Application of nematode mannitol dehydrogenase gene in improving crop disease and pest resistance

By expressing the nematode mannitol dehydrogenase gene in rice and soybeans, the problem of crop susceptibility to pests and diseases has been solved, effectively enhancing resistance to pests and diseases and ensuring food security.

CN119662716BActive Publication Date: 2026-01-13ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510045749.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-13
Publication Date
2026-01-13
Estimated Expiration
2045-01-13

AI Technical Summary

Technical Problem

The lack of effective pest and disease resistance genes in existing technologies makes crops such as rice and soybeans susceptible to pests and diseases during production, affecting yield and safety.

Method used

The mannitol dehydrogenase gene from nematodes is transferred into plants for heterologous expression or overexpression to enhance plant resistance to pests and diseases. Specifically, this includes expressing the mannitol dehydrogenase gene from nematodes in rice and soybeans, using recombinant vectors and genetically engineered bacteria to modify the gene and regulate the expression level of mannitol dehydrogenase to improve resistance.

Benefits of technology

It significantly improved the resistance of rice and soybeans to insect, nematode and fungal infections, enhanced the ability to control diseases and pests, and ensured the food security of crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119662716B_ABST
    Figure CN119662716B_ABST
Patent Text Reader

Abstract

The application belongs to the field of molecular biology and genetic engineering technology, and particularly relates to application of nematode mannitol dehydrogenase gene in improving crop disease and pest resistance. The application finds that the expression of nematode mannitol dehydrogenase gene into plants can improve the resistance of plants to diseases and pests, and the influence of the expression of nematode mannitol dehydrogenase gene in rice and soybean on the disease and pest resistance of plants is specifically studied, and it is found that the knockdown of the expression of nematode mannitol dehydrogenase gene in nematodes can improve the ability of nematodes to infest plants, which indicates that the nematode mannitol dehydrogenase gene plays a negative regulation role on the infestation ability of nematodes. The application deepens the research on the mannitol dehydrogenase coding gene, provides theoretical guidance for the research on improving crop resistance and the like in production and application, and can play an important role in protecting the food safety of crops such as rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and genetic engineering, specifically relating to the application of nematode mannitol dehydrogenase in improving crop resistance to pests and diseases. Background Technology

[0002] Rice (Oryza sativa L.) is an annual herbaceous plant belonging to the Poaceae family. It is one of the earliest cultivated crops in human history and one of the world's most important food crops. It is not only the primary food source for more than half of the world's population, especially in Asia, but also has a profound impact on the agricultural economies of many countries, providing numerous employment opportunities and driving the development of related industries. Against the backdrop of population growth and climate change, stable rice production is crucial for ensuring global food security. However, rice is highly susceptible to pests and diseases during production, particularly the rice planthopper, rice stem borer, rice leaf roller, as well as rice blast and rice sheath blight—the "three insects and two diseases"—which are widespread and cause severe damage, directly threatening safe rice production and stable agricultural yields.

[0003] Crop diseases and pests refer to the phenomena that occur during plant growth and development when plants are attacked by biotic or abiotic factors, leading to disorders of plant physiological and biochemical functions, damage to anatomical structures, and changes in morphological characteristics, affecting plant growth, quality, yield, and even causing plant death. These diseases and pests can be divided into two main categories: insect pests and diseases. Insect pests typically refer to insects and mites that harm plants, while diseases are classified into non-infectious and infectious diseases based on the type of pathogen. Non-infectious diseases are caused by abiotic factors, such as nutrient deficiencies, insufficient or excessive water, low-temperature freezing damage, and high-temperature scorching; infectious diseases are caused by biotic factors and are contagious, with pathogens including fungi, bacteria, viruses, nematodes, or parasitic seed plants. The symptoms of plant diseases mainly include discoloration, necrosis, rotting, wilting, and malformation. Therefore, the prevention and control of diseases and pests is extremely crucial for crops, especially important food crops such as rice.

[0004] There are various ways to control plant diseases and pests. Besides agricultural methods such as crop rotation and deep soil tilling, practical production often requires chemical or biological control methods. These include using insecticides, fungicides, herbicides, and nematicides to directly eliminate pests and diseases, or utilizing natural enemies and microorganisms to control pests. Therefore, biological or chemical control remains an external solution to plant diseases and pests. Currently, obtaining disease- and pest-resistant plants through transgenic technology is also a major direction for solving plant diseases and pests. A key challenge in this approach is finding suitable resistance genes. Summary of the Invention

[0005] To address the need in existing technologies to find suitable genes for disease and pest resistance, this invention provides the application of nematode mannitol dehydrogenase in improving crop disease and pest resistance. The specific technical solution is as follows:

[0006] In a first aspect, this invention provides the application of a nematode mannitol dehydrogenase gene in improving crop resistance to pests and diseases, wherein the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parastie library. Hetgly10886、 Hetgly10745、Hetgly11294、Hetgly10741、Hetgly10740、Hsc_gene_22899、Hsc_gene_ 22901、Hsc_gene_25686、Hsc_gene_25687、Hsc_gene_25897、Hsc_gene_2755、Hsc_gene_ 5370、Hsc_gene_5370、Hsc_gene_5372、Hsc_gene_5629、Hsc_gene_8419、Gpal_D383_ g15530、Gpal_D383_g15541、Gr19_v10_g15265、Gr22_v10_g15578、Gr22_v10_g4659 One of the genes shown;

[0007] The pests and diseases mentioned are insect damage, nematode infection and / or fungal invasion.

[0008] Furthermore, the application method is as follows: the nematode mannitol dehydrogenase gene is transferred into plants for heterologous expression, or the nematode mannitol dehydrogenase gene is overexpressed in plants to enhance the plant's resistance to diseases and pests.

[0009] Furthermore, the nematode mannitol dehydrogenase gene is located in the Wormbase Parastie library with the gene number […]. Hetgly10886、Hetgly11294 One of the genes shown.

[0010] Furthermore, the plant is rice or soybean.

[0011] In this invention, the mannitol dehydrogenase gene of nematodes was expressed in rice and soybean. It was found that expression of the mannitol dehydrogenase gene in rice can improve the resistance of rice to brown planthopper and rice blast, while expression of the mannitol dehydrogenase gene in soybean can improve the resistance of soybean cyst nematode and Phytophthora blight. This indicates that expressing the mannitol dehydrogenase gene of nematodes in crops can improve the plant's broad resistance to pests and diseases, which is of great significance for ensuring food security of key crops such as rice.

[0012] Secondly, this invention provides the application of a recombinant vector in improving crop resistance to pests and diseases, wherein the recombinant vector contains a nematode mannitol dehydrogenase gene; the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parastie library. Hetgly10886、Hetgly10745、Hetgly11294、Hetgly10741、 Hetgly10740、Hsc_gene_22899、Hsc_gene_22901、Hsc_gene_25686、Hsc_gene_25687、Hsc_ gene_25897、Hsc_gene_2755、Hsc_gene_5370、Hsc_gene_5370、Hsc_gene_5372、Hsc_gene_ 5629、Hsc_gene_8419、Gpal_D383_g15530、Gpal_D383_g15541、Gr19_v10_g15265、Gr22_ v10_g15578、Gr22_v10_g4659 One of the genes shown;

[0013] The pests and diseases mentioned are insect damage, nematode infection and / or fungal invasion.

[0014] Thirdly, this invention provides the application of a genetically engineered bacterium in improving crop resistance to pests and diseases, wherein the genetically engineered bacterium contains a nematode mannitol dehydrogenase gene; the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parastie library. Hetgly10886、Hetgly10745、Hetgly11294、Hetgly10741、 Hetgly10740、Hsc_gene_22899、Hsc_gene_22901、Hsc_gene_25686、Hsc_gene_25687、Hsc_ gene_25897、Hsc_gene_2755、Hsc_gene_5370、Hsc_gene_5370、Hsc_gene_5372、Hsc_gene_ 5629、Hsc_gene_8419、Gpal_D383_g15530、Gpal_D383_g15541、Gr19_v10_g15265、Gr22_ v10_g15578、Gr22_v10_g4659 One of the genes shown;

[0015] The pests and diseases mentioned are insect damage, nematode infection and / or fungal invasion.

[0016] Fourthly, the present invention provides a method for constructing a plant with enhanced resistance to pests and diseases, comprising: heterologous expression or overexpression of the nematode mannitol dehydrogenase gene in the plant;

[0017] The nematode mannitol dehydrogenase gene is located in the Wormbase Parastie library with the gene number [missing information]. Hetgly10886、 Hetgly10745, Hetgly11294, Hetgly10741, Hetgly10740, Hsc_gene_22899, Hsc_gene_ 22901, Hsc_gene_25686, Hsc_gene_25687, Hsc_gene_25897, Hsc_gene_2755, Hsc_gene_ 5370, Hsc_gene_5370, Hsc_gene_5372, Hsc_gene_5629, Hsc_gene_8419, Gpal_D383_ g15530, Gpal_D383_g15541, Gr19_v10_g15265, Gr22_v10_g15578, Gr22_v10_g4659 One of the genes shown;

[0018] The pests and diseases mentioned are insect damage, nematode infection and / or fungal invasion.

[0019] Furthermore, the plant is soybean or rice.

[0020] Furthermore, the method for preparing rice plants with enhanced resistance to diseases and pests is as follows: the above-mentioned nematode mannitol dehydrogenase gene is transferred into rice for heterologous expression, thereby enhancing the rice's resistance to diseases and pests.

[0021] Furthermore, the rice plants with improved resistance to pests and diseases show increased resistance to brown planthoppers and rice blast.

[0022] Furthermore, the method for preparing soybean plants with enhanced resistance to diseases and pests is as follows: overexpressing the aforementioned nematode mannitol dehydrogenase gene in soybean plants to enhance the soybean's resistance to diseases and pests.

[0023] Furthermore, the soybean plants with improved resistance to diseases and pests show increased resistance to soybean cyst nematode and soybean Phytophthora.

[0024] Fifthly, this invention provides the application of the nematode mannitol dehydrogenase gene in regulating the ability of soybean cyst nematodes to infect plants, wherein the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parastie library. Hetgly10886, Hetgly10745, Hetgly11294, Hetgly10741, Hetgly10740, Hsc_gene_22899, Hsc_gene_22901, Hsc_gene_25686, Hsc_gene_25687, Hsc_gene_25897, Hsc_gene_2755, Hsc_gene_5370, Hsc_gene_5370, Hsc_gene_5372, Hsc_gene_5629, Hsc_gene_8419, Gpal_ D383_g15530, Gpal_D383_g15541, Gr19_v10_g15265, Gr22_v10_g15578, Gr22_v10_g4659One of the genes shown.

[0025] Furthermore, the plant in question is soybean.

[0026] Furthermore, the regulatory pathways are as follows: using gene mutation, gene knockout, gene interference, or gene silencing techniques to cause the mannitol dehydrogenase gene in nematodes to be deleted or its expression level to be reduced, thereby increasing the ability of nematodes to infect soybeans; or using gene overexpression to increase the expression level of the mannitol dehydrogenase gene in nematodes, thereby reducing the ability of nematodes to infect soybeans.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] This invention discovers that transferring the nematode mannitol dehydrogenase gene into plants can enhance plant resistance to pests and diseases. Specifically, the study investigated the effects of nematode mannitol dehydrogenase gene expression in rice and soybeans on plant resistance to pests and diseases. Furthermore, it was found that knocking down the expression of the nematode mannitol dehydrogenase gene in nematodes increases their ability to infect plants, indicating that the nematode mannitol dehydrogenase gene plays a negative regulatory role in nematode infectivity. This invention deepens the research on mannitol dehydrogenase encoding genes, providing theoretical guidance for research on improving crop resistance in production applications, and can play an important role in protecting food security for crops such as rice. Attached Figure Description

[0029] Figure 1 The diagram shows the annotation information for the functional domains of the nematode mannitol dehydrogenase gene. Figure 1 B in the diagram is a phylogenetic tree of the mannitol dehydrogenase gene in nematodes; PF01232 and PF08125 are functional domains related to mannitol dehydrogenase, and MTD represents mannitol dehydrogenase.

[0030] Figure 2 Mannitol dehydrogenase gene of nematodes Hetgly10886 and Hetgly11294 Expression levels of soybean cyst nematode at different developmental stages; where Cyst represents cysts, J2 represents uninfected larvae in the J2 stage, 10hpi represents larvae 10 hours after infection with soybeans, and 48hpi represents larvae 48 hours after infection with soybeans.

[0031] Figure 3 The image shows the enzyme activity identification results of mannitol dehydrogenase from nematodes; where A represents the reaction catalyzed by mannitol dehydrogenase from nematodes, B represents the enzyme activity determination results of two types of mannitol dehydrogenase from nematodes, Hetgly10886 and Hetgly11294, and MTD represents mannitol dehydrogenase.

[0032] Figure 4 To introduce the mannitol dehydrogenase gene from nematodes Hetgly11294The experimental results of resistance of Nipponbare rice to brown planthopper are shown in the figure. In this figure, A represents the honeydew secretion rate after brown planthopper feeding, B represents the body weight gain rate after brown planthopper feeding, and OE-Hetgly11294-1, OE-Hetgly11294-7, OE-Hetgly11294-13, and OE-Hetgly11294-14 represent the nematode mannitol dehydrogenase gene transferred into the rice. Hetgly11294 Different strains of rice.

[0033] Figure 5 To introduce the mannitol dehydrogenase gene from nematodes Hetgly10886 , Hetgly11294 The results of the observation of the resistance of Nipponbare rice and the control group rice to rice blast are shown in the figure.

[0034] Figure 6 The graph shows the expression level of the nematode mannitol dehydrogenase gene in soybean; where A represents... Hetgly10886 The relative expression levels of the gene in mannitol dehydrogenase gene overexpression in soybeans and wild-type soybeans; B is... Hetgly11294 Relative expression levels of the gene in mannitol dehydrogenase gene-overexpressing soybeans and wild-type soybeans.

[0035] Figure 7 To overexpress the nematode mannitol dehydrogenase gene Hetgly10886 , Hetgly11294 Microscopic images of soybean roots and SCN infection status in control soybean lines.

[0036] Figure 8 This is a statistical graph showing the SCN infection status of different soybean root systems; where OE-Hetgly10886 and OE-Hetgly11294 represent soybean root systems overexpressing the mannitol dehydrogenase gene, Mock represents the control group soybean root system, and OE-Hetgly10886 represents the nematode mannitol dehydrogenase gene overexpressing. Hetgly10886 The gene OE-Hetgly11294 in soybean roots indicates overexpression of the nematode mannitol dehydrogenase gene. Hetgly11294 The soybean root system with genes.

[0037] Figure 9 To overexpress the mannitol dehydrogenase gene Hetgly10886 or Hetgly11294 The results of quantitative fluorescence microscopy of soybean lines and control soybean lines after infection with Phytophthora soybean spores.

[0038] Figure 10 To overexpress the mannitol dehydrogenase gene Hetgly10886 Gene or Hetgly11294A graph showing the relative biomass of *Phytophthora sojae* after infection of soybean lines with *Phytophthora sojae* spores; where Mock represents the soybean root system of the control group, and OE-Hetgly10886 represents the overexpression of the nematode mannitol dehydrogenase gene. Hetgly10886 Soybean root system, OE-Hetgly11294 indicates overexpression of the nematode mannitol dehydrogenase gene. Hetgly11294 Soybean root system.

[0039] Figure 11 Mannitol dehydrogenase gene in soybean cyst nematodes after soaking with different dsRNAs Hetgly10886 Genes and Hetgly11294 The graph shows the results of relative gene expression level detection; where RNAi-Hetgly10886 indicates the corresponding gene expression level. Hetgly10886 The gene's dsRNA-soaked nematodes, RNAi-Hetgly11294 indicates the use of the corresponding Hetgly11294 Nematodes soaked in dsRNA of the gene.

[0040] Figure 12 For the corresponding Hetgly11294 Gene, Hetgly10886 Microscopic observation of the dsRNA of the gene and the infection effect of soybean cyst nematodes on Wm82 soybean and Forrest resistant soybean after soaking in the control group.

[0041] Figure 13 The graph shows the infection effect of soybean cyst nematodes on different soybean varieties after soaking with different dsRNAs. The infection is characterized by the proportion of total nematodes infected at the J3 and J4 stages. Here, Wm82 represents the Williams 82 soybean variety, Forrest represents the Forrest soybean variety resistant to soybean cyst nematodes, Mock represents the control group soybean roots, and RNAi-Hetgly10886 represents the soybean root system treated with the corresponding dsRNA. Hetgly10886 The gene's dsRNA-soaked nematodes, RNAi-Hetgly11294 indicates the use of the corresponding Hetgly11294 Nematodes soaked in dsRNA of the gene. Detailed Implementation

[0042] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0043] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0044] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0045] In the following examples, the rice variety used was Nipponbare; the soybean varieties used were Williams 82 and Forrest; and the soybean cyst nematode (SCN) variety used was physiological race 3 (Hg 0).

[0046] In the following examples, the methods for obtaining the overexpression vector or overexpression vector of the target gene, or the methods for designing and preparing the required primers in practice, are conventional methods.

[0047] In the following examples, stages J2, J3, and J4 refer to the developmental stages of newly hatched nematode larvae. Between each developmental stage, the nematode undergoes a molt. As the developmental stages change, the nematode's cell nucleus gradually enlarges, and the aggregation and distribution of chromosomes also differ. Using acid fuchsin staining, nematode larvae at different developmental stages can be distinguished based on their morphology. J2-stage nematodes exhibit standard linearity, J3-stage nematodes show significant swelling and thickening, especially in the abdomen, which shows an irregular swelling. J4-stage nematodes are standard lemon-shaped. The specific method of acid fuchsin staining is a conventional method and will not be described in detail here.

[0048] Example 1: Nematode mannitol dehydrogenase gene

[0049] 1. Screening and identification of mannitol dehydrogenase genes

[0050] To screen for horizontally transferred HGT genes in nematodes, a robust and conserved phylogenetic biology-based approach was employed. In the screening results of horizontally transferred genes in nematodes, the mannitol dehydrogenase (MTD) gene was identified. This gene is derived from the genus *Mesorhizobium* and acquired from a common ancestor of the genera *Nematoda*, *Cyclocystis*, and *Perforatoria*. This gene belongs to bacterial-derived horizontally transferred genes. Annotation using Egggnogmapper (v2.1.12) revealed that it possesses two functional domains related to mannitol dehydrogenase (e.g., ...). Figure 1(As shown in A in the figure). Analysis of its gene family showed that it is distributed in 3 species of *Cytocystis*, 3 species of *Coccidioidomyces*, and 1 species of *Perforatoria*, and multiple copies occurred in most nematode species.

[0051] 2. Construct a phylogenetic tree of mannitol dehydrogenase genes.

[0052] Phylogenetic trees were constructed by comparing the selected mannitol dehydrogenase genes (as shown in Table 1) with homologous sequences from bacteria such as *Mesophyta* and *Rhizobium*.

[0053] MAFFT (v 7.299) was used to align homologous sequences from the mannitol dehydrogenase gene and bacteria such as *Mestizomorpha*. TrimAl v1.4 was used to trim blurred alignment regions. Based on the alignment results, IQ-tree (1.6.12) and its optimal amino acid evolution model (LG+G4+F) with bootstrap=1000 were used to infer the phylogenetic tree (maximum likelihood method). Figure 1 (As shown in B in the diagram).

[0054] Table 1. List of mannitol dehydrogenase genes in Example 1

[0055]

[0056] 3. Time series analysis of expression levels.

[0057] To verify the biological function of this horizontally transferred gene, the soybean cyst nematode was selected as the research subject. Analysis revealed that the mannitol dehydrogenase gene has 5 copies in the soybean cyst nematode, and two copies were verified by qRT-PCR. Hetgly10886 and Hetgly11294 The expression levels of ) in cysts (Cyst), uninfected larvae (J2), 10 hours post-infection (10 hpi), and 48 hours post-infection (48 hpi) were as follows: Figure 2 As shown, it can be seen that Hetgly10886 and Hetgly11294 The expression levels of both were significantly upregulated after nematode infection; therefore, these two copies were selected for subsequent experimental verification.

[0058] 4. To verify Hetgly10886 and Hetgly11294 It does indeed have the effect of degrading mannitol, as demonstrated by enzyme activity experiments.

[0059] (1) Expression of Hetgly10886 and Hetgly11294 proteins using a prokaryotic expression system. The coding regions of the two genes were cloned into the prokaryotic expression vector pET-28a and expressed in Escherichia coli. The His-tagged Hetgly10886 and Hetgly11294 proteins were purified by nickel column affinity chromatography.

[0060] (2) Based on the enzyme activity chemical reaction formula, the enzyme activity reaction system was prepared using the obtained high-purity purified protein as follows:

[0061] Table 2 Enzyme Activity System

[0062]

[0063] In this reaction system, the absorbance at 340 nm was measured at 37 degrees Celsius for 30 minutes. The amount of enzyme required to generate 1 μmol NADH per minute was defined as 1 unit of enzyme activity (U). After measuring the enzyme activity, the specific activity was calculated using the following formula:

[0064]

[0065] Where: ∆A: Absorbance change at 340nm; ∆t: Detection time; Vt: Total volume of reaction solution, 200uL; e: Absorbance of NADH at 340nm, constant, 6.22; Vs: Detection reaction volume, 10uL; l: Pore size, 1cm; c: Original enzyme concentration, unit mg / mL.

[0066] Through the above experiments, the results of measuring Hetgly10886 and Hetgly11294 proteins were obtained as follows: Figure 3 As shown, both proteins exhibit catalytic activity towards mannitol, indicating that... Hetgly10886 Genes and Hetgly11294 The gene is the mannitol dehydrogenase gene.

[0067] Example 2: Transformation of mannitol dehydrogenase gene into rice

[0068] 1. Constructing transgenic rice containing nematode mannitol dehydrogenase

[0069] Using homologous recombination, the mannitol dehydrogenase gene of nematodes ( Hetgly10886 and Hetgly11294Overexpression vectors UBQ-Hg10886-NOST-pCAMBIA1301 and UBQ-Hg11294-NOST-pCAMBIA1301 were constructed. The correctly sequenced plasmids were transformed into Agrobacterium tumefaciens strain EHA105, and positive single clones were sent to Wuhan Aidijing Biotechnology Co., Ltd. for rice genetic transformation experiments. After obtaining transgenic rice seedlings, breeding was carried out. In the T1 generation plants, transgenic positive plants were identified using PCR and Sanger sequencing technology. Positive plants were selected for subsequent experiments.

[0070] 2. Resistance of transgenic rice to agricultural pests to mannitol dehydrogenase

[0071] To evaluate the resistance of transgenic rice to brown planthoppers, four transgenic positive plants obtained through the above procedures were used as experimental group rice materials (OE-Hetgly11294-1, OE-Hetgly11294-7, OE-Hetgly11294-13 and OE-Hetgly11294-14), and Nipponbare rice was used as control group rice material (CK). Brown planthoppers ( Nilaparvata lugens The infection experiment was conducted on rice materials. The specific experimental steps are as follows:

[0072] (1) Take 5th instar brown planthopper nymphs and place them in a cage for a period of time. Observe the emergence of 5th instar brown planthopper nymphs in the cage. Take newly emerged (within 6 hours of emergence) female brown planthopper adults and weigh the initial weight of brown planthoppers twice using a balance with a value of 0.01%. Take the average value and mark the serial number.

[0073] (2) Make a honeydew collection device using sealing film, and weigh the honeydew collection device twice using a balance with a weight of 0.01%, take the average value, and mark the serial number.

[0074] (3) Place the female adult brown planthoppers into the honeydew collection device and fix them on the rice stem. After feeding for 48 hours, weigh the final weight of the brown planthoppers and the final weight of the honeydew collection device, and calculate the weight gain ratio and honeydew content of the brown planthoppers respectively.

[0075] The results are as follows Figure 4 As shown, Figure 4 In section A, the amount of honeydew secreted by brown planthoppers after feeding on rice was statistically analyzed in the CK, OE-Hetgly11294-1, OE-Hetgly11294-7, OE-Hetgly11294-13, and OE-Hetgly11294-14 groups. Figure 4The study B statistically analyzed the weight gain of brown planthoppers after feeding on rice in the CK, OE-Hetgly11294-1, OE-Hetgly11294-7, OE-Hetgly11294-13, and OE-Hetgly11294-14 groups. It can be seen that compared with the control group, the weight gain and honeydew secretion of brown planthoppers in the leaves of transgenic rice with mannitol dehydrogenase were significantly reduced, indicating that the resistance of rice to brown planthoppers was improved. This shows that the introduction of the nematode mannitol dehydrogenase gene into rice can enhance the resistance of rice to pests.

[0076] 3. Resistance of mannitol dehydrogenase-modified rice to fungal diseases

[0077] To evaluate the resistance of transgenic rice to rice blast, four transgenic positive plants obtained through the above procedures were used as experimental group rice materials (OE-Hetgly11294-1, OE-Hetgly11294-7, OE-Hetgly11294-13 and OE-Hetgly11294-14), and Nipponbare rice was used as control group rice material (CK). The rice blast fungus (… Magnaporthe oryzae The standard strain Guy11 was used as the pathogen to conduct an infection experiment on rice. The specific experimental steps are as follows:

[0078] (1) Rice was cultivated in a greenhouse for 1-2 months, and healthy rice leaves of uniform size were selected as experimental materials.

[0079] (2) Activate the Guy11 strain of rice blast fungus and prepare a spore suspension, and then inoculate the leaves by spraying the spore suspension.

[0080] (3) After inoculation with pathogens, seal the tray with sealing film to keep it moist. After 7-10 days, identify the disease resistance of the leaves inoculated with Guy11 strain of rice blast fungus.

[0081] The results are as follows Figure 5 As shown, the leaves of transgenic rice with mannitol dehydrogenase showed a significant reduction in rice blast infection and a significant decrease in rice blast incidence, indicating that the introduction of the mannitol dehydrogenase gene into rice can inhibit fungal infection and improve the rice's resistance to fungi.

[0082] Example 3: Transfection of mannitol dehydrogenase gene into soybean

[0083] 1. Overexpression of mannitol dehydrogenase gene in soybean

[0084] Using cDNA from soybean cyst nematode Hetgly10886The gene was amplified by PCR using primers I and II, and Toyobo's KOD one PCR Master Mix. The PCR products were detected by agarose gel electrophoresis, and the target fragment was recovered by gel excision.

[0085] Primer I: C gAC gAC AAg ACC gT g ACC ATGCCTGCCCAAAATTTTGTCACGAA (where lowercase letters represent the homologous recombination vector sequence, used for homologous recombination ligation)

[0086] Primer II: gA ggA gAA gAg CCg TCA TTGACTTGCTTTGTTGCCCAA (where lowercase letters represent the homologous recombination vector sequence used for homologous recombination ligation)

[0087] Using cDNA from soybean cyst nematode Hetgly11294 The gene was amplified by PCR using primers III and IV, and Toyobo's KOD one PCR Master Mix. The PCR products were detected by agarose gel electrophoresis, and the target fragment was recovered by gel excision.

[0088] Primer III: C gAC gAC AAg ACC gT g ACC atgGCCACCCTTCTCGAATATCCG (where lowercase letters represent the homologous recombination vector sequence, used for homologous recombination ligation)

[0089] Primer IV: gA ggA gAA gAg CCg TTA GTGCTCTGCTAAATATCGCTTCAACGC (where lowercase letters represent the homologous recombination vector sequence, used for homologous recombination ligation)

[0090] The amplified Hetgly10886 and Hetgly11294 The gene fragments, along with the 35S promoter of cauliflower mosaic virus (CaMV) and the terminator of cauliflower broccoli synthase (NOS), were integrated into the binary vector pAGM4673. This backbone vector also carries an RFP fluorescent marker gene for subsequent screening of transgenic plants.

[0091] Further screening was conducted using *E. coli* transformation and colony PCR. Samples with the target band were then validated by PCR, ultimately yielding successfully ligated vectors OE-Hetgly10886 and OE-Hetgly11294. These plasmid vectors were then transformed into *Agrobacterium rhizogenes* strain ARqua1. Two days later, positive clones were picked and inoculated into selective liquid medium, cultured with shaking at 28°C, and the bacterial cells were collected and resuspended in infiltration buffer to approximately OD600 = 0.7, then incubated at room temperature for 2 h.

[0092] Finally, select robust and plump soybean cotyledons, disinfect them with 75% ethanol for 30 seconds, rinse once with water, soak them in disinfectant solution for 4 minutes, and finally soak them in water three times for five minutes each time. Place the cotyledons in an Agrobacterium suspension in a clean bench, and cut off one-fifth of the bottom of the soybean cotyledons with a blade for Agrobacterium-mediated genetic transformation. Transfer the treated cotyledons to a co-culture medium covered with sterile filter paper and culture for 3 days. After 3 days of culture on the co-culture medium, transfer the cotyledons to a rooting medium. After 14 days of culture at 28℃, observe the transformed roots using a fluorescence microscope, and select soybean roots that appear red under the microscope to obtain transgenic hairy roots overexpressing MTD (OE-Hetgly10886 and OE-Hetgly11294). In subsequent experiments, soybean roots that did not overexpress MTD were selected as a mock control group.

[0093] The expression level of the MTD gene under different treatments in the above experiments was detected using RT-qPCR technology, and the expression level was standardized using a control gene. Figure 6 The expression of the two MTD genes in MTD-overexpressing soybean lines was shown. Compared with the Mock control group, the expression of the MTD gene in both overexpressing lines OE-Hetgly10886 and OE-Hetgly11294 was significantly upregulated (p<0.05), demonstrating that the MTD gene was effectively expressed in the soybean overexpressing lines.

[0094] 2. The effect of overexpressing the mannitol gene on enhancing soybean's resistance to nematodes.

[0095] To investigate the effect of mannitol gene overexpression on soybean resistance to nematodes, soybean cyst nematode (SCN) sporangia were inoculated onto soybean roots of OE-Hetgly10886, OE-Hetgly11294, and Mock varieties. Soybean root samples were collected 14 days later (dpi) for observation and statistical analysis. The infection status of SCN at different developmental stages (J2 to J4 and sporangia) in soybean hairy roots was observed and statistically analyzed using acid fuchsin staining.

[0096] Microscopic observation results of nematode infection of soybean hairy roots are as follows: Figure 7 As shown, in the MTD gene overexpression treatment group, SCN infection was significantly reduced and development was significantly slowed, especially the number of nematodes entering the J3 and J4 stages was significantly reduced, indicating that the overexpression of both MTD genes in soybean significantly inhibited the development of soybean cyst nematode (SCN).

[0097] The statistical results of the proportion of J3 and J4 stage nematodes in the total number of infected nematodes are as follows: Figure 8 As shown, the proportion of SCN development in the MTD gene overexpression treatment group was significantly lower than that in the Mock group (p<0.05), indicating that both OE-Hetgly10886 and OE-Hetgly11294 treatments significantly reduced the proportion of nematodes developing to the late stages (J3, J4).

[0098] It can be seen that overexpression of the MTD gene significantly enhances soybean root resistance to SCN and inhibits nematode development in the roots. This finding indicates that expression of the MTD gene in soybean can improve soybean's resistance to SCN infection and has the potential for application in other plants.

[0099] 3. The effect of overexpressing the mannitol gene on enhancing the antifungal ability of soybeans

[0100] The experiment was conducted using Phytophthora soybeanis to verify the effect of overexpression of the mannitol gene on the antifungal ability of soybean.

[0101] Soybean roots of OE-Hetgly10886 and OE-Hetgly11294, as well as soybean roots from the Mock strain, prepared in this embodiment, were inoculated with *Phytophthora indicum* hyphae labeled with *Hp* and placed in petri dishes in the dark for 48 hours. After 48 hours, the size and number of fluorescent regions were observed under a microscope to compare the number of *Phytophthora indicum* spores. Simultaneously, equal lengths of the inoculated roots (the shortest root length) were cut, and total RNA was extracted. qPCR quantification using the actin gene was performed to detect the biomass of *Phytophthora indicum*.

[0102] Fluorescence quantitative microscopy image of Phytophthora spores in soybean hairy roots as shown below Figure 9As shown, it can be seen that in soybean roots overexpressing the mannitol dehydrogenase gene, the number of Phytophthora spores is significantly reduced, and the overexpression of the mannitol dehydrogenase gene significantly inhibits Phytophthora infection.

[0103] Statistical results of Phytophthora biomass in soybean hairy roots are as follows: Figure 10 As shown, the biomass of Phytophthora in soybean roots overexpressing the mannitol dehydrogenase gene was significantly reduced, further verifying that overexpression of the mannitol dehydrogenase gene inhibited Phytophthora infection.

[0104] Example 4: Effect of silencing the mannitol dehydrogenase gene on the infectivity of nematodes

[0105] To further investigate the role of the mannitol dehydrogenase gene in nematode infection, gene silencing (RNAi) technology was used to interfere with the mannitol dehydrogenase gene by synthesizing dsRNA. The specific steps are as follows:

[0106] 1. Synthesis of positive and antisense strand templates for in vitro transcription

[0107] Synthesized by PCR Hetgly10886 and Hetgly11294 The in vitro transcription of the positive and antisense strand templates was performed, and the obtained templates were washed with RNase-free water.

[0108] 2. Synthesis of dsRNA

[0109] dsRNA was synthesized according to the T7 RNAi Transcription Kit Box (Novizan Nanjing) instructions. The sequence of the dsRNA is shown in the table below:

[0110] Table 3 dsRNA sequences

[0111]

[0112] 3. Purification of dsRNA

[0113] The synthesized dsRNA was transferred to a 1.5 mL centrifuge tube, and 0.1 volume of 3 M sodium acetate (pH=5.2) was added, followed by an equal volume of isopropanol. The mixture was vortexed to mix, and immediately placed on ice for 5 min to allow slow precipitation. The mixture was then centrifuged at 14000 rpm for 10 min. The supernatant was discarded, and the sample was washed with 500 μL of 70% ethanol. The supernatant was then removed after centrifuging at 14000 rpm for 3 min. The sample was air-dried, water was added, and the concentration was measured.

[0114] 4. dsRNA soaking

[0115] The soaking steps are as follows:

[0116] (1) The soaking system is shown in the table below.

[0117] Table 4 Immersion System

[0118]

[0119] (2) The nematodes were soaked in water with gentle shaking at room temperature for 24 h. The control group was treated with sterile double-distilled water instead of dsRNA.

[0120] (3) Centrifuge at 3000 rpm for 5 min, collect nematodes, wash nematodes with DEPC H2O 5-6 times, take 3000 nematodes from each of the treatment group and the control group, centrifuge and collect, store in liquid nitrogen, and detect gene interference efficiency by qRT-PCR.

[0121] The expression level of the MTD gene under different treatment conditions in the above experiments was detected by RT-qPCR, and the expression level was standardized using a control gene. Figure 11 The expression of the MTD gene in two MTD gene silencing treatment groups (RNAi-Hetgly10886 and RNAi-Hetgly11294) was shown. Compared with the Mock control group, the expression of the MTD gene in both treatment groups was significantly downregulated (p<0.05), demonstrating the significant MTD gene silencing effect in SCN.

[0122] Gene-silenced SCNs were inoculated onto the hairy roots of Williams 82 (Wm82) and the resistant variety Forrest soybean for infection experiments. Soybean root samples were collected 14 days after inoculation (dpi), and the infection status of SCNs at different developmental stages (J2 to J4 and sporangia) in soybean hairy roots was observed under a microscope using acid fuchsin staining. Figure 12 This study demonstrates the infection status of SCNs in Wm82 and Forrest soybeans under RNAi-Hetgly10886, RNAi-Hetgly11294, and Mock control groups. The results show that the number of SCNs entering the J3 and J4 stages was significantly increased in both gene silencing treatment groups, indicating that silencing both MTD genes significantly enhanced the infectivity of SCNs.

[0123] The statistical chart showing the proportion of J3 and J4 stage nematodes in the total number of infected nematodes is shown below. Figure 13 As shown, in Wm82 and Forrest soybean varieties, the proportion of SCN development in the MTD gene silencing group was significantly higher than that in the Mock group (p<0.05). Statistical results indicate that both the RNAi-Hetgly10886 and RNAi-Hetgly11294 treatment groups significantly increased the proportion of nematodes developing to the late stages (J3, J4).

[0124] Therefore, it can be seen that silencing the MTD gene can significantly enhance the nematode's ability to infect soybeans, indicating that the MTD gene plays a negative regulatory role in the nematode's infectivity.

Claims

1. The application of the nematode mannitol dehydrogenase gene in improving crop resistance to diseases and pests, characterized in that, The nematode mannitol dehydrogenase gene is located in the Wormbase Parasite library with the gene number […]. Hetgly10886 , Hetgly11294 One of the genes shown; The pests and diseases mentioned are brown planthopper, nematode infestation, rice blast, and / or soybean blight.

2. The application according to claim 1, characterized in that, The application method involves overexpressing the mannitol dehydrogenase gene of nematodes in plants to enhance the plant's response to biotic stress.

3. The application according to claim 1, characterized in that, The crop in question is either rice or soybean.

4. The application of a recombinant vector in improving crop resistance to diseases and pests, characterized in that, The recombinant vector contains the nematode mannitol dehydrogenase gene; the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parasite library. Hetgly10886 , Hetgly11294 One of the genes shown; The pests and diseases mentioned are brown planthopper, nematode infestation, rice blast, and / or soybean blight.

5. The application of a genetically engineered bacterium in improving crop resistance to diseases and pests, characterized in that, The genetically engineered bacteria contains the nematode mannitol dehydrogenase gene; the nematode mannitol dehydrogenase gene has the gene number [missing information] in the Wormbase Parasite library. Hetgly10886 , Hetgly11294 One of the genes shown; The pests and diseases mentioned are brown planthopper, nematode infestation, rice blast, and / or soybean blight.

6. A method for constructing a plant with enhanced resistance to diseases and pests, characterized in that, include: Overexpression of the nematode mannitol dehydrogenase gene in plants; The nematode mannitol dehydrogenase gene is located in the Wormbase Parasite library with the gene number […]. Hetgly10886 , Hetgly11294 One of the genes shown; The pests and diseases mentioned are brown planthopper, nematode infestation, rice blast, and / or soybean blight.

7. The method according to claim 6, characterized in that, The plant in question is either soybean or rice.

Citation Information

Patent Citations

  • Construction method and application of soybean cyst nematode specific efficient gene silencing plant transformation vector

    CN118240861A

  • Genes Implicated In Resistance To Soybean Cyst Nematode Infection And Methods Of Their Use

    US20120260368A1