Preparation method of yeast-expressed triple helix structure type Ⅱ recombinant human collagen and application thereof

Abstract

The application discloses a preparation method of a yeast-expressed triple helix structure type II recombinant human collagen and application thereof, and relates to the technical field of biology. The preparation method comprises the following steps: obtaining the triple helix structure type II recombinant human collagen through fermentation and purification of an engineering bacterium; and the construction method of the engineering bacterium comprises the following steps: transforming pMChZ-alpha1 (II) plasmid, pPIC9K-P4H (DP) -1 plasmid and pMCeH-alpha1 (II) plasmid into a yeast host bacterium to obtain the engineering bacterium. The yeast bacterium is used as a host bacterium to construct a gene engineering bacterium for expressing type II recombinant human collagen, and the triple helix structure type II recombinant human collagen can be obtained through fermentation and purification. The triple helix structure type II recombinant human collagen prepared by the application can be widely applied to the fields of cosmetics, medical cosmetology, medical devices, biomedical materials and the like, and has important market application value.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for preparing recombinant human collagen of type II triple helix structure expressed in yeast and its application. Background Technology

[0002] Collagen is the most abundant protein in the body and a major component of the extracellular matrix. It plays a vital role in maintaining the normal physiological functions of cells, tissues, and organs, as well as in repairing damage. Structurally, each collagen peptide chain is primarily composed of repeating Gly-XY (where X and Y are any amino acid residues other than Gly) triplet structures. This unique structure is essential for the formation of higher-order collagen fiber structures, determining collagen's excellent biocompatibility and low immunogenicity. It has been widely used in the pharmaceutical, health product, and cosmetic industries.

[0003] Type II collagen is abundant, currently mainly extracted from animal tissues, but this method carries the risk of viral transmission. With the development of biotechnology, significant progress has been made in obtaining recombinant collagen through microbial fermentation using gene recombination technology. This method overcomes the viral risks associated with traditional extraction methods and significantly improves the stability, hydrophilicity, and biocompatibility of collagen. Chinese patent CN1380414A discloses a recombinant human type II collagen functional polypeptide, its preparation method, and its uses. However, the prepared recombinant type II collagen polypeptide lacks the characteristic triple helix structure and fibrous morphology of collagen. Chinese patent CN115819557A discloses a method for obtaining recombinant humanized type II collagen through expression in *E. coli*. While *E. coli* expression systems face risks of purification difficulties and high endotoxin content, methanol-nutritive *Pichia pastoris*, as a eukaryotic expression system, offers advantages such as high target protein expression levels, simple purification methods, and immunity to endotoxins. It has been widely used for recombinant protein expression and is a superior host bacterium for recombinant collagen expression. Recombinant humanized collagen can be expressed in microorganisms at a low cost, but these collagens lack key collagen characteristics, are prone to enzymatic hydrolysis or non-enzymatic hydrolysis due to chemical reactions, and have low mechanical properties, making them unsuitable for applications requiring high molecular weight, high-support collagen.

[0004] Therefore, there is an urgent need for a method to obtain high molecular weight, highly supportive triple-helix type II recombinant human collagen. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing type II recombinant human collagen with a triple-helix structure expressed in yeast and its application, thereby solving the problems existing in the prior art. The type II recombinant human collagen prepared using this method has a triple-helix structure, a large molecular weight, strong support, and good market application value.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides a method for constructing an engineered bacterium expressing a triple-helix type II recombinant human collagen, comprising the steps of transforming pMChZ-α1(II) plasmid, pPIC9K-P4H(DP)-1 plasmid and pMCeH-α1(II) plasmid into yeast host bacteria to construct the engineered bacterium;

[0008] The pMChZ-α1(II) plasmid was obtained by cloning α1(II) into the pMChZ-AOX vector;

[0009] The pPIC9K-P4H(DP)-1 plasmid is obtained by replacing KanR in the P4H 9K DP plasmid with the sequence shown in SEQ ID NO.6;

[0010] The pMCeH-α1(II) plasmid was obtained by cloning α1(II) into the pMCeH-AOX vector;

[0011] The nucleotide sequence of α1(II) is shown in SEQ ID NO.2;

[0012] The pMChZ-AOX vector is obtained by modifying the pPIC9K plasmid as follows: replacing 4648-9221 bp of the pPIC9K plasmid with a DNA molecule whose nucleotide sequence is shown in SEQ ID NO. 3; deleting BamHI located upstream of αMF in the pPIC9K plasmid; and introducing a BamHI recognition site between 1583-1584 bp of the pPIC9K plasmid through point mutation.

[0013] The pMCeH-AOX vector was constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt on the pMChZ-AOX vector with DNA molecules whose nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5, respectively.

[0014] Furthermore, the construction method specifically includes the following steps:

[0015] The pMChZ-α1(II) plasmid was transformed into the yeast host cell to obtain α1(II)-1#-Z R strain;

[0016] The pPIC9K-P4H(DP)-1 plasmid was transformed into the α1(II)-1#-Z plasmid. R The strain was obtained as α1(II)-1#-P4H.

[0017] The pMCeH-α1(II) plasmid was transformed into the α1(II)-1#-P4H strain to obtain the engineered strain.

[0018] Furthermore, the host bacteria is Pichia pastoris X33 or Pichia pastoris KM71.

[0019] Furthermore, the BamHⅠ located upstream of αMF in the pPIC9K plasmid is deleted by point mutation.

[0020] The present invention also provides an engineered bacterium expressing recombinant human collagen of a triple helix structure II, which is constructed according to the above-described construction method.

[0021] The present invention also provides the application of the above-mentioned engineered bacteria in the preparation of triple-helix type II recombinant human collagen.

[0022] The present invention also provides a method for preparing recombinant human collagen of triple helix type II expressed by yeast, comprising the step of fermenting and purifying the above-mentioned engineered bacteria to obtain the recombinant human collagen of triple helix type II.

[0023] The present invention also provides a triple-helix type II recombinant human collagen prepared according to the above preparation method.

[0024] The present invention also provides the application of the above-mentioned triple-helix type II recombinant human collagen in the preparation of biomedical materials, cosmetics or medical devices.

[0025] The present invention discloses the following technical effects:

[0026] This invention provides a method for preparing triple-helix type II recombinant human collagen. Using yeast as the host bacteria, a genetically engineered bacterium expressing type II recombinant human collagen is constructed. The triple-helix type II recombinant human collagen can be obtained through fermentation and purification. The triple-helix type II recombinant human collagen prepared by this invention can be widely used in cosmetics, medical aesthetics, medical devices, biomedical materials, and other fields, and has significant market application value. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 The plasmid map of pPIC9K;

[0029] Figure 2The plasmid map of pMChZ-AOX;

[0030] Figure 3 The plasmid map of pMCeH-AOX;

[0031] Figure 4 The plasmid map of pPIC9K-P4H(DP)-1;

[0032] Figure 5 The results of collagen detection using COL2A1, P4HA, and P4HB antibodies, respectively;

[0033] Figure 6 The results are from circular dichroism chromatographic analysis.

[0034] Figure 7 These are the results of transmission electron microscopy. Detailed Implementation

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0037] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0038] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0039] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0040] Example 1

[0041] 1. Construct the sequence encoding type II recombinant human collagen with a triple helix structure.

[0042] The amino acid sequence of the α1(II) chain of the triple-helix type II recombinant human collagen is shown in SEQ ID NO.1. The coding gene for the α1(II) chain was optimized according to the expression preferences of Pichia pastoris to obtain the coding gene with the nucleic acid sequence shown in SEQ ID NO.2.

[0043] 2. Constructing plasmids

[0044] 2.1 Construction of plasmid pMChZ-AOX

[0045] The nucleotide sequence shown in SEQ ID NO.3 was synthesized as a substitution fragment, replacing 4648-9221 bp of the pPIC9K vector sequence. Specifically, the substitution fragment replaced the KanR resistance gene, Bom, and AOX13' fragment element in pPIC9K. BamHI (938-943 bp) upstream of αMF (α-factor secretion signal) in pPIC9K was deleted via point mutation, and a BamHI recognition site was introduced downstream of AOX1tt (also known as AOX1 transcription termination or AOX1 termination) (between 1583-1584 bp) via point mutation. Other vector element sequences remained unchanged, resulting in the plasmid pMChZ-AOX (where h represents the recombination site PpHIS4, and Z represents the selection marker BleoR). This plasmid expresses Cre recombinase upon methanol induction, catalyzing the recombination of lox71 and lox66, thus recovering the resistance gene. The BamHI located after AOX1tt can be used for isosigmazyme construction of in vitro multicopy plasmids. The spectra of the original plasmid pPIC9K and the plasmid pMChZ-AOX constructed in this invention are as follows: Figure 1 and Figure 2 As shown.

[0046] The synthesized nucleotide sequence, as shown in SEQ ID NO.3, contains lox71 and lox66 sequences at both ends. Upstream of lox71 is ori, and inside is the Cre transcription unit. The Cre gene is started by the AOX1 promoter with a mutation at the SacⅠ restriction site. Upstream of BleoR are prokaryotic and eukaryotic promoters, which can be used for screening prokaryotes and eukaryotes. Upstream of AmpR is a prokaryotic promoter, which can be used for screening prokaryotes.

[0047] SEQ ID NO.3:

[0048]

[0049]

[0050]

[0051] Part of it is ori, 5' end For lox71, 3' end It is lox66; For AmpR, For pAmpR (AmpR promoter), The pAOX1 promoter is mutated at the SacⅠ site. It is the Cre recombinase gene. For AOX1tt, pTEF1 (corresponding to) Figure 2 (TEF1 promoter), The lowercase part is pEM7 (corresponding to) Figure 2 EM7 promoter), Part of it is BleoR, and the part with "" followed by lowercase letters is CYC1tt (corresponding to Figure 2 (CYC1 terminator).

[0052] 2.2 Construction of plasmid pMCeH-AOX

[0053] The sequences shown in SEQ ID NO.4 (PpENO) and SEQ ID NO.5 were synthesized and substituted for PpHIS4 and PEM7-BleoR-CYC1 tt on pMChZ-AOX (obtained in step 2.1), respectively, to obtain plasmid pMCeH-AOX (e represents the recombination site as PpENO, and H represents the selection marker as HygR), as shown in the diagram. Figure 3 As shown.

[0054] SEQ ID NO.5:

[0055] ATGGGTAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGT CTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTC CTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCC CGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGT CACGTTGCAAGACCTCCCTGAAACCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCT GCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTG ATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGT CGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCACGCGGATTTC GGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATT CCCAATACGAGGTCGCCAACATCTTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGA GCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTAT CAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAG CCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGC CGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTG, where the underscore is HygR and the 3' end is TEFtt.

[0056] 3. Constructing recombinant expression vectors

[0057] 3.1 The encoding gene of α1(II) (SEQ ID NO.2) was cloned into the pMChZ-AOX vector constructed in 2.1 to obtain the recombinant expression plasmid pMChZ-α1(II).

[0058] 3.2 The encoding gene of α1(II) (SEQ ID NO.2) was cloned into the pMCeH-AOX vector constructed in 2.2 to obtain the recombinant expression plasmid pMCeH-α1(II).

[0059] 3.3 Construction of the P4H expression vector pPIC9K-P4H(DP)-1

[0060] The sequence shown in SEQ ID NO.6 was synthesized, and the KanR of the P4H 9K DP plasmid (disclosed in patent CN114480471A) was replaced. Specifically, PTEF and PEM7 were added to the 5' end of the selection marker (in the direction of the pPIC9K plasmid), and CYC1tt was added to the 3' end to obtain the P4H expression vector pPIC9K-P4H(DP)-1, whose plasmid profile is shown below. Figure 4 As shown.

[0061] SEQ ID NO.6:

[0062]

[0063] in, The bold underline represents PTEF. It is PEM7. The lowercase part is KanR. For CYC1tt.

[0064] 4. Construction of recombinant engineered strains, induction of expression, and strain screening

[0065] Using Pichia pastoris X33 as the starting strain, competent Pichia pastoris cells were prepared according to the competent cell preparation method described by Lin-Cereghino (Lin-Cereghino et al., 2005). The pMChZ-α1(II) obtained in step 3.1 was linearized using SalI to obtain the pMChZ-α1(II) linearized plasmid. The pMChZ-α1(II) linearized plasmid was electroporated into competent Pichia pastoris cells according to the Invitrogen Pichia Expression Kit USERGUIDE method, and then plated on YPDZ plates (containing bleomycin 300 μg / mL). The resulting transformants were designated X33-α1(II)-1#-Z. R .

[0066] In embodiments of the present invention, the naming rule for the obtained transformants is: Starting strain name / POI-number of electroporation#-susceptibility to screening antibiotics; the description of antibiotic sensitivity will be omitted if the screening marker is not recovered. Here, Z is an abbreviation for Zeocin, S (sensitive) represents sensitive, and R (resistant) represents resistant.

[0067] With X33-α1(II)-1#-Z R The starting strain was subjected to shake-flask induction, which involved inoculating the culture into a 100 mL Erlenmeyer flask containing 10 mL of BMGY medium and incubating at 28-30°C and 220 rpm until the OD reached its limit. 600 The time is 2–6 (16–18 h). Centrifuge at 3000 g for 5 min at room temperature, collect the bacterial cells, resuspend the cells in BMMY medium, and adjust the OD value. 600 The culture medium was kept at approximately 2 μg / mL and placed on a shaker at 28-30℃ and 220 rpm for 3 days for further growth. Every 24 hours, 100% methanol was added to the culture medium until the final concentration reached 1.0% for induction. After induction, the bacterial culture was streaked onto YPD plates. The resulting colonies were then spotted onto YPD and YPDZ (100 μg / mL) plates. The strain that grew normally on YPD plates but not on YPDZ plates was the selected strain X33-α1(II)-1#-Z. S .

[0068] With X33 / α1(II)-1#-Z S As the starting strain, pPIC9K-P4H(DP)-1 was linearized using BspEⅠ and electroporated into competent cells of the starting strain to obtain transformant X33-α1(II)-1#-P4H.

[0069] Using X33-α1(II)-1#-P4H as the starting strain, pMCeH-α1(II) was linearized using SalⅠ and electroporated into competent cells of the starting strain to obtain X33-α1(II)-2#-P4H.

[0070] The transformed individuals obtained above were induced in shake flasks, and the cell walls were broken to extract total protein. The extraction steps were as follows: 1 mL of sample was placed in a 1.5 mL EP tube and centrifuged at 12000 g for 5 min at 4 °C. The supernatant and bacterial cells were collected separately. 80 μL of the supernatant was added to 20 μL of loading buffer and heated at 80 °C for 5 min to prepare the sample. 20 μL of the sample was then subjected to SDS-PAGE. Add 200 μL of cell disruption buffer (50 mM sodium phosphate (pH 7.4), 1 mM EDTA, 5% glycerol, 1 mM PMSF (phenylmethylsulfonyl fluoride, dissolved in anhydrous ethanol to prepare a 100× stock solution, added before cell disruption) and 40% liquid volume of 0.5 mm glass beads to the bacterial cells; vortex for 1 min, place on ice for 1 min, and repeat 6-10 times; centrifuge at 3000 g for 3 min at 4 °C, take 80 μL of the supernatant (total protein), add 20 μL of loading buffer, and heat at 99 °C for 5 min to prepare the sample.

[0071] Using the same total protein sample, SDS-PAGE and WB were performed, and the results are as follows: Figure 5 As shown. From Figure 5 As can be seen from this, X33-α1(II)-1#-Z R α1(II) was detectable, and after transformation into pPIC9K-P4H(DP)-1, the P4HA and P4HB subunits were expressed normally. Two electroporations using the plasmid pMCeH-α1(II) with altered recombination sites significantly increased the expression level of X33-α1(II)-2#-P4H.

[0072] 5. High-density fermentation culture and protein purification

[0073] The engineered bacteria with high protein expression levels, as identified through protein expression analysis, were then subjected to high-density fermentation culture and protein purification in a fermenter.

[0074] X33-α1(II)-2#-P4H was inoculated into a 1L shake flask containing 200mL of seed culture medium YPG and incubated at 220rpm and 30℃ for 18h until OD was reached. 600 =8.

[0075] A 5L fermenter (Baoxing Biotechnology) was used, filled with 2L of fermentation medium. Before inoculation, the fermentation speed was adjusted to 300 rpm, the aeration rate to 4L / min, and the temperature to 30℃. The pH was adjusted to 6.0 using a concentrated ammonia solution. First, 0.9mL of PTM1 was added, followed by 200mL of the prepared seed culture (flame ring inoculation). The dissolved oxygen electrode was then calibrated, and fermentation began. When the dissolved oxygen level first dropped to 30%, the dissolved oxygen cascade speed function was used to maintain it at 30%. The fermentation continued until the glycerol was depleted, the dissolved oxygen rebounded, and the dissolved oxygen level exceeded 70% (OD). 600 (Value approximately 20), cancel dissolved oxygen cascade stirring speed, increase stirring speed to 650 rpm, and use 30% glycerol in a continuous feeding manner, adding 150 mL of glycerol. Stop glycerol feeding, and after dissolved oxygen rebounds to above 70%, induce culture with methanol at a constant feeding rate of 4 mL / h. Induction lasts 80–90 h, OD... 600 Once the change is not significant or decreases, the mixture can be placed in a tank to obtain the fermentation broth.

[0076] After fermentation, the bacterial culture was centrifuged at 5000 rpm for 30 min to collect the bacterial cells. The cells were resuspended in the purified cell-wall-breaking solution at a ratio of 1:10 (W:V) and homogenized at 1000 bar. After homogenization, the supernatant and precipitate were separated by centrifugation at 12000 rpm and 4℃ for 30 min. The precipitate was washed, renatured, digested with pepsin, desalted by ultrafiltration, and then lyophilized to obtain α1(II) lyophilized powder.

[0077] 6. Structural characterization of α1(II) lyophilized powder

[0078] After reconstitution of the α1(II) lyophilized powder, acid hydrolysis was performed. The peak area of ​​the target data was calculated using MassLynx quantitative software and the identification results were obtained by standard curve method. The results showed that the hydroxyproline content reached more than 30% of the total proline.

[0079] The α1(II) lyophilized powder was dissolved in water, and the results were analyzed using a circular dichroism spectrometer. The test results are as follows: Figure 6 As shown, it conforms to the circular dichroism spectral characteristics of triple-helix collagen.

[0080] Collagen samples were negatively stained and then examined using transmission electron microscopy. The test results are as follows: Figure 7 As shown, this illustrates the typical structural features of collagen microfibers with alternating light and dark areas.

[0081] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A method for constructing an engineered bacterium expressing triple-helical structure type II recombinant human collagen, characterized by, The step of constructing the engineering bacteria comprises transforming pMChZ-alpha1 (II) plasmid, pPIC9K-P4H (DP)-1 plasmid and pMCeH-alpha1 (II) plasmid into a yeast host strain. The pMChZ-alpha1 (II) plasmid is obtained by cloning alpha1 (II) into a pMChZ-AOX vector; The pPIC9K-P4H (DP)-1 plasmid is obtained by replacing KanR in a P4H 9K DP plasmid with a sequence shown as SEQ ID NO. 6; The pMCeH-alpha1 (II) plasmid is obtained by cloning alpha1 (II) into a pMCeH-AOX vector; The nucleotide sequence of alpha1 (II) is shown as SEQ ID NO. 2; The pMChZ-AOX vector is obtained by modifying a pPIC9K plasmid as follows: replacing 4648-9221 bp of the pPIC9K plasmid with a DNA molecule having a nucleotide sequence shown as SEQ ID NO. 3; deleting BamH I upstream of alphaMF in the pPIC9K plasmid; and introducing a BamH I recognition site by point mutation between 1583-1584 bp of the pPIC9K plasmid; The pMCeH-AOX vector is constructed by replacing PpHIS4 and PEM7-BleoR-CYC1 tt in the pMChZ-AOX vector with DNA molecules having nucleotide sequences shown as SEQ ID NO. 4 and SEQ ID NO. 5, respectively; The construction method specifically comprises the following steps: The pMChZ-al (II) plasmid was transformed into the yeast host strain to obtain al (II)-1#-Z R Strain; The pPIC9K-P4H(DP)-1 plasmid was transformed into the α1(II)-1#-Z R strain to obtain the α1(II)-1#-P4H strain; The pMCeH-alpha1 (II) plasmid is transformed into the alpha1 (II)-1#-P4H strain to obtain the engineering bacteria.

2. The construction method of claim 1, wherein, The host strain is Pichia pastoris X33 or Pichia pastoris KM71.

3. The construction method of claim 1, wherein, The BamH I upstream of alphaMF in the pPIC9K plasmid is deleted by point mutation.

4. Engineering bacteria expressing triple-helix type II recombinant human collagen, which are constructed by the construction method according to any one of claims 1-3.

5. Use of the engineering bacteria according to claim 4 in the preparation of triple-helix type II recombinant human collagen.

6. A method for preparing a yeast-expressed triple-helical structure type II recombinant human collagen, characterized by, The step of purifying the triple-helix type II recombinant human collagen by fermentation using the engineering bacteria according to claim 4.

7. Triple-helix type II recombinant human collagen, which is prepared by the preparation method according to claim 6.

8. Use of the triple-helix type II recombinant human collagen according to claim 7 in the preparation of biomedical materials, cosmetics or medical devices.

Images