Application of transcription factor MaERF12 in regulating aroma release of banana fruit

By applying the transcription factor MaERF12 gene to activate key genes in the fatty acid synthesis pathway in banana fruit, the problem of unclear aroma release regulation mechanism in banana fruit was solved, enabling precise regulation of banana fruit aroma and improving the nutritional quality and storage life of the fruit.

CN119662701BActive Publication Date: 2025-11-11SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411636998.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-15
Publication Date
2025-11-11
Estimated Expiration
2044-11-15

AI Technical Summary

Technical Problem

The limited understanding of the regulatory mechanisms of banana fruit aroma release in existing technologies restricts the research and application of technologies for the precise release of aroma substances.

Method used

The transcription factor MaERF12 gene was used to regulate the release of banana fruit aroma under conditions of 14℃-25℃. By activating key genes MaHPL, MaADH and MaAAT in the fatty acid synthesis pathway, the release and diversity of volatile aroma substances in banana fruit were promoted.

Benefits of technology

This study achieved precise control over the release of aroma from banana fruits, influencing the amount and variety of volatile substances released during the ripening period of banana fruits, and providing a theoretical basis for improving nutritional quality and extending storage life.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662701B_ABST
    Figure CN119662701B_ABST
Patent Text Reader

Abstract

This invention discloses the application of the transcription factor MaERF12 in regulating aroma release in banana fruits. This invention demonstrates that MaERF12 participates in the temperature-mediated transcriptional regulation of banana fruit aroma release by activating the transcription of MaHPL, MaADH, and MaAAT in the fatty acid synthesis pathway, affecting the amount and diversity of volatile substances released during banana fruit ripening. This invention provides a new perspective for understanding the transcriptional regulatory mechanisms related to aroma formation during banana ripening and provides a theoretical basis for precise regulation of banana fruit aroma metabolism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving the application of transcription factor MaERF12 in regulating the release of aroma from banana fruits. Background Technology

[0002] After harvest, fruits undergo a series of changes, including color transformation, softening of the flesh, and the release of aromas; this phenomenon is called post-ripening. Based on the respiration activity during post-ripening, fruits can be divided into climacteric and non-climacteric types. The difference lies in the fact that climacteric fruits experience a dramatic increase in respiration intensity and a large release of ethylene in the later stages of ripening, while simultaneously undergoing a rapid transition from growth to senescence. For climacteric fruits, untimely climacteric changes can sometimes lead to significant post-harvest waste. Therefore, in the large-scale cultivation and sale of climacteric fruits, artificial ripening is a crucial post-harvest treatment step.

[0003] As a typical climacteric fruit, bananas undergo a series of physiological changes related to ripening and senescence during their post-ripening period, triggered by the release of endogenous ethylene. These changes directly or indirectly determine the texture, appearance, flavor, and nutritional quality of the fruit, affecting its shelf life and commercial value.

[0004] Temperature is a crucial factor affecting fruit quality and shelf life. By controlling ripening temperatures, the market timing of fruits and vegetables can be adjusted according to market demand. Bananas, harvested in tropical or subtropical regions, are highly sensitive to ripening temperatures. The optimal ripening temperature for bananas is 14℃-25℃. Numerous studies have shown that within this suitable temperature range, lower ripening temperatures can delay softening, respiration rate, and ethylene production, while higher temperatures can accelerate the ripening process. However, when the ripening temperature is below 13℃, the fruit cannot ripen normally; when the ripening temperature is above 25℃, the banana softens faster and the peel remains green, resulting in what is known as "green-skinned ripening." In addition, some researchers have explored a temperature-transfer ripening method: ripening at 18℃ followed by storage at 22℃ effectively improves the commercial quality of the "Zhongjiao No. 9" banana variety.

[0005] Banana fruits accumulate many compounds that are important for sensory quality, such as those affecting fruit color (chlorophyll, carotenoids, and flavonoids), texture (cell wall disintegration and decreased cell turgor pressure), and flavor (starch degradation, sugar and acid metabolism, and synthesis of aromatic volatiles). Changes in fruit sensory quality are regulated by various transcription factors, plant hormones, epigenetic modifications, and exogenous environmental factors. Therefore, exploring precise ripening techniques for banana fruits is not only beneficial for regulating the post-ripening process of bananas but also provides a reference for improving nutritional quality, extending storage life, and reducing post-harvest losses.

[0006] Currently, research on fruit aroma mainly focuses on the identification of aroma compounds, the differences in fruit aroma among different varieties and the determination of characteristic aromas, fruit ripening and shelf life, changes in fruit aroma components during storage and their relationship with quality. The future trend in fruit aroma research lies in utilizing molecular biology techniques to understand the information of fruit aroma metabolism genes and clarify the functions of key enzyme genes involved in fruit aroma metabolism, thereby achieving precise regulation of fruit aroma metabolism. However, our understanding of the mechanisms regulating aroma release is still very limited, restricting the research and application of technologies for precise release of aroma compounds. Summary of the Invention

[0007] To address the aforementioned shortcomings of existing technologies, this invention provides the application of transcription factor MaERF12 in regulating the release of aroma from banana fruits.

[0008] The purpose of this invention is to provide the application of the MaERF12 gene in regulating the release of aroma from banana fruits, and the nucleotide sequence of the MaERF12 gene is shown in SEQ ID NO.21.

[0009] Preferably, the application is the use of the MaERF12 gene in regulating the release of aroma from banana fruits under conditions of 14℃-25℃.

[0010] Preferably, the application is the use of the MaERF12 gene to promote the release of aroma from banana fruit at 20°C.

[0011] Preferably, the expression level of the MaERF12 gene increases with increasing temperature at 14℃-25℃, positively regulating the release of banana fruit aroma and promoting the release and variety of volatile aroma substances in banana fruit.

[0012] Preferably, the MaERF12 gene, under 20°C conditions, positively regulates key genes in the fatty acid synthesis pathway, causing volatile aldehyde compounds to convert into volatile lipid compounds, thereby promoting the release of banana fruit aroma.

[0013] Preferably, the key genes in the fatty acid synthesis pathway are MaHPL, MaADH, and MaAAT.

[0014] The beneficial effects of this invention are:

[0015] This invention confirms that MaERF12 participates in the temperature-mediated transcriptional regulation of banana fruit aroma release by activating the transcription of MaHPL, MaADH, and MaAAT in the fatty acid synthesis pathway, affecting the amount and diversity of volatile substances released during banana fruit ripening. This invention provides a new perspective for understanding the transcriptional regulatory mechanisms related to aroma formation during banana ripening and provides a theoretical basis for precise regulation of banana fruit aroma metabolism. Attached Figure Description

[0016] Figure 1 This shows the changes in the appearance of banana fruits under different ripening temperatures.

[0017] Figure 2 This study investigates the effect of different ripening temperatures on the release of volatile substances from banana fruits.

[0018] Figure 3 The effects of different ripening temperatures on the expression of fatty acid pathway enzyme genes during the post-ripening process of banana fruit are shown. (a) is a schematic diagram of the fatty acid synthesis pathway, and (b) shows the expression characteristics of genes in the fatty acid synthesis pathway at different ripening temperatures. Different letters in (b) indicate that there are significant differences in the expression level of the same gene at different ripening temperatures during the same period (p<0.05).

[0019] Figure 4 The expression patterns of ERF (i.e., MaERF12, Ma08_g23930) under different ripening temperatures are shown; different letters indicate that the expression levels of the Ma08_g23930 gene under different ripening temperatures at the same time are significantly different (p<0.05).

[0020] Figure 5 This is a phylogenetic analysis of MaERF12 and Arabidopsis thaliana ERF; where XP 009414052.1 represents MaERF12.

[0021] Figure 6 This is a transcriptional activity analysis of MaERF12; where (a) is a schematic diagram of the vector, and (b) is a diagram showing the transcriptional activation activity of MaERF12 in tobacco leaves.

[0022] Figure 7 This diagram illustrates the transcriptional activation of the MaHPL, MaADH, and MaAAT promoters by MaERF12. (a) is a schematic diagram of the vector, and (b) shows the results of MaERF12 activation of MaHPL, MaADH, and MaAAT transcription. Detailed Implementation

[0023] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0024] Example 1

[0025] 1. Materials and Methods

[0026] 1.1 Test materials

[0027] The banana variety used in this experiment was Guijiao No. 1, all harvested from Guangxi Meicheng Agricultural Technology Co., Ltd. (Wuming District, Nanning City), at a maturity of 6-7 tenths ripeness. After harvesting, the bananas were immediately transported back to the laboratory and left at room temperature overnight to dissipate field heat.

[0028] 1.2 Experimental processing and sampling methods

[0029] 1.2.1 Pre-experimental treatment

[0030] Select whole bunches of bananas that are basically the same in color, size, shape and weight, soak them in 0.05% (v / v) Spock solution for 2 minutes, remove them and let them air dry. Then soak them in 800 ppm ethephon solution for 1.5 minutes, remove them and drain the water for 20 minutes, pack them in polyethylene film bags, and randomly divide the experimental bananas into three groups and place them in constant temperature incubators at the corresponding temperatures, as detailed in 1.2.2.

[0031] 1.2.2 Experimental Grouping Scheme

[0032] This experiment designed three ripening temperatures. The first group was continuously placed in a 20℃ constant temperature chamber for ripening; the second group was continuously placed in a 14℃ constant temperature chamber for ripening; and the third group was first placed in a 14℃ constant temperature chamber for ripening, and then transferred to a 20℃ constant temperature chamber for further ripening on the 8th day.

[0033] 1.2.3 Sampling Method

[0034] Bananas ripened under three different temperatures were photographed at five time points: 0d (the day of ripening in the constant temperature chamber, i.e., unripe), peel not yet yellowed, peel turning yellow, peel fully yellowed, and overripe (labeled A, B, C, D, and E, respectively). Samples were taken to measure the volatile substances in the pulp. On the day of sampling, three bananas were randomly selected, and their peels and pulp were collected, flash-frozen in liquid nitrogen, and stored at -80℃ for the determination of relevant indicators.

[0035] 1.3 Determination of volatile substances in banana pulp

[0036] On the day of the test, the pulp of three banana fruits was randomly selected for testing. The average peak area of ​​the substances detected in the three samples was plotted.

[0037] Volatile substances were extracted from banana pulp using the HS-SPME method, and the extracted substances were characterized using a Shimadzu GC-MS-QP2010 Ultra gas spectroscopy system.

[0038] The extraction method was as follows: Banana pulp was juiced into a homogenate using a juicer. 1g of the homogenate was quickly weighed into an extraction flask, which was then completely sealed with aluminum foil and sealing film. The flask was then allowed to stand at room temperature for 15 minutes. Volatile substances in the flask were extracted using a Supeoco 50 / 30μm DVB / CAR / PDMS coated extraction head, held 2cm above the pulp homogenate, and maintained under headspace for 30 minutes before analysis.

[0039] GC-MS test conditions:

[0040] ①GC: Column oven temperature: 50℃, injection port temperature: 220℃, injection mode: split. Carrier gas: Helium (99.99% purity), initial pressure 500-900 kPa, flow control method: linear velocity, pressure: 53.6 kPa, total flow rate: 17 mL / min, column flow rate: 1 mL / min, linear velocity: 36.3 cm / s, purge flow rate: 6 mL / min, split ratio: 10. Column: Rxi-5sil MS (30 m × 0.25 mm × 0.25 μm).

[0041] The program was to maintain the temperature at 50°C for 1 minute, then increase the temperature to 180°C at a rate of 4°C / min and maintain it for 2 minutes, for a total program time of 35 minutes.

[0042] ②MS: Ion source temperature: 200℃, injection port temperature: 230℃.

[0043] 1.4 Extraction of total RNA from banana pulp

[0044] Total RNA was extracted from banana pulp according to the instructions of the Tiangen Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441).

[0045] 1.5 Synthesis of Banana cDNA

[0046] The synthesis of banana pulp cDNA was performed using the total RNA from banana pulp obtained in section 1.4 as a template, following the instructions of the Novizan reverse transcription kit. The assay was performed according to the IIQ RT SuperMix for qPCR (Cat.R223) instructions.

[0047] 1.6 Real-time quantitative PCR (qRT-PCR)

[0048] The cDNA obtained in step 1.5 was used as a template; the reaction system was prepared using ChamQSYBR-qPCR Master Mix (Cat.Q311) from Novizan for dye-based quantitative PCR. Quantitative reactions were performed using a Bio-Rad CFX9600 instrument from Bio-Rad.

[0049] MaRPS4 was selected as an internal reference gene for banana ripening (Chen et al., 2011). For MaERF12 (Ma08_g23930, see the website for the gene sequence), further analysis was conducted. https: / / banana-genome- hub.southgreen.fr / Quantitative PCR was performed using MaHPL (Ma06_g15030), MaADH (Ma05_g11250), and MaAAT (Ma01_g13530). The sequences of the quantitative primers used are shown in Table 1.

[0050] Table 1 Quantitative Primer Sequences

[0051] Primer name Primer sequence Serial Number MaRPS4-F TGAGAGTGGCTTGACCCTGA SEQ ID NO.1 MaRPS4-R GTGACATTTAGTCGTCTGCTGG SEQ ID NO.2 MaERF12-F AAGGTAAGAAGCAGTACAAGGG SEQ ID NO.3 MaERF12-R CAAATCCTGGTCTTCTGGTTTG SEQ ID NO.4 MaHPL-F CATTCTCATCGGGGACTACATG SEQ ID NO.5 MaHPL-R CTGAGGAGTTCCAAGCAGAAG SEQ ID NO.6 MaADH-F GACCAGCTCCAGTTCACATATA SEQ ID NO.7 MaADH-R CTTTCCCGAACTTGACAGCTAT SEQ ID NO.8 MaAAT-F CTATCCCCTGACCACATCGATC SEQ ID NO.9 MaAAT-R GTAGAAGCAGTTGCCGTAGTAG SEQ ID NO.10

[0052] 1.7g DNA extraction

[0053] gDNA was extracted according to the instructions of the Tiangen Plant Genomic DNA Extraction Kit (Cat.DP305).

[0054] 1.8 Gene Cloning

[0055] Primers for amplifying the MaERF12(Ma08_g23930) CDs sequence and primers for amplifying the MaHPL, MaADH, and MaAAT promoter fragments were designed online using the Primer3 website. I-5 primers from MCLAB were used. TM The 2×High-Fidelity MasterMix enzyme was used to clone the cDNA obtained in step 1.5 and the gDNA obtained in step 1.7.

[0056] PCR amplification, T-vector ligation, pGreenII 0800LUC vector ligation, 62-SKBD vector ligation, 62SK vector ligation, E. coli competent cell transformation, and sequencing identification were performed to obtain plasmids.

[0057] 1.9 Dual-luciferase reporter gene assay (DLR)

[0058] (1) The plasmid obtained in 1.8 was transformed into EHA105 Agrobacterium competent cells;

[0059] (2) Pick colonies and put them into 5 mL of LB solution with added kanamycin. Incubate them in a constant temperature shaker at 215 rpm for 16 h at 28 °C. Use electrophoresis to identify whether the transformation was successful.

[0060] (3) Prepare the permeation solution (10mM MgCl2, 10mM MES and 100μM acetylsalicylic acid, adjust the pH to 5.6);

[0061] (4) Five consecutive GAL4 sequences and the TATA sequence on the 35S promoter, as well as the downstream promoter fragments of MaHPL, MaADH and MaAAT, were constructed into the pGreenII0800LUC vector as reporters. The MaERF12 gene fragment was constructed into the 62-SKBD and 62SK vectors as emitters. The specific primer sequences are shown in Table 2.

[0062] (5) Prepare the incubation solution of Effector and Reporter to OD600 = 0.3 by mixing them in a volume ratio of 9:1;

[0063] (6) Incubate in the dark for 2 hours;

[0064] (7) Select tobacco leaves (they should be of moderate size and flat) for injection and incubate for 60 hours;

[0065] (8) The levels of firefly luciferase (LUC) and kidney luciferase (REN) in tobacco leaf samples were measured using a dual-luciferase kit (Shanghai Yisheng, catalog number: 11402ES80) with a chemiluminescence analyzer (Thermo), and the LUC / REN ratio was calculated. The LUC / REN ratio of the control group was used as the unit to determine the activity of transcriptional regulation of the target gene.

[0066] Table 2 Primers used for gene cloning

[0067]

[0068] 2. Results and Analysis

[0069] 2.1 The effect of ripening temperature on the post-harvest ripening process of banana fruits

[0070] When bananas are ripened at 20℃ for 2 days, the peel begins to turn yellow. As storage time increases, the area of ​​yellowing increases, reaching full yellow on the 4th day, which is the optimal marketable period. By the 6th day of ripening, brown spots appear on the peel, indicating that the bananas are entering senescence. Bananas ripened at 14℃ begin to turn yellow on the 8th day. At this time, some bananas are transferred to 20℃ for further ripening (recorded as 14℃ 8 days to 20℃). Bananas still stored at 14℃ are fully yellow on the 11th day, and brown spots appear on the peel on the 16th day. Bananas ripened at 20℃ are fully yellow on the 10th day (2 days after transferring to 20℃), and dark brown spots appear on the peel on the 14th day (6 days after transferring to 20℃). Therefore, compared to ripening at room temperature (20℃), ripening at a lower temperature (14℃) effectively delayed the color change of the banana peel and extended the ripening time by 10 days; the method of first ripening at 14℃ and then transferring to 20℃ on the 8th day could extend the ripening time of bananas by 8 days. Figure 1 ).

[0071] 2.2 The effect of ripening temperature on the release of volatile substances from banana pulp after harvest

[0072] When the fruit peel begins to turn yellow at different ripening temperatures (i.e., stage C), three banana samples are randomly selected from each group for the determination of volatile substances. The average and standard deviation of the peak areas of the substances measured in the three banana samples of the same group are plotted in a table. Volatile compounds are determined in the same way at other stages.

[0073] Table 3. Volatile substances in banana fruits ripened at 20℃ and 14℃ (peripheral yellowing stage).

[0074]

[0075] Table 3 shows all volatile substances in banana fruits ripened at 20℃ and 14℃ during stage C. At this stage, the types of volatile substances in both groups of samples were relatively simple, mainly aldehydes. Ten volatile substances were detected in the samples ripened at 20℃, which can be divided into four categories according to their type: seven aldehydes, one alcohol, one alkane, and argon. In contrast, the samples ripened at 14℃ showed a more limited variety of substances, including seven aldehydes and argon.

[0076] Table 3 also reveals that bananas ripened at 20℃ contain three volatile substances: dimethylsilanediol, 2,6,10,14-tetramethylhexadecane, and trans-2-octenal; bananas ripened at 14℃ contain one volatile substance: 2-heptenal.

[0077] In summary, during the C stage, the volatile substances in bananas ripened by both methods were mainly aldehydes. In addition, small amounts of alcohols and alkanes were also detected in the pulp of bananas ripened at 20°C.

[0078] Table 4. Volatile substances in banana fruits ripened at 20℃, 14℃, and 14℃ for 8 days followed by 20℃ (during the full yellowing stage of the peel).

[0079]

[0080]

[0081]

[0082] Table 4 shows that the abundance of volatile compounds in banana fruits at stage D increased under the three ripening temperatures. These compounds included aldehydes, alcohols, esters, alkanes, ketones, and alkenes. In the sample ripened at 20℃, 38 volatile compounds were detected, which could be classified into 7 categories: 3 aldehydes, 7 alcohols, 20 esters, 3 ketones, 2 alkenes, 1 alkane, and 2 other substances. In the sample ripened at 14℃, 12 volatile compounds were detected, which could be classified into 3 categories: 7 aldehydes, 4 esters, and 1 other substance. In the sample ripened from 14℃ for 8 days to 20℃, 20 substances were detected, which could be classified into 6 categories: 4 aldehydes, 12 esters, and 1 each of alcohol, alkene, ketone, and other substances.

[0083] Furthermore, Table 4 reveals 20 volatile compounds specific to bananas ripened at 20℃ when the fruit is fully yellow. These include: cis-3-octen-1-ol, 3-cyclopentyl-1-propanol, ethanol, isoamyl alcohol, 4-hexen-1-ol, cyclohexaneethanol, butyl isovalerate, 2-methylcyclohexyl acetate, 1-cycloethylbutyrate, isoamyl hexanoate, (n)butyl acetate, isobutyl butyrate, 3,6-nonadien-2-methylbutyrate isopropyl acetate, isobutyl acetate, ethyl acetate, butanoic acid, 4-phenylpropylamine ester, vinylcyclohexane, 4-heptanone, 2-heptanone, and 4-methyl-1-(1-methylethyl)cyclohexene. Bananas ripened at 14℃ exhibit 4 volatile compounds specific to them: 2-heptenal, (E,Z)-2,6-nonadienal, nonanal, and cis-2-methylcyclohexyl butyrate. Bananas ripened at 14℃ for 8 days and then at 20℃ contain two unique substances: valeric acid, 2-pentyl ester, and cyclopropane carbonate, type II ester.

[0084] In summary, 38 volatile substances were detected in the samples ripened at 20℃ during period D, belonging to 7 categories of volatile substances, including aldehydes, alcohols, esters, alkanes, ketones, and alkenes, representing the largest number and most diverse range of substances. The next largest group was the samples ripened at 14℃ for 8 days followed by 20℃, with 20 substances detected, belonging to 6 categories of volatile substances, including aldehydes, alcohols, esters, ketones, and alkenes. Finally, the samples ripened at 14℃ had the fewest substances detected, with only 12 substances, belonging to 3 categories of volatile substances, including aldehydes and esters. Among the three groups of samples, the bananas ripened at 20℃ and 14℃ for 8 days followed by 20℃ showed the highest similarity in volatile substance composition, with 17 volatile substances detectable in both groups.

[0085] At this point, the bananas ripened at all three temperatures reached a fully yellow color. The characteristic aroma of ripe yellow bananas is mainly composed of esters such as isoamyl butyrate and isoamyl acetate. However, the volatile matter analysis results showed that the 14℃ ripened fruit had significantly fewer types of volatile substances than the other two groups, containing only aldehydes and esters. At the same time, the release of characteristic esters was much lower than in the other two groups, resulting in the aroma release of bananas ripened at 14℃ being asynchronous with the changes in appearance, and the aroma release being hindered when the appearance reached its optimal commercial stage.

[0086] Table 5. Volatile substances in banana fruits ripened at 20℃, 14℃, and 14℃ for 8 days followed by 20℃ (fruit overripe stage).

[0087]

[0088]

[0089]

[0090]

[0091] During stage E, the release of volatile substances from banana fruits under the three ripening temperatures continued to increase, and the variety of substances also became more abundant (Table 5). In banana fruits ripened at 20℃, 67 volatile substances were detected, which could be divided into 7 categories: 2 aldehydes, 10 alcohols, 36 esters, 5 ketones, 3 alkenes, 4 alkanes, and 7 other substances. In banana fruits ripened at 14℃, 25 volatile substances were detected, which could be divided into 6 categories: including 4 aldehydes, 2 alcohols, 15 esters, 1 alkane, 1 ketone, and 2 other substances. In banana fruits ripened at 14℃ for 8 days and then transferred to 20℃, a total of 57 volatile substances were detected, which could be divided into 7 categories: including 2 aldehydes, 32 esters, 7 alcohols, 5 alkanes, 4 ketones, 2 alkenes, and 6 other substances.

[0092] In addition, Table 5 shows that bananas ripened at 20℃ contain 20 volatile substances, namely ethanol, isobutanol, 3-cyclohexen-1-ol, acetate, trans-2-methylcyclohexanol, trifluoroacetate, 4-penten-2-ol, acetate, acetic acid, 4-methyl-3-oxopent-1-enol ester, valeric acid, 4-pentadecanol ester, 3-methyl-3-buten-1-ol acetate, butyl isobutyrate, acetic acid, 3-acetoxy-1-(2- Acetoxy-1-methyl-ethyl)-2-methyl-propyl ester, trans-(2-ethylcyclopentyl)acetate, (3E,6E)-3,6-diallyl-2-methylbutyrate naphthyl ester, (Z)-4-decen-1-propyl carbonate, 1,5-dimethyl acetate, isobutyl isobutyrate, 1,2-epoxydodecane, 2-acetoxytetradecane, geranylacetone, 1,3-cyclohexadiene, 5-ethyl and 2-pentenoic acid, 2-methyl-2-pentenoic acid. Four specific volatile substances detected in bananas ripened at 14℃ were trans-2-nonenal, (E,Z)-2,6-nonadienal, 2-pentanol, and 2-ethyl-2-methyl-1,3-propanediol. Bananas ripened at 14℃ for 8 days and then at 20℃ contain nine unique volatile substances: 3-octen-1-ol (Z), 3-hexen-1-ol, acetic acid (E), heptyl acetate, propyl butyrate, pentyl acetate, 2,3-dioxabicyclo[2.2.1]heptane, 1-methyl, ethylene oxide, 2-(hexyn-1-yl)-3-methoxymethylene, 2-acetoxytridecane, and 3-allyl-6-methoxyphenol.

[0093] In summary, bananas ripened at 20℃ during stage E had the highest number of volatile compounds detected, totaling 67, which can be classified into seven categories: aldehydes, alcohols, esters, alkanes, ketones, and alkenes, representing the most diverse range of substances. Next, bananas ripened at 14℃ for 8 days followed by 20℃ had 57 volatile compounds detected, also classified into seven categories. Bananas ripened at 14℃ had the fewest volatile compounds detected, totaling 25, which can be classified into six categories: aldehydes, alcohols, esters, alkanes, and ketones. The volatile components from 20℃ and 14℃ for 8 days followed by 20℃ showed the highest similarity, with 46 substances detected in both groups. 19 substances were detected in both 20℃ and 14℃ ripening groups, and 20 components were found in both groups.

[0094] As bananas mature further, the amount and variety of volatile substances released also tend to increase. Figure 2Existing technology shows that during the green ripening stage of bananas, the aroma compounds are mostly aldehydes, such as hexanal and trans-2-hexenal, which have a fresh, grassy aroma, representing the characteristic aroma of bananas in the green-hard stage. During the yellow ripening stage, aldehydes begin to transform into esters, with a rapid increase in the content of esters, mainly isoamyl butyrate and isoamyl acetate, representing the characteristic aroma of yellow-ripe bananas. In the fully ripening stage, the ester content decreases slightly, and ultimately, ethanol and ethyl acetate become the characteristic volatile compounds of overripe bananas. However, in this embodiment, among the three groups of bananas ripened at different temperatures, the 14℃ ripening group consistently exhibited a single type of volatile compound (mainly aldehydes) and low or absent characteristic compounds during the post-ripening period, resulting in a decline in aroma quality.

[0095] In summary, during the post-ripening process of bananas, the changes in volatile substances are characterized by a decrease in aldehydes and an increase in esters, along with an increased diversity of volatile substances. Ultimately, the interplay of various volatile substances constitutes the characteristic aroma of bananas. Measurements of volatile substance release during the post-ripening period of bananas under three ripening methods revealed that ripening at 14℃ leads to a decrease in the amount of volatile substances released, a reduction in the diversity of volatile substances, and an obstruction of the conversion of aldehydes to esters, ultimately resulting in damage to the aroma quality of bananas at their optimal market value. Furthermore, volatile substance testing showed that if bananas ripened at 14℃ were transferred to 20℃ for further ripening before they turned completely yellow (i.e., from 14℃ for 8 days to 20℃), the amount of volatile substances released increased again, and esters could be converted normally, mitigating the aroma loss caused by ripening at 14℃ to some extent.

[0096] 2.3 Analysis of differences in volatile substances in banana pulp under different ripening temperatures

[0097] To clarify the cause of aroma loss due to ripening at 14℃, orthogonal partial least squares-discriminant analysis (OPLS-DA) was performed using the peak areas of all measured volatile compounds. Variable Importance in Projection (VIP) was obtained for each volatile compound, and differentially expressed compounds were screened using VIP, FC, and p-values. The screening criteria were VIP ≥ 1, Log2|FC| ≥ 1, and p-value < 0.05. The fit index (R²) of the independent variable was used. 2 x ), dependent variable fit index (R) 2 y ) and model prediction index (Q 2To evaluate the model's fit, the closer the above indicators are to 1, the better the OPLS-DA model fits the data.

[0098] (1) Analysis of the differences in volatile substances in banana fruits ripened at 20℃ and 14℃ during stage C

[0099] Using all 11 substances measured in bananas ripened at 20℃ and 14℃ during stage C as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA effectively distinguished banana samples from the two ripening temperatures. The R-value of the independent variable in this analysis is... 2 x The value was 0.681, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.997. 2 The value was 0.899, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0100] Table 6. Differential volatile substances in banana fruits ripened at 20℃ and 14℃ (peripheral yellowing stage).

[0101] Serial Number substance <![CDATA[log2(FC)]]> P-value VIP-value 1 Hexanal 1.18 0.01 1.24 2 Dimethylsilanediol -Inf 0.05 1.20 3 trans-2-octenal -Inf 0.03 1.21 4 2-Heptenal Inf 0.02 1.24

[0102] Note: Positive values ​​in the log2(FC) column indicate that the substance is upregulated in the 14℃ group; Inf indicates that the substance is a differential substance unique to the 14℃ group; -Inf indicates that the substance is missing in the 14℃ group.

[0103] Based on the above screening criteria, the differences in volatile compounds obtained from banana fruits ripened at 20℃ and 14℃ during stage C are shown in Table 6. In the 14℃ ripening group, the volatile compounds hexanal and 2-heptenal were significantly upregulated, while dimethylsilanediol and trans-2-octenal were significantly downregulated.

[0104] (2) Differences in volatile compounds in bananas ripened at 20℃, 14℃ and 14℃ for 8 days followed by ripening at 20℃ during stage D.

[0105] Using all 43 volatile compounds detected in bananas ripened at 20℃ and 14℃ during stage D as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA effectively distinguished banana samples from the two ripening temperatures. The fit index (R²) of the independent variables in this analysis is... 2 x The value was 0.949, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.999. 2 The value was 0.963, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0106] Table 7. Differential volatile substances in banana fruits ripened at 20℃ and 14℃ (after the peel turns completely yellow)

[0107]

[0108]

[0109] Note: Positive values ​​in the log2(FC) column indicate that the substance is upregulated in the 14℃ group; Inf indicates that the substance is a differential substance unique to the 14℃ group; -Inf indicates that the substance is missing in the 14℃ group.

[0110] Table 7 shows the differentially volatile metabolites detected in bananas ripened at 20℃ and 14℃ during stage D, based on the screening criteria described above. Hexanal was detected in both groups of samples, but its content was higher in the samples ripened at 14℃. Furthermore, bananas ripened at 14℃ showed higher levels of aldehydes, including 2-heptenal, (E,Z)-2,6-nonadienal, decanal, and nonanal, which were not detected in the samples ripened at 20℃. In addition, the fruits ripened at 14℃ lacked some esters, alcohols, and alkanes, such as cis-3-octen-1-ol, 4-methyl-1-(1-methylethyl)cyclohexene, (n)butyl acetate, hexyl butyrate, ethanol, butyl butyrate, isoamyl alcohol, cyclooctadiene, vinylcyclohexane, hexyl acetate, cyclohexaneethanol, n-hexanol, and 4-phenylpropyl butyrate.

[0111] Using all 41 substances detected in bananas ripened at 20℃ and 14℃ for 8 days followed by a transition to 20℃ during stage D as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA effectively distinguished banana samples from the two ripening temperatures. The R² value of the independent variable in this analysis was [not specified in the original text]. x The R² value was 0.903, and the dependent variable fit index (R²) was... y The model prediction index (Q) is 0.97. 2 The value was 0.922, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0112] Table 8. Differential volatile substances in banana fruits ripened at 20℃ and 14℃ for 8 days before being converted to 20℃ (after the peel turns completely yellow).

[0113]

[0114]

[0115] Note: In the log2(FC) column, a positive value indicates that the substance was upregulated in the 14℃8d to 20℃ group, and a negative value indicates that the substance was downregulated in the 14℃8d to 20℃ group; -Inf indicates that the substance was missing in the 14℃8d to 20℃ group.

[0116] According to the above screening criteria, the differentially expressed volatile compounds obtained from bananas ripened at 20℃ and 14℃ for 8 days followed by a change to 20℃ during period D are shown in Table 8. Among these, hexanal was a common volatile compound in bananas ripened at both temperatures, with a higher content in the 14℃-8 days-to-20℃ group. Butyl butyrate, cyclooctadiene, hexyl acetate, and n-hexanol were significantly downregulated in the 14℃-8 days-to-20℃ group. Furthermore, cis-3-octen-1-ol, 4-methyl-1-(1-methylethyl)cyclohexene, (n-)butyl acetate, ethanol, isoamyl alcohol, vinylcyclohexane, cyclohexaneethanol, and 4-phenylpropylamine ester were absent in bananas ripened at 14℃-8 days-to-20℃.

[0117] Using all 25 substances detected in bananas ripened at 14℃ and 14℃ for 8 days followed by 20℃ during stage D as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA effectively distinguished banana samples from the two ripening temperatures. The fit index (R²) of the independent variable in this analysis is... 2 x The coefficient of variation (R²) was 0.928, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.996. 2 The value was 0.983, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0118] Table 9. Differential volatile substances in banana fruits ripened at 14℃ and 14℃ for 8 days followed by 20℃ (after the peel turns completely yellow).

[0119] Serial Number substance <![CDATA[log2(FC)]]> P-value VIP-value 1 2-Pentanone Inf 0.04 1.21 2 Argon -Inf 0.00 1.31 3 2-Heptenal -Inf 0.04 1.24 4 (E,Z)-2,6-Nonadienal -Inf 0.03 1.26 5 Nononal -Inf 0.01 1.28

[0120] Note: Inf indicates that the substance is a differential substance unique to the 14℃8d to 20℃ group; -Inf indicates that the substance is missing in the 14℃8d to 20℃ group.

[0121] During stage D, five differentially volatile metabolites were obtained from banana fruits ripened at 14℃ and 14℃ for 8 days followed by 20℃ (Table 9). Among them, 2-pentanone was a differentially expressed substance specific to banana fruits ripened at 14℃ for 8 days followed by 20℃, while argon, 2-heptenal, (E,Z)-2,6-nonadienal, and nonanal were differentially expressed substances specific to banana fruits ripened at 14℃.

[0122] In summary, pairwise analysis of volatile compounds in bananas ripened at three different temperatures during stage D revealed that aldehydes were the main differentiating substance among the 14℃-ripened bananas compared to the other two groups, with higher levels and variety of aldehydes. Bananas ripened at 14℃ for 8 days followed by a change to 20℃ showed slightly lower volatile compound richness compared to those ripened at 20℃, but a greater variety of volatile compounds than those ripened at 14℃. This further confirms the previous conclusion that ripening at 14℃ hinders the aldehyde conversion process, and that changing the temperature during ripening can alleviate this phenomenon.

[0123] (3) Analysis of differences in volatile compounds in bananas ripened at 20℃, 14℃ and 14℃ for 8 days followed by ripening at 20℃ during the E stage.

[0124] Using all 73 substances detected in bananas ripened at 20℃ and 14℃ during stage E as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA effectively distinguished banana samples from the two ripening temperatures. The fit index (R²) of the independent variable in this analysis is... 2 x The value was 0.922, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.999. 2 The value was 0.996, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0125] Table 10. Differential volatile substances in banana fruits ripened at 20℃ and 14℃ (fruit overripe stage)

[0126]

[0127]

[0128] Note: A negative value in the log2(FC) column indicates that the substance is downregulated in the 14℃ group; Inf indicates that the substance is a differential substance unique to the 14℃ group; -Inf indicates that the substance is missing in the 14℃ group.

[0129] Table 10 shows the differentially volatile metabolites screened from bananas ripened at 20℃ and 14℃ during stage E. Among the 17 volatile substances common to both groups, hexyl isovalerate, isoamyl butyrate, isoamyl isovalerate, butyl butyrate, isoamyl acetate, vinylcyclohexane, 2-pentanone, and hexyl acetate were significantly downregulated in bananas ripened at 14℃. In addition, aroma compounds such as isobutyl hexanoate, ethanol, butyl isovalerate, isobutanol, ethyl acetate, n-hexanol, butyl isovalerate, and isobutyl isovalerate were absent in fruits ripened at 14℃, but aldehydes (such as trans-2-nonenal and (E,Z)-2,6-nonadienal) were still present in fruits ripened at 14℃, representing significant differences specific to fruits ripened at 14℃.

[0130] Using all 78 substances detected in bananas ripened at 20℃ and 14℃ for 8 days followed by a transition to 20℃ during the E period as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA was used to effectively distinguish banana samples from the two ripening temperatures. The fit index (R²) of the independent variable in this analysis is... 2 x The value was 0.867, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.997. 2 The value was 0.975, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0131] Table 11. Differential volatile substances in banana fruits ripened at 20℃ and 14℃ for 8 days followed by ripening at 20℃ (fruit overripe period).

[0132]

[0133]

[0134]

[0135] Note: In the log2(FC) column, a positive value indicates that the substance was upregulated in the 14℃8d to 20℃ group, and a negative value indicates that the substance was downregulated in the 14℃8d to 20℃ group; Inf indicates that the substance is a differential substance unique to the 14℃8d to 20℃ group; -Inf indicates that the substance was missing in the 14℃8d to 20℃ group.

[0136] In stage E, 38 differential metabolites were screened from banana fruits ripened at 20℃ and 14℃ for 8 days followed by ripening at 20℃ (Table 11). Among the volatile substances common to both groups, the contents of isoamyl isovalerate, (Z)-4-decen-1-yl-2-methylbutyrate, 5-ketohexanoate, isobutyl isovalerate, 4-heptanone, 2-heptanol, isobutyl acetate, isoamyl alcohol, and 4-hexen-1-ol were significantly downregulated in fruits ripened at 14℃ for 8 days followed by ripening at 20℃; while the contents of 1-methylbutyl butyrate, 1-cycloethylbutyrate, hexyl butyrate, butyl butyrate, 1,3-dimethylbutylbutyrate, and isobutyl hexanoate were significantly upregulated. In addition, isoamyl hexanoate, valeric acid, 1-cyclopentylethyl ester, 2,3-dioxabicyclo[2.2.1]heptane, 1-methyl, 3-allyl-6-methoxyphenol, heptyl acetate, cis-3-octen-1-ol, ethylene oxide, 2-(hexyn-1-yl)-3-methoxymethylene, propyl butyrate, 2-acetoxytridecane, acetic acid, pentyl ester and (E)-3-hexen-1-ol, acetic acid is a significantly different volatile substance unique to fruits ripened at 14℃ for 8 days and then transferred to 20℃; acetic acid, 4-methyl-3-oxopent-1-enol ester, 1,3-cyclohexadiene, 5-ethyl, valeric acid, 4-pentadecanyl ester, ethanol, isobutyrate, ... Butyl acetate, isobutanol, acetic acid, 3-acetoxy-1-(2-acetoxy-1-methyl-ethyl)-2-methyl-propyl ester, 3-cyclohexen-1-ol, acetate, trans-(2-ethylcyclopentyl)methyl acetate, 1,2-epoxydodecane, 2-pentenoic acid, 2-methyl-2-pentenoic acid, isopropyl 3,6-nonadien-2-methylbutyrate, trans-2-methylcyclohexanol, trifluoroacetate, 4-penten-2-ol, acetate, (Z)-4-decen-1-propyl carbonate, 1,5-dimethyl acetate, 2-acetoxytetradecane, and isobutyl isobutyrate were absent in fruits ripened at 14℃ for 8 days and then transferred to 20℃.

[0137] Using all 62 substances detected in bananas ripened at 14℃ and 14℃ for 8 days followed by 20℃ during the E period as the dependent variable, and different ripening temperatures as the independent variable, OPLS-DA was used to effectively distinguish banana samples from the two ripening temperatures. The fit index (R²) of the independent variable in this analysis is... 2 x The value was 0.93, and the dependent variable fit index (R²) was... 2 y The model prediction index (Q) is 0.997. 2 The value was 0.972, suggesting that this result can be used for the identification and analysis of banana fruit aroma at different storage temperatures.

[0138] Table 12. Differential volatile substances in banana fruits ripened at 14℃ and 14℃ for 8 days followed by 20℃ (overripe period)

[0139]

[0140]

[0141] Note: In the log2(FC) column, a positive value indicates that the substance was upregulated in the 14℃8d to 20℃ group, and a negative value indicates that the substance was downregulated in the 14℃8d to 20℃ group; Inf indicates that the substance is a differential substance unique to the 14℃8d to 20℃ group; -Inf indicates that the substance was missing in the 14℃8d to 20℃ group.

[0142] Table 12 shows the differentially volatile substances screened from banana fruits ripened at 14℃ and 14℃ for 8 days followed by 20℃ during stage E. Among the 19 volatile substances common to both groups, the contents of isoamyl butyrate, hexyl butyrate, butyl butyrate, isoamyl acetate, 1,3-dimethylbutylbutyrate, vinylcyclohexane, 2-pentanone, hexyl acetate, and isoamyl hexanoate were significantly upregulated in fruits ripened at 14℃ for 8 days followed by 20℃, while the content of hexanal was significantly downregulated.

[0143] Meanwhile, (Z)-4-decen-1-yl 2-methylbutyrate, isobutyl hexanoate, (n)butyl acetate, 2-heptanone, 11-dodecyn-1-ol acetate, cyclooctadiene, ethyl acetate, n-hexanol, 5-ketohexane, n-propyl acetate, butyl isovalerate, 2,4-diacetoxypentane, 4-heptanone, isobutyl butyrate, 2-heptanol, (E)-3-hexenyl butyrate, isopentanol, and methyl nonyl ketone 2,3-Dioxabicyclo[2.2.1]heptane, 1-methyl, 3-allyl-6-methoxyphenol, heptyl acetate, cis-3-octen-1-ol, ethylene oxide, 2-(hexyn-1-yl)-3-methoxymethylene, propyl butyrate, 2-acetoxytridecane, pentyl acetate, (E)-3-hexen-1-ol, acetic acid is a significant differentiating substance unique to fruits ripened at 14℃ for 8 days and then transferred to 20℃. Argon, trans-2-nonenal and (E,Z)-2,6-nonadienal are significant differentiating substances unique to fruits ripened at 14℃.

[0144] By analyzing the differential volatile metabolites of bananas ripened at 14℃ and 14℃ for 8 days followed by 20℃, it was found that the 14℃ for 8 days followed by 20℃ group produced a large amount of volatile substances such as esters, alkanes, and ketones after the temperature change, and the release amount was significantly different from that at 14℃, thus alleviating the aroma loss caused by 14℃.

[0145] In summary, pairwise comparisons of volatile substances in banana fruits at three ripening temperatures during three different periods revealed that the content of aldehydes (such as hexanal, trans-2-hexenal, and decanal) in fruits ripened at 14℃ was consistently higher than that in samples ripened using the other two methods across all three periods. Meanwhile, the content of alcohols (such as n-hexanol, isoamyl alcohol, and cis-3-octen-1-ol) and esters (such as hexyl acetate, isoamyl butyrate, and isoamyl acetate) was lower or even absent in the three periods compared to the other two groups.

[0146] 2.4 Analysis of metabolic pathways and expression of related structural genes of differentially volatile substances

[0147] The above results indicate that, at various stages of banana fruit ripening under the three ripening temperatures, the main differentially volatile metabolites were hexanal, hexanol, and hexyl acetate, all of which were enriched in the fatty acid metabolism pathway. Furthermore, the LOX pathway is the main metabolic pathway for ester synthesis, and esters (such as hexyl acetate, isobutyl acetate, isoamyl acetate, butyl butyrate, and isoamyl butyrate) are characteristic volatile substances of banana fruit during the yellow ripening stage. Therefore, subsequent qRT-PCR experiments were conducted using key structural genes in the banana fruit fatty acid metabolism pathway: MaHPL (Ma06_g15030), MaADH (Ma05_g11250), and MaAAT (Ma01_g13530). The results are as follows: Figure 3 As shown.

[0148] Figure 3Quantitative results showed that ripening temperature affected the expression of MaHPL, MaADH, and MaAAT genes, with significant differences in expression levels among fruit pulp samples ripened at the three temperatures. Specifically, MaHPL expression in the 20℃ ripening group initially increased and then decreased, with expression levels at different stages significantly higher than the other two groups. Furthermore, variable-temperature ripening had no effect on MaHPL expression; samples ripened at 14℃ for 8 days followed by a change to 20℃, and those ripened at 14℃, consistently showed a slight increase in expression levels after ripening, followed by a continuous decrease. The expression patterns of MaADH were relatively consistent across the three groups of samples: In the 20℃ ripening group, MaADH expression initially decreased after ripening, then rose to a peak when the sample turned yellow, followed by a slight decrease; in the 14℃ ripening group, the peak expression of MaADH was delayed, occurring approximately when the sample was fully yellow, followed by a slight decrease; similarly, when the sample was fully yellow, the MaADH expression in the 14℃-8d-to-20℃ ripening group increased rapidly, significantly higher than the 20℃ and 14℃ ripening groups, and then decreased slightly. MaAAT showed a trend of first increasing and then decreasing during the ripening process of all three groups of fruit: expression reached a peak at the yellowing stage, then decreased rapidly. The 14℃ and 14℃-8d-to-20℃ ripening groups inhibited MaAAT expression, with MaAAT expression levels lower than the 20℃ group at all stages. However, in the fruit ripening group that was induced to ripen at 14℃ for 8 days and then transferred to 20℃, the expression level of MaAAT increased significantly (compared to the 14℃ ripening group), and then decreased rapidly.

[0149] In summary, in the ripening method of 14℃ for 8 days followed by 20℃, the expression levels of MaADH and MaAAT genes were significantly increased after the temperature change. This phenomenon is consistent with the increase in the content and types of volatile substances in banana fruits ripened at 14℃ for 8 days followed by 20℃ during the D stage.

[0150] 2.5 MaERF12 activates the transcription of aroma synthesis genes in the fatty acid synthesis pathway.

[0151] HPL is a key enzyme in the fatty acid synthesis pathway, catalyzing the cleavage of hydroperoxide into hexanal or hexenal. Aromatic aldehydes such as hexanal and hexenal are the main sources of the fresh aroma of bananas. In this embodiment, abundant aldehydes were detected in bananas at different ripening stages. Therefore, the transcription factors regulating the key gene MaHPL in the fatty acid synthesis pathway were predicted using the Plant Transcription Factor Database (PlantTFDB). This database predicted 132 transcription factors that may regulate MaHPL. Based on previous transcriptome analysis, the expression characteristics of these predicted transcription factors during the post-ripening stage were analyzed. The ERF family transcription factor Ma08_g23930, which showed the largest fold change in gene expression during post-ripening, was selected. Its open reading frame nucleotide sequence is shown in SEQ ID NO. 21. Its gene expression showed extremely large fold changes at different stages of post-ripening in bananas ripened at 22°C: a fold change of 47 at 0d / 1d and a fold change of 20 at 1d / 7d. Meanwhile, its expression pattern is consistent with MaHPL and MaAAT. Figure 3 and Figure 4 All showed a trend of first rising and then falling.

[0152] qRT-PCR experiments revealed that the expression pattern of Ma08_g23930 at different ripening temperatures was initially elevated and then decreased, consistent with the transcriptome results: In bananas ripened at 20℃, the gene expression level continuously increased after ripening, reaching a peak at phase C, and then rapidly decreased; in bananas ripened at 14℃, the gene expression level slightly increased after ripening, reaching a peak at phase B, and then continuously decreased; in bananas ripened at 14℃ for 8 days and then transferred to 20℃, the gene expression was significantly upregulated after the temperature change, decreasing slightly at phase E, but still significantly higher than that in the 14℃ group. Figure 4 ).

[0153] Phylogenetic analysis was performed on Ma08_g23930 and all reported ERF amino acid sequences in Arabidopsis thaliana. Figure 5 The results showed that it belonged to subgroup II of the ERF family and was most similar to the amino acid sequence of Arabidopsis thaliana ERF12, so it was named MaERF12.

[0154] Furthermore, using the Jaspar database, we predicted the binding sites of Arabidopsis thaliana ERF12 with the promoters of MaHPL, MaADH, and MaAAT. We found binding sites for MaERF12 on the promoters of all three key genes in the fatty acid synthesis pathway. Therefore, we speculate that MaERF12 may be an upstream transcription factor regulating the fatty acid synthesis pathway.

[0155] To further clarify the transcriptional characteristics of MaERF12, MaERF12 and the positive control VP16 were inserted into the 62-SKBD vector as Effectors; the pGreen0800-LUC recombinant vector containing 5×GAL4 and LUC and REN reporter genes was used as the Reporter. The vectors were constructed as follows. Figure 6 (a) The recombinant plasmid containing MaERF12, the empty vector, the positive control, and the reporter gene were transformed into *Agrobacterium tumefaciens* EHA105 (psoup), respectively. The effector and reporter were mixed at a volume ratio of 9:1 and injected into tobacco leaf cells. After 60 hours, the LUC and REN values ​​were measured, and their ratios were calculated. The results are shown in (a). Figure 6 As shown in (b), when the LUC / REN value of the empty vector was set to 1, the ratio of the MaERF12 fusion plasmid was 4.59, while the expression level of the fusion plasmid containing the positive control VP16 was much higher than that of the empty vector. These results indicate that MaERF12 is a transcriptional activator.

[0156] The regulatory effects of MaERF12 on MaHPL, MaADH, and MaAAT were analyzed using a dual-luciferase reporter gene assay. The promoter sequences of MaHPL, MaADH, and MaAAT were constructed into the pGreenⅡ0800-LUC vector as the reporter, and MaERF12 was constructed into the 62SK vector as the effector. Vector construction was as follows. Figure 7 (a) in the example. Figure 7 In (b), the DLR experiment showed that MaERF12 activated the transcription of MaHPL, MaADH and MaAAT.

Claims

1. The application of overexpression of the MaERF12 gene in promoting aroma release in banana fruit, characterized in that, The nucleotide sequence of the MaERF12 gene is shown in SEQ ID NO.

21.

2. The application according to claim 1, characterized in that, This study investigates the application of the MaERF12 gene in regulating the aroma release of banana fruits under conditions of 14℃-25℃.

3. The application according to claim 2, characterized in that, This study investigates the application of the MaERF12 gene in promoting aroma release in banana fruits at 20°C.

4. The application according to claim 2, characterized in that, The expression level of the MaERF12 gene increases with increasing temperature between 14℃ and 25℃, positively regulating the release of banana fruit aroma and promoting the release and variety of volatile aroma compounds in banana fruit.

5. The application according to claim 3, characterized in that, The MaERF12 gene, under 20℃ conditions, positively regulates key genes in the fatty acid synthesis pathway, causing volatile aldehyde compounds to convert into volatile lipid compounds, thereby promoting the release of aroma from banana fruits.

6. The application according to claim 5, characterized in that, The key genes in the fatty acid synthesis pathway are MaHPL, MaADH, and MaAAT.

Citation Information

Patent Citations

  • Cloning of resistance-related MdERF014 gene in apples and application thereof

    CN108948165A

  • Banana MADS-Box Genes for Banana Ripening Control

    US20130036515A1