20 μL transcription reaction system formula

[0102]

[0103]

[0104] mRNA integrity detection:

[0105] Capillary electrophoresis was used to detect the integrity of the mRNA obtained by the above transcription, with the capillary as the separation channel and the DC high voltage power supply as the separation driving force for separation and detection. The mRNA aqueous solution was diluted to 0.5-0.2μg / μL and 10× diluent was added. The system was placed in a PCR instrument, heated at 75°C for 5 minutes, then cooled at 4°C for 10 minutes, and the mRNA integrity was detected using a Qsep1 portable biological fragment analyzer.

[0106] The results are as follows Figure 1 ; Figure 1 a is the plasmid map of 5'UTR in vitro transcribed into eGFP-mRNA, Figure 1 b is the eGFP-mRNA integrity detection diagram; Figure 1 b shows that the main peak of the obtained eGFP-mRNA is obvious, and the peak time is 3-4 minutes, indicating that the integrity of the eGFP-mRNA transcribed in vitro from the 5'UTR sequence of the present invention is excellent.

[0107] (2) The eGFP-mRNA in (1) obtained by using the 5'UTR sequences of the present invention SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 was transfected into HEK293T cells using Lipofectamine 2000, and the transfection of each group of eGFP-mRNA into cells was detected by flow cytometry.

[0108] The specific operation is as follows: HEK293T cells in logarithmic growth phase are placed in 24 wells, and 5×10 4 Cells were cultured overnight in DMEM (containing 10% FBS and 1% penicillin and streptomycin solution). 2 μL Lipofectamine2000 was incubated with 1 μg of eGFP-mRNA encoding enhanced green fluorescent protein for 30 minutes, added to the microwells, and cultured for 24 hours. The culture medium was removed and washed with PBS, the cells were digested with trypsin, washed with PBS and resuspended, and then the green fluorescence intensity was detected by flow cytometry.

[0109] The results are as follows Figure 2 , Figure 2 A is a highly linear correlation diagram between the MRL predicted by Smart5UTR and the MFI of eGFP-mRNA; Figure 2 B is the fluorescence intensity diagram of eGFP-mRNA transfected into HEK293T;

[0110] Figure 2 The experimental results showed that in HEK293T cells, the MRL predicted by Smart5UTR was highly linearly correlated with the MFI of eGFP-mRNA (R2=0.8311, Figure 2 A), indicating that the eGFP-mRNA transcribed in vitro from the 5'UTR sequence of the present invention is well expressed in vitro in HEK293T cells, and the eGFP-mRNA containing the 5'UTR sequence with a high MRL value has a higher transfection rate for HEK293T cells ( Figure 2 B).

[0111] Example 2 In vivo evaluation of COVID-19 mRNA vaccine (anti-new coronavirus nanoantibody mRNA vaccine)

[0112] (1) Preparation and characterization of anti-COVID-19 nanoantibody mRNA:

[0113] The 5'UTR sequences of the present invention SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 are used in the COVID-19 mRNA vaccine, and the dominant 5'UTRs sequence (S27a-44'5'UTR) derived from the natural genome is used as a positive control;

[0114] The spike protein (S protein) plays an important role in the process of SARS-CoV-2 invading host cells and has excellent immunogenicity, so the present invention uses the spike protein (S protein) as a COVID-19 vaccine antigen. m1Ψ-mRNA is used to encode the S protein to evaluate the 5'UTRs sequence of the present invention.

[0115] The preparation process of mRNA containing anti-new coronavirus nanoantibodies is the same as that in Example 1, except that the EGFP sequence in the plasmid is replaced with the anti-new coronavirus nanoantibody sequence.

[0116] The specific preparation steps of COVID-19 mRNA vaccine are as follows:

[0117] DMG-PEG2000, ionizable lipids, DOPE and cholesterol were prepared with a molecular weight ratio of 2.5:35:16:46.5 to prepare the oil phase. 0.1 times the volume of 100mM pH=3 citric acid buffer was added to the aqueous phase containing anti-new coronavirus nanoantibody mRNA to prepare a 0.4μg / μL mRNA solution. Using a microfluidic device, a volume ratio of 3:1 aqueous phase and oil phase was used, and the flow rate was 9mL / min. The lipid nanoparticles were prepared and loaded with mRNA through microfluidic chip mixing, dilution, and ethanol removal.

[0118] The specific characterization operation of the COVID-19 mRNA vaccine is as follows: after dialysis with 10mM pH=6 citric acid buffer, the particle size of the COVID-19 mRNA vaccine lipid nanoparticles is detected using a Malvern particle size analyzer, and the particle size potential is also detected. Figure 3 and Figure 4 As shown, the COVID-19 mRNA vaccine prepared using the 5'UTR sequence of the present invention has a particle size between 100nm and 400nm, and a potential between 2mV and 5mV, which meets the particle size requirements of vaccine lipid nanoparticles.

[0119] (2) Evaluating the efficacy of anti-COVID-19 nanoantibody mRNA vaccine in mice

[0120] The specific operations are:

[0121] On days 0 and 14, male 7-week-old BALB / c mice were intramuscularly injected with PBS and the above-mentioned COVID-19 vaccine (5μg mRNA), and mouse blood was collected on day 28. After the whole blood of the mice was allowed to stand at 4°C for 4 hours, it was centrifuged at 15,000 rpm for 30 minutes to collect the serum. 100μL of 1μg / mL SARS-CoV-2Delta or Omicron receptor binding domain recombinant protein (RBD) was added to the microwells of the ELISA plate and incubated overnight at 4°C. The microwells were washed, the microwells were blocked with a washing solution containing 5% BSA, and incubated at 25°C for 4 hours. The microwells were washed, the mouse serum was diluted 100 times and 2-fold, added to the microwells, 100μL per well, and incubated overnight at 4°C. The microwells were washed, and 100μL of 50,000-fold diluted anti-mouse IgG antibody coupled to horseradish peroxidase was added to each well and incubated at 37°C for 2 hours. The microwells were washed, TMB color development solution was added, and the cells were incubated at 37°C in the dark for 30 minutes. 2 M sulfuric acid was added to terminate the reaction.

[0122] Antibody titer was measured by ELISA ( Figure 5 A). Using the RBD of SARS-CoV-2 Delta strain (B.1.617.2) as the coating antigen, the binding antibody titers of the mRNA vaccines containing 7.73, 7.69, 7.54, and 6.92 5'UTR were 327680, 204800, 133120, and 74240, respectively; the antibody titer of the vaccine containing S27a-44'5'UTR was 2720 ( Figure 5 B).

[0123] Using the RBD of the SARS-CoV-2Omicron variant (B.1.1.529) as the coating antigen, the titers of all vaccines were reduced. The COVID-19 mRNA vaccine containing 7.73 5'UTR induced the strongest immune response, with a titer of 102400, which was much higher than the vaccine titer using S27a-44'5'UTR, 2560 ( Figure 5 C).

[0124] It shows that the in vivo immunity induced by the COVID-19 mRNA vaccine obtained by the 5'UTR sequence of the present invention is stronger than that of the mRNA vaccine using the 5'UTR of the natural genome.

[0125] (3) To verify that the improvement of the effect of COVID-19 mRNA vaccine is related to the increase of mRNA expression, the expression level of S protein was detected by quantitative enzyme-linked immunosorbent assay (ELISA). S-mRNA (mRNA containing the new coronavirus S protein) loaded in LNP was transfected into HEK293T cells and DC2.4 cells;

[0126] Specific operations:

[0127] The preparation process of mRNA containing the new coronavirus S protein is consistent with that in Example 1, except that the EGFP sequence in the plasmid is replaced with the new coronavirus S protein sequence. The preparation process of the LNP preparation containing mRNA of the new coronavirus S protein (mRNA vaccine containing the new coronavirus S protein) is consistent with that in Example 2 (1), except that the anti-new coronavirus nanoantibody mRNA in the aqueous solution is replaced with mRNA containing the new coronavirus S protein.

[0128] The novel coronavirus S protein quantitative detection kit was used to detect the expression of S protein in DC2.4 cells and HEK293T cells by double antibody sandwich method. DC2.4 cells or HEK293T cells in logarithmic growth phase were placed in 6-well plates, and 5×10 6 Cells were cultured in DMEM (containing 10% FBS and 1% penicillin / streptomycin solution), 5 μg of mRNA vaccine was added to each well, and incubated for 24 hours. The cell culture fluid was collected, centrifuged at 1200 rpm for 3 minutes, and the supernatant was retained. The diluted standard and supernatant were added to the ELISA plate coated with anti-S protein antibody and incubated at 37°C for 60 minutes. The microwells were washed, and anti-S protein antibodies coupled to horseradish peroxidase were added and incubated at 37°C for 60 minutes. The microwells were washed, the color developing solution was added, and the stop solution was added after incubation at 37°C for 10 minutes to terminate the color development reaction. The absorbance at 450nm was measured using an ELISA instrument, and a standard curve was drawn based on the concentration of the standard and its absorbance value to calculate the S protein content in the supernatant.

[0129] The results are as follows Figure 6 As shown, Figure 6 A is the expression level of S protein in DC2.4 cells; Figure 6 B is a graph showing the expression of S protein in HEK293T cells, indicating that the expression of S-mRNA containing 7.73, 7.69, 7.54 and 6.92 5'UTR of the present invention is significantly higher than that of S-mRNA containing S27a-44'5'UTR in both cells.

[0130] (4) To prove that the difference in expression of S protein (COVID-19 S protein) was due to translation efficiency, the stability of S-mRNA was detected by fluorescence quantitative PCR;

[0131] The specific operation is as follows: DC2.4 cells or HEK293T cells in logarithmic growth phase are placed in 6 wells, and 5×10 6Cells were cultured in DMEM (containing 10% FBS and 1% penicillin / streptomycin solution), and a vaccine preparation containing 5 μg of S-mRNA was added to each well and incubated for 24 hours. The culture medium was removed and washed with PBS, and trypsin was added to digest the cells. After washing the cells with PBS, the cells were lysed and total RNA was extracted using a total RNA extraction kit. A reverse transcription kit was used to reverse transcribe the RNA solution to synthesize cDNA. cDNA, S protein primers, GAPH primers, PowerUp SYBR Green Master Mix and fluorescent quantitative PCR instrument were used to amplify and detect cDNA and calculate the mRNA content.

[0132] The results are as follows Figure 7 As shown, Figure 7 A is a graph showing the mRNA content of DC2.4 cells; Figure 7 B is a graph of mRNA content in HEK293T cells, indicating that there is no significant relationship between mRNA stability and its expression level.

[0133] In summary, the difference in protein expression of mRNA is determined by translation efficiency and has nothing to do with the stability of mRNA.

[0134] Example 3 Safety evaluation of COVID-19 mRNA vaccine

[0135] In order to evaluate the safety of the COVID-19 mRNA vaccine designed using the 5UTR sequence optimized by the present invention, the blood biochemical indicators and organs of the vaccinated mice were tested.

[0136] The specific operation is: take the mice that have completed two doses under the item "Evaluation of the efficacy of mRNA vaccine in mice" in Example 2 and conduct testing.

[0137] Blood biochemical index detection

[0138] The mouse serum was collected and the blood biochemical indicators were detected using a fully automatic blood biochemical analyzer, including creatine kinase isoenzyme (CKMB), alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), serum creatinine (CRE), and urea (URE).

[0139] Tissue section preparation and evaluation

[0140] The hearts, livers, spleens, lungs, and kidneys of mice were collected, fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin-eosin. The tissues were then observed and images were collected using a Nikon Eclipse Ti2 microscope. Figure 8As shown, the serum creatine kinase isoenzyme (CKMB) level of the vaccinated mice did not increase significantly, and the heart sections showed no pathological manifestations; the liver-related blood biochemical indicators: alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP) and albumin (ALB) were all normal, and no vaccine-related liver damage was found in the liver sections; at the same time, blood creatinine (CRE) and urea (URE) were normal, and no damage was observed in the HE-stained sections of the kidney, lung and spleen. It shows that the COVID-19 mRNA vaccine obtained by using the 5'UTR of the present invention has good safety.

[0141] In summary, the eGFP-mRNA constructed by the 5'UTR sequence of the present invention is well expressed in vitro in in vitro cell transcription; the translation efficiency of mRNA can be significantly improved; the anti-new coronavirus nanoantibody mRNA constructed using the 5'UTR sequence of the present invention has a particle size between 100nm and 400nm, and a potential between 2mV and 5mV, which meets the particle size requirements of vaccine lipid nanoparticles; the COVID-19 mRNA vaccine obtained using the 5'UTR sequence of the present invention is safe and reliable, and induces mice to produce a strong immune response, and its antibody titer against SARS-CoV-2Delta and Omicron strains is significantly better than that of the vaccine using the naturally dominant 5'UTR sequence.

Claims

1. 5'UTR sequence, characterized in that: Including one or more of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4; wherein, The specific sequence of SEQ ID NO: 1 is as follows: SEQ ID NO: 1: GGCAAATAATAGAAATAATAATTATTAACACAATTAAACACAACGTAACC; The specific sequence of SEQ ID NO:2 is as follows: SEQ ID NO: 2: GACTGAACAATTCAAACATTACAAACATTACTAACAAACCACTAATCATC; The specific sequence of SEQ ID NO:3 is as follows: SEQ ID NO: 3: GGATAATAACGGAAAATAATAGAAGTGATAACTATTAAACTTAATAAGAAG; The specific sequence of SEQ ID NO:4 is as follows: SEQ ID NO: 4: CCGGGAATTTGTTGTAGTGAGTTTTGTTTAAGAGTTTGATAGTAAGAGTT.

2. A nucleic acid molecule comprising the 5'UTR sequence according to claim 1, characterized in that: The nucleic acid molecule comprises a 5'UTR sequence of one or more of the above SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:

4.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule comprises one or more 5'UTR sequences that have more than 80% homology with the sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 and have the same or similar functions.

4. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule contains one or more 5'UTR sequences that have more than 96% homology with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4 and have the same or similar functions.

5. The nucleic acid molecule according to claim 2, characterized in that: It also contains at least one of a promoter, a 3' non-coding region element (3'UTR element), a polyadenylation signal (PAS), and a polyadenylic acid tail (polyA).

6. Use of the 5'UTR sequence of claim 1 in promoting the expression of a target gene.

7. A vector comprising the nucleic acid molecule according to any one of claims 2 to 5, characterized in that: The vector comprises at least one selected from a plasmid vector, an adenovirus vector, a lentivirus vector and an adeno-associated virus vector.

8. mRNA, characterized in that: The mRNA or its template DNA contains one or more 5'UTR sequences of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 according to claim 1.

9. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises at least one of the nucleic acid molecule according to any one of claims 2 to 5, the vector according to claim 7, and the mRNA according to claim 8.

10. Use of at least one of the nucleic acid molecule according to any one of claims 2 to 5, the vector according to claim 7, the mRNA according to claim 8 or the pharmaceutical composition according to claim 9 in the preparation of a preventive or therapeutic drug.

11. The use according to claim 10, characterized in that: The preventive or therapeutic drug is a new coronavirus vaccine drug.

Images