AcMYB22, a gene that regulates the biosynthesis of flavonoids in kiwifruit, and its application.

Abstract

This invention discloses a gene, AcMYB22, that regulates the biosynthesis of flavonoids in kiwifruit and its applications, belonging to the field of genetic engineering technology. This invention clones two alleles of the AcMYB22 transcription factor, AcMYB22-1 and AcMYB22-2, from the 'Hongyang' kiwifruit and its bud mutations. Plant expression vectors of AcMYB22-1 and AcMYB22-2 were constructed, and overexpressed kiwifruit fruits and stably overexpressed kiwifruit plants were obtained using Agrobacterium-mediated transformation. The overexpressed materials showed a promotion of flavonoid and anthocyanin accumulation. This research enriches the mechanism by which MYB transcription factors regulate the biosynthesis of flavonoids in kiwifruit, provides technical support for improving plant flavonoid synthesis, and is of great significance for the quality improvement and new variety breeding of kiwifruit.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a gene AcMYB22 that regulates the biosynthesis of flavonoids in kiwifruit and its applications. Background Technology

[0002] Flavonoids are a class of low-molecular-weight polyphenolic secondary metabolites with natural antioxidant activity, participating in plant growth and development, physiological metabolism, biological and non-stress responses. Flavonoids are widely distributed natural products in plants, exhibiting extremely rich structures and varieties. It is estimated that over 10,000 types of flavonoids have been identified in plants to date. Despite their structural diversity, flavonoids all share a common flavonoid aglycone, namely the C6-C3-C6 structure, whose basic structure consists of two aromatic rings plus one heterocycle. Based on structural differences, flavonoids can be further subdivided into six main subclasses: flavones, flavonols, flavanones, flavanols, anthocyanins, and isoflavones. The flavonoid synthesis pathway has been extensively studied in model plants. It originates from the metabolism of phenylalanine and involves genes such as phenylalanine ammonia-lyase (PAL), cinnamic acid 4-hydroxylase (C4H), 4-coumaric acid:coenzyme A ligase (4CL), chalcone synthase (CHS), coumarin isomerase (CHI), flavanone 3-hydroxylase (F3H), flavonol synthase (FLS), anthocyanin synthase (ANS), anthocyanin reductase (ANR), flavonoid 3′-hydroxylase (F3′H), flavonoid 3′,5′-hydroxylase (F3′5′H), dihydroflavanol 4-reductase (DFR), and anthocyanin synthase (ANS).

[0003] In plants, several MYB transcription factors have been identified as participating in the regulation of flavonoid synthesis, with some playing a positive regulatory role and others a negative one. For example, in Arabidopsis thaliana, AtMYB4 inhibits the transcription of genes from PAL to 4CL, thereby suppressing the synthesis of flavonoids; AtMYB7 inhibits anthocyanin synthesis by negatively regulating the expression of genes encoding key enzymes DFR and UDP in the flavonoid pathway. Meanwhile, transcription factors in subgroups 5-7 of the R2R3-MYB group mostly play a positive regulatory role in the flavonoid biosynthesis pathway. The fifth subgroup of R2R3-MYB (TT2 / SG5 / PA2) is generally considered to be an activator of proanthocyanidin biosynthesis; members of the sixth subgroup, AtMYB75 / 90 / 113 / 114, positively regulate genes such as DFR, LDOX, and ANS; MdMYB10 binds to the W-box in the MdUFGT promoter, positively regulating anthocyanin accumulation; members of the seventh subgroup, such as AtMYB11, AtMYB12, and AtMYB111, mainly affect flavonol synthesis by promoting the expression of early genes such as CHS, CHI, and FLS; CsMYB12 positively regulates the FLS gene to produce flavonols.

[0004] Several MYB transcription factors have been found to regulate anthocyanin biosynthesis in kiwifruit. Transfection of AcMYB75 into Arabidopsis thaliana significantly increased anthocyanin content in leaves and substantially upregulated the expression of anthocyanin biosynthesis genes. The interaction between AcMYB10 and AcbHLH42 activates anthocyanin biosynthesis by activating the transcription of AcLDOX and AcF3GT. Overexpression of AcMYB10 positively regulates anthocyanin accumulation in 'Hongyang' tissue culture seedlings. Co-expression of AcMYB123 and AcbHLH42 activates the transcription of late-stage flavonoid synthesis genes AcF3GT1 and AcANS to produce anthocyanins. Overexpression of AcMYB110 in kiwifruit fruits and petals significantly upregulated anthocyanins in both cases. However, reports on the regulation of other flavonoid biosynthesis by MYB transcription factors are limited. Therefore, enriching the application of MYB transcription factors in regulating flavonoid biosynthesis in kiwifruit is of great significance for improving the nutritional quality of kiwifruit and breeding new varieties. Summary of the Invention

[0005] The purpose of this invention is to provide a gene AcMYB22 that regulates the biosynthesis of flavonoids in kiwifruit and its application, in order to solve the problems existing in the prior art.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] One of the technical solutions of the present invention is the application of the AcMYB22 gene or its expression vector in regulating the biosynthesis of flavonoids in plant fruits, wherein the plant includes kiwifruit.

[0008] The second technical solution of the present invention is a method for regulating the biosynthesis of flavonoids in plant fruits by overexpressing the AcMYB22 gene to promote the biosynthesis of flavonoids in plant fruits, and by silencing or knocking out the AcMYB22 gene to reduce the biosynthesis of flavonoids in plant fruits.

[0009] Based on the above technical solution, the present invention has the following technical effects:

[0010] This invention reveals that AcMYB22-1 and AcMYB22-2 can bind to and activate the AcF3H and AcUFGT promoters. AcMYB22-2 cloned in "H16" exhibits higher transcriptional activation activity towards the AcF3H and AcUFGT promoters, both of which positively promote the accumulation of flavonoids and anthocyanins. This research enriches our understanding of the mechanism by which MYB transcription factors regulate the flavonoid biosynthesis pathway in kiwifruit, and is of great significance for nutritional improvement, coloring mechanism research, and new variety breeding of kiwifruit. Attached Figure Description

[0011] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0012] Figure 1 The changes in the content of total phenols, total flavonoids, total anthocyanins, and phenolic compounds during the fruit development of 'Hongyang' and 'H-16' varieties are shown. In this table, A represents the content of total phenols, total flavonoids, and total anthocyanins during fruit development; B represents phenolic compounds during fruit development; and C represents anthocyanin components during fruit development.

[0013] Figure 2 This study measured and analyzed the expression levels of AcMYB22 during the fruit development of 'Hongyang' and 'H-16' varieties. In this study, A represents the expression levels of AcMYB22 at different growth stages of 'Hongyang' and 'H-16' fruits. B represents the correlation between the relative expression level of AcMYB22 and the contents of total phenols, total flavonoids, total anthocyanins, and anthocyanin components. The left side of the correlation analysis is for 'Hongyang', and the right side is for 'H-16'.

[0014] Figure 3 This is a comparison diagram of the amino acid sequences of AcMYB22-1 and AcMYB22-2.

[0015] Figure 4Phylogenetic analysis of AcMYB22 and sequence comparison and subcellular localization with other MYB proteins are presented. A shows the phylogenetic analysis of AcMYB22 protein with MYB proteins from other species. B shows the sequence comparison analysis of AcMYB22 with other SG7 subfamily proteins. C is a schematic diagram of the subcellular localization vector. D shows the subcellular localization results of AcMYB22. Fluorescence excitation signals were observed using confocal microscopy. All scale bars are 10 μm.

[0016] Figure 5 Transient transformation of AcMYB22-1 and AcMYB22-2 in 'Hongyang' fruit. A represents the fruit phenotype. B represents the relative expression of AcMYB22 in the injected fruit as detected by quantitative RT-PCR. C represents the colorimetric value of the injected fruit. Total phenols and total flavonoids were also included.

[0017] Figure 6 The overexpression of AcMYB22 in kiwifruit leads to changes in the content of phenolic and anthocyanin components. Here, A represents the phenolic content, and B represents the expression level of genes related to the flavonoid metabolism pathway.

[0018] Figure 7 Stable overexpression of the Chinese kiwifruit 'Hongyang' was achieved. A represents the DNA level of the AcMYB22 transgenic line. B represents the qRT-PRC of the AcMYB22 transgenic line. C represents the phenotype of the AcMYB22 overexpressing plant. D represents the content of total phenols, total flavonoids, total flavanols, and total anthocyanins in the leaves of the AcMYB22-1 and AcMYB22-2 transgenic lines. E represents the relative expression of the flavonoid synthesis structural gene in the AcMYB22-1 and AcMYB22-2 transgenic lines. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0025] The plant material used in this invention is the 'Hongyang' kiwifruit and its bud mutation line "H-6" (published in the Journal of Fruit Science, Analysis of Genetic Diversity and Identification of Variation Materials of Kiwifruit Germplasm Based on SRAP and SCoT Markers, 021, 38(12): 2059-2071). The kiwifruit fruit of "H-6" exhibits a red-fleshed, yellow-fleshed flesh color, with a larger red area than 'Hongyang' and the remaining parts being more yellow than 'Hongyang'. Experiments revealed that the flesh of kiwifruit of "H-6" contains a higher content of flavonoids, including anthocyanins and flavonoids, indicating that the AcMYB22 gene can enhance the biosynthesis of flavonoids in plants.

[0026] This invention provides the application of the AcMYB22 gene or its expression vector in regulating flavonoid biosynthesis in plant fruits, including kiwifruit.

[0027] In some specific embodiments, the AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of AcMYB22-1 is shown in SEQ ID NO.1; and the nucleotide sequence of AcMYB22-2 is shown in SEQ ID NO.2.

[0028] In some specific implementations, the flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins, and isoflavones.

[0029] This invention also provides a method for regulating the biosynthesis of flavonoids in plant fruits: overexpressing the AcMYB22 gene to promote the biosynthesis of flavonoids in plant fruits; or silencing or knocking out the AcMYB22 gene to reduce the biosynthesis of flavonoids in plant fruits.

[0030] In some specific embodiments, the AcMYB22 gene includes AcMYB22-1 and AcMYB22-2; the nucleotide sequence of AcMYB22-1 is shown in SEQ ID NO.1; and the nucleotide sequence of AcMYB22-2 is shown in SEQ ID NO.2.

[0031] In some specific implementations, the plant includes kiwifruit.

[0032] In some specific implementations, the flavonoids include flavones, flavonols, flavanones, flavanols, anthocyanins, and isoflavones.

[0033] Example 1

[0034] Molecular Characterization Analysis of 1AcMYB22

[0035] 1.1 Materials

[0036] This experiment collected materials from two kiwifruit varieties: 'Hongyang' (Actinidia chinensis var. chinensis cv. 'Hongyang') and its bud mutation 'H-16', collected in Mingshan District, Ya'an, Sichuan Province. Fruits were collected at 20, 40, 70, 100, and 120 days after flowering and stored in an ultra-low temperature freezer at -80℃. Uniformly sized, uniformly grown 'Hongyang' kiwifruit at the color-changing stage (70 days after flowering), free from pests, diseases, and mechanical damage, were used as materials for transient infection. Sterile tissue culture seedlings of 'Hongyang' preserved in the laboratory were used for stable transformation, and Nicotiana benthamiana was used for subcellular localization. All materials were cultured in a culture room at 24℃, 16h light / 8h dark, and 80% humidity.

[0037] 1.2 Kiwifruit RNA Extraction and AcMYB22 Cloning

[0038] The pulp of 'Hongyang' and 'H-16' kiwifruit varieties was ground into powder in liquid nitrogen, and total RNA was extracted from the kiwifruit tissue using an RNA extraction kit (tiangen). The concentration and purity of the extracted RNA samples were determined using a UV spectrophotometer, and the integrity of the extracted RNA was verified by 1.0% agarose gel electrophoresis. RNA samples with an A260 / A280 ratio between 1.8 and 2.0, and an A260 / A230 ratio greater than 2.0, were used to synthesize cDNA using a reverse transcription kit.

[0039] Based on the transcriptome sequencing information and expression levels of kiwifruit, the gene sequence of AcMYB22 was obtained. Primers were designed using Primer 5.0: forward primer: 5'ACAATGGGGAGAGCACCTTG, reverse primer: 3'ACACCAGTATTCCGGCTACTC. After cloning and sequencing, two AcMYB22 sequences were obtained, named AcMYB22-1 and AcMYB22-2, respectively.

[0040]

[0041]

[0042] 1.3 Subcellular localization

[0043] Specific primers were designed using Snapgene software, and the target fragment was ligated to a subcellular localization vector using homologous recombinase to obtain a subcellular localization vector containing AcMYB22. Agrobacterium competent cells were transformed using the freeze-thaw method, and the bacterial culture was verified by PCR and preserved. Bacterial culture was streaked onto YEP solid medium containing 50 mg / L Kan and 50 mg / L Rif using an inoculation loop. The culture was incubated at 28°C for 2-3 days. Single Agrobacterium cells were picked and cultured in 10 mL of YEP liquid medium containing the same antibiotics at 200 rpm / min and 28°C for 12 h with shaking. 1-2 mL of bacterial culture was added to 50 mL of YEP liquid medium containing the same antibiotics, and the culture was expanded under the same conditions. The culture was continued until the bacterial culture reached OD... 600 When the concentration is approximately 0.6, centrifuge at 5000 rpm for 1 min at room temperature, and resuspend the precipitate in the infiltration buffer (10 mmol / L LMEs + 10 mmol / L MgCl2 + 200 μmol / L LMEs) to OD. 600 ≈0.6, after standing at room temperature for 30 min, the solution was injected into leaves of normally grown tobacco Benedictine tumefaciens for 30 days using a syringe, and then cultured in the dark for 48 h. The subcellular localization results were observed using a confocal fluorescence microscopy system.

[0044] 1.4 qRT-PCR analysis of gene expression

[0045] Total RNA was extracted from fruit samples of 'Hongyang' kiwifruit and its bud mutation line 'H-6' using the CTAB method, and cDNA was prepared using the PrimeScript™ RT kit with a gDNA eraser (TaKaRa, Dalian, China). Quantitative PCR was performed on a CFX96 instrument (Bio-Rad, CA, USA) using a TB Green Premix from Taq™ II (TaKaRa, Dalian, China). Each reaction included three techniques and biological replications. Actin (Acc08081.1) was used as an internal standard as a reference gene for calculating relative gene expression.

[0046] 1.5 Construction of overexpression vector and Agrobacterium-mediated transient transformation of kiwifruit

[0047] Pbi121-AcMYB22 was obtained by fusing AcMYB22 with the pBI121 vector and then transformed into Agrobacterium GV3101. Agrobacterium with an OD value of 0.6 was injected into the fruit along the equator in four directions, resulting in 400 μL of bacterial culture. The mixture was then incubated in an incubator (80% relative humidity, 16 h / d light, 24℃) for 5-7 days. Afterward, photographs were taken, and the injected fruit pulp was cut into small pieces, flash-frozen in liquid nitrogen, and stored at -80℃ for later use.

[0048] 1.6 Agrobacterium-mediated stable transformation of kiwifruit

[0049] The strain used for stable transformation in kiwifruit was the same as that in 1.5, namely Pbi121-AcMYB22. Leaves from tissue-cultured *Actinidia chinensis* seedlings that had been pre-cultured for 3 days were inoculated with a resuspended *Agrobacterium* solution for 10 min, then placed on regeneration medium containing 100 μmol / L acetylsyringone (AS) and incubated in the dark at 28°C for 2 days. The co-cultured leaf explants were rinsed five times with sterile water, and residual liquid was blotted off with sterile filter paper. They were then inoculated onto regeneration medium, and after 2 weeks, the medium was replaced with Kans-containing medium for selection culture. Two months later, DNA and RNA were extracted from the leaves of resistant buds to identify transgenic plants.

[0050] 1.7 Determination of total phenols, total flavonoids, and total flavanols

[0051] Total phenol content (TPC) was determined using the Folin-Ciocalteu method. Total flavonoid content (TFC) was determined using the Jia method. Total flavanol content (TFAC) was determined using the p-DMACA method.

[0052] The extract was prepared by mixing 70 ml methanol, 2 ml formic acid, and 28 ml anhydrous ethanol. 0.2 g of leaf material was added to 2 ml of the extract and ground at 0°C. The mixture was then transferred to a centrifuge tube. The mortar was rinsed with the extract, and the mixture was transferred back to the centrifuge tube and brought to a final volume of 5 ml. The mixture was shaken at 30°C and 250 rpm for 2 hours, then centrifuged at 10000 g for 10 minutes. The supernatant was collected, filtered through a 0.45 μm filter membrane, and stored at 4°C for later use.

[0053] Total phenols were determined using gallic acid as the standard. 100 μl of the extract was taken, 1.5 mL of distilled water and 100 μl of Folin-Ciocalteu were added, and the mixture was shaken and allowed to stand for 1 min. Then, 1.5 mL of 20% saturated Na2CO3 solution was added and mixed well. The mixture was allowed to react in the dark for 2 h. The absorbance was measured at 765 nm using a control with added blank extract for zeroing.

[0054] Total flavonoids were determined using rutin as the standard. 200 μl of extract was taken, and 1.3 ml of methanol, 100 μl of NaNO2 (0.5 M) and 100 μl of AlCl3 were added. After mixing, the mixture was allowed to stand for 5 min. 500 μl of NaOH (1 M) was added, and the sample was zeroed by adding a blank extract. The absorbance was measured at 510 nm.

[0055] Total flavanols were determined using catechins as the standard. 100 μl of the extract was added to 0.1% p-DMACA, mixed well, and allowed to stand for 10 min. The absorbance was measured at 640 nm using a control with added blank extract for zeroing.

[0056] 1.8 HPLC method for the determination of phenolic substances

[0057] Weigh 2g of fruit pulp and extract with 3mL of 70% methanol aqueous solution (containing 2% formic acid). Mix well and sonicate at 30℃ for 30min. Centrifuge the mixture at 10000g for 10min. Filter the supernatant through a 0.45μm filter membrane. Use the filtrate for analysis. The HPLC conditions are as follows: DAD detector used; Comatex C18 column (250mm × 4.6mm, 5μm); mobile phase A: 2% acetic acid aqueous solution; mobile phase B: 0.5% acetic acid-acetonitrile aqueous solution (1:1, V / V); gradient elution program as shown in Table 2-8; column temperature: 30℃; injection volume: 20μL; flow rate: 1mL·min. -1 Detection wavelengths: 260nm, 280nm, 320nm, 330nm.

[0058] 1.9 Anthocyanin content determination

[0059] Take 1g of kiwifruit inner peel, chop it, add 5mL of 0.1mol / L hydrochloric acid ethanol solution, and incubate in a water bath at 60℃ for 20min. Collect the supernatant. Repeat the extraction three times, and bring the volume to 20mL. Then, using 0.1mol / L hydrochloric acid ethanol solution as a reference solution, measure the absorbance (OD) value of the extract at wavelengths of 650nm, 620nm, and 530nm. Calculate the total anthocyanin content using the formula based on the OD value.

[0060] Anthocyanin components were determined by HPLC. 0.5 g of fruit was added to 1.5 mL of 1% HCl-methanol and ground into a homogenate under liquid nitrogen in the dark. Extraction was then performed at 4°C for 12 h in the dark. The mixture was centrifuged at 10000 g for 10 min at 4°C, and the supernatant was filtered through a 0.45 μm filter membrane. HPLC conditions are shown in Table 2-9: A DAD detector and a Comatex C18 column (250 mm × 4.6 mm, 5 μm) were used for HPLC. Mobile phase A was water, B was acetonitrile, and C was formic acid. The gradient elution program is shown in Table 2-9. The flow rate was 1 mL / min. -1 The injection volume was 10 μL, the column temperature was 30℃, and the detection wavelength was 520 nm.

[0061] 2. Experimental Results

[0062] 2.1 Changes in phenolic substances during fruit development

[0063] To study the phenolic compounds in kiwifruit, H-16 and 'Hongyang' fruits were collected at five post-flowering stages, and their components were determined. The contents of total flavonoids and total phenols decreased with fruit development, with the contents of 'H-16' being significantly higher than those of 'Hongyang'. The main period of anthocyanin accumulation was 70-120 days after flowering, and during these periods, the total anthocyanin content in 'H-16' fruits was significantly higher than that in 'Hongyang' fruits. Figure 1 (A)

[0064] During fruit growth and development, the protocatechuic acid content of both 'Hongyang' and 'H-16' reached its maximum 40 days after flowering, showing an initial increase followed by a decrease between 20 and 70 days after flowering; and no significant change in content between 70 and 120 days after flowering. Caffeic acid content remained relatively low throughout the fruit's growth cycle, exhibiting a fluctuating trend. The caffeic acid content of 'H-16' was significantly higher than that of 'Hongyang' at 20 and 100 days after full bloom, while 'Hongyang' was significantly higher than 'H-16' at 40, 70, and 120 days after full bloom. The content of vanillic acid and quercetin in both 'Hongyang' and 'H-16' generally showed a decreasing trend, reaching its maximum 40 days after full bloom. Between 40 and 140 days after full bloom, the vanillic acid content of 'Hongyang' was significantly lower than that of 'H-16' except at 120 days after full bloom. The quercetin content of 'Hongyang' and 'H-16' varieties reached its maximum 40 and 20 days after full bloom, respectively. By fruit maturity, it decreased by 76% and 77% compared to 20 days after full bloom, respectively, showing an overall downward trend. Epicatechin was the most abundant phenolic compound in both 'Hongyang' and 'H-16' varieties, reaching its highest content 20 days after flowering, followed by a downward trend, reaching its lowest point 100 days after flowering. The epicatechin content in 'H-16' was significantly higher than that in 'Hongyang' at all stages. Chlorogenic acid content was low in the early stages, began to rise sharply 70 days after full bloom, and reached its maximum at 100 days after full bloom. Figure 1 (B)

[0065] Cyanide 3-O-xyl-galactoside (Cy.xyl.gal.) and cyanide 3-galactoside (Cy.gal.) are the two main components of anthocyanins in 'Hongyang' and 'H-16' kiwifruit. Their trends are similar to those of total anthocyanins, generally showing a trend of first decreasing and then increasing. Figure 1 (C)

[0066] 2.2 Screening of the MYB22 gene and correlation analysis with genes involved in flavonoid metabolism

[0067] Based on the inventors' previous analysis of the transcriptome data of 'Hongyang' kiwifruit and its bud mutation line 'H-16', the transcription factor AcMYB22, associated with flavonoid synthesis, was screened. The expression of AcMYB22 was studied using 'Hongyang' and 'H-16' kiwifruit during fruit development. The expression level of AcMYB22 was highest at 0 days after flowering among the five developmental stages. As the fruit developed, the expression level of AcMYB22 gradually decreased. The relative expression level of AcMYB22 in 'H-16' was 1.78 times that in 'Hongyang'. Figure 2 ).

[0068] Correlation analysis was performed on the relative expression level of AcMYB22 with total phenols, total flavonoids, total anthocyanins, and the anthocyanin components cyanidin 3-O-xyl-galactoside (Cy.xyl.gal.) and cyanidin 3-galactoside (Cy.gal.). The results showed that in 'Hongyang', AcMYB22 expression was significantly correlated with the accumulation of total phenols, but no strong correlation was found with other components. In 'H-16', AcMYB22 expression was significantly correlated with total flavonoids, total phenols, and Cy.xyl.gal. These results suggest that AcMYB22 may have a positive correlation with flavonoid biosynthesis.

[0069] 2.3 Cloning, sequence analysis, and subcellular localization of AcMYB22

[0070] The gene was cloned from 'Hongyang' and 'H-16' kiwifruit, respectively. Sequencing analysis yielded two allele sequences, named AcMYB22-1 and AcMYB22-2, respectively. AcMYB22-1 was isolated from 'Hongyang' kiwifruit, and both AcMYB22-1 and AcMYB22-2 were isolated from the bud mutation 'H-16'. Both alleles have an open reading frame of 1032 bp, encoding 343 amino acids. AcMYB22-1 and AcMYB22-2 differ by 9 nucleotides, resulting in 5 amino acid differences. Figure 3 ).

[0071] Phylogenetic analysis showed that AcMYB22 clustered with apple MdMYB22, Arabidopsis AtMYB11, AtMYB12, and AtMYB111. Figure 4 (A). Amino acid sequence alignment analysis showed that AcMYB22 contains conserved R2 and R3 domains and the characteristic domains of the R2R3-MYB transcription factor subgroup 7 (SG7) SG7([K / R][R / x][R / K]xGRT[S / x][R / G]xx[M / x]K) motif and SG7-2 motif ([W / x][L / x]LS)( Figure 4The presence of subgroup B indicates that AcMYB22 belongs to subgroup 7. It is speculated that AcMYB22 may also be involved in flavonoid biosynthesis. Therefore, the tissue location of AcMYB22 was determined, and subcellular results showed that AcMYB22 is located in the cell nucleus (…). Figure 4 (C, D)

[0072] 2.4 Transient overexpression of AcMYB22 enhances flavonoid synthesis in kiwifruit.

[0073] Transient overexpression of AcMYB22-1 and AcMYB22-2 in kiwifruit was investigated to explore the effects of these two inhibitors on the flavonoid synthesis pathway in kiwifruit. Seven days after injection, the flesh of kiwifruit injected with 35S::AcMYB22 turned yellow. Figure 5 (A) and quantitative results showed that the expression level of AcMYB22 in the fruit injected with 35S::AcMYB22 was significantly higher than that in the control, being 8.14 times and 19.61 times higher, respectively. Figure 5 (B). Color difference values ​​were measured, and the results showed that the kiwifruit treated with AcMYB22 overexpression had significantly higher a* (representing red-green hue) and b* (representing yellow-blue hue) values ​​than the control. Figure 5 (C). The contents of total phenols, total flavonoids, total flavanols, and total anthocyanins in the pulp were determined. The results showed that the total phenols, total flavonoids, and total flavanols in the fruit after overexpression treatment were significantly higher than those in the unexpressed fruit, indicating that AcMYB22 has a positive regulatory function on flavonoid synthesis. It is worth mentioning that the contents of total phenols, total flavonoids, and total anthocyanins in the fruit injected with 35S::MYB22-2 were significantly higher than those in the fruit injected with 35S::MYB22-1, while the contents of total flavanols in the fruit injected with 35S::MYB22-2 were significantly lower than those in the fruit injected with 35S::MYB22-1. Figure 5 (D).

[0074] 2.5 Transient overexpression of AcMYB22 increases the content of phenolic compounds in kiwifruit.

[0075] The phenolic compounds in transiently expressed kiwifruit pulp were determined by liquid chromatography. The results showed that the contents of vanillic acid, caffeic acid, epicatechin, chlorogenic acid, and p-hydroxybenzoic acid in pulp injected with AcMYB22 were significantly higher than those in pulp injected without the control. In addition, quercetin was higher in kiwifruit pulp injected with AcMYB22-1 compared to the control, while the quercetin content in pulp injected with AcMYB22-2 did not change significantly. Protocatechuic acid was significantly upregulated in fruits infected with AcMYB22-2, but no difference was observed in fruits injected with AcMYB22-1. Liquid chromatography was used to determine the main anthocyanin components in treated fruits. The results showed that the contents of cyanidin 3-galactoside and cyanidin 3-O-xylose-galactoside were significantly increased in the treated fruits, and the anthocyanin content of fruits injected with 35S::AcMYB22-2 was significantly higher than that of fruits injected with 35S::AcMYB22-1. Figure 6 (A)

[0076] Quantitative analysis was performed on the structural genes involved in flavonoid synthesis in fruit pulp injected with Agrobacterium tumefaciens solutions 35S::AcMYB22-1 and 35S::AcMYB22-2. The results showed that the expression levels of flavonoid synthesis structural genes in treated fruits were significantly higher than those in untreated fruits. Except for F3'H, the expression levels of flavonoid synthesis structural genes in pulp injected with 35S::AcMYB22-2 were significantly higher than those in pulp injected with 35S::AcMYB22-1. Figure 6 (B)

[0077] 2.6 Stable overexpression of AcMYB22 enhances the accumulation of flavonoids in kiwifruit leaves.

[0078] AcMYB22 was stably overexpressed in Hongyang kiwifruit, and the obtained overexpression lines were named OEMYB22-1.1, OEMYB22-2.1, OEMYB22-2, and OEMYB22-3, respectively. Figure 7 (A and B) The leaf phenotypes of the stably overexpressing plants changed compared to the control. The leaves of the overexpressing plants showed redness at the leaf margins and between the leaves, and the overall leaf color was yellow compared to the control. Figure 7 (C)

[0079] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. AcMYB22 The application of genes or their expression vectors in regulating flavonoid biosynthesis in plant fruits is characterized by, The plant in question is a kiwifruit; The AcMYB22 Genes are AcMYB22-1 and AcMYB22-2 The AcMYB22-1 The nucleotide sequence is shown in SEQ ID NO. 1; AcMYB22-2 The nucleotide sequence is shown in SEQ ID NO.2; overexpression AcMYB22 Genes that promote the biosynthesis of flavonoids in plant fruits; The flavonoids are total flavonoids, total flavanols and total anthocyanins; the total anthocyanins are cyanidin 3-galactoside and cyanidin 3-O-xylose-galactoside.

2. A method for regulating flavonoid biosynthesis in plant fruits, characterized in that, overexpression AcMYB22 Genes that promote the biosynthesis of flavonoids in plant fruits; The AcMYB22 Genes are AcMYB22-1 and AcMYB22-2 The AcMYB22-1 The nucleotide sequence is shown in SEQ ID NO. 1; AcMYB22-2 The nucleotide sequence is shown in SEQ ID NO.2; The plant in question is a kiwifruit; The flavonoids are total flavonoids, total flavanols and total anthocyanins; the total anthocyanins are cyanidin 3-galactoside and cyanidin 3-O-xylose-galactoside.

Images