Application of circular RNA as a marker in detection of hand-foot-mouth disease complicated with nerve injury
By detecting the expression level of hsa_circ_0069335 in blood, the problem of early diagnosis of nerve damage in hand-foot-mouth disease has been solved, providing an early prediction and treatment method and reducing the risk of death for patients.
Patent Information
- Application Number
- CN202411741577.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2044-11-29
AI Technical Summary
Current technology makes it difficult to diagnose nerve damage caused by hand-foot-mouth disease in its early stages, especially in patients with no obvious symptoms, leading to inappropriate timing of treatment initiation and increasing the risk of death.
Using hsa_circ_0069335 as a biomarker, the expression level of hsa_circ_0069335 in blood samples was detected by techniques such as Northern blotting, PCR, and microarray. A kit for predicting nerve damage in hand-foot-mouth disease was developed, and hsa_circ_0069335 activators or mimics were used for treatment.
hsa_circ_0069335 exhibits excellent specificity and sensitivity in blood, enabling early prediction of nerve damage, providing an early therapeutic target, and reducing the risk of death.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_4
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of circular RNA as a marker in detection of hand-foot-mouth disease complicated with nerve injury. BACKGROUND
[0002] Enterovirus 71 (EV71) is a neurotropic single-stranded positive-sense RNA virus and is the main pathogenic factor of hand-foot-mouth disease (HFMD). It has caused large-scale epidemics around the world many times, bringing huge disease and economic burden to the world.
[0003] Hand-foot-mouth disease is mainly manifested as rash or herpes on the hands, feet, mouth and other parts, and systemic fever. In some severe cases, it can be complicated with meningitis, encephalitis, acute flaccid paralysis and myocarditis, etc. A small number of extremely severe children have fast disease progression and high risk of death. Although the main symptoms of most HFMD children are oral ulcerative blisters and hand-foot viral rash, a small number of patients can have heart-lung or nervous system complications, including aseptic meningitis, encephalitis, acute transverse myelitis, poliomyelitis-like syndrome, Guillain-Barre syndrome, acute cerebellar ataxia, etc. These complications are the main factors leading to the death of patients with hand-foot-mouth disease.
[0004] Considering that most HFMD patients have no neurological symptoms or are occult, once neurological symptoms are found, most of them progress to critical illness or even death in a short time. It is challenging to simply guide the early diagnosis of nerve injury, the degree of judgment and the starting time of protective treatment from clinical manifestations, so it is necessary to find reliable biomarkers to assist in making early clinical decisions. SUMMARY
[0005] The first aspect of the application aims to provide hsa_circ_0069335 as a marker for predicting hand-foot-mouth disease complicated with nerve injury.
[0006] The second aspect of the application aims to provide a substance for detecting hsa_circ_0069335 for use in the preparation of a product for predicting hand-foot-mouth disease complicated with nerve injury.
[0007] The third aspect of the application aims to provide a primer for detecting hsa_circ_0069335.
[0008] The fourth aspect of the application aims to provide a kit for predicting hand-foot-mouth disease complicated with nerve injury.
[0009] The fifth aspect of the application aims to provide a hsa_circ_0069335 activator or mimetic for use in the preparation of a treatment for hand-foot-mouth disease complicated with nerve injury.
[0010] In order to achieve the above-mentioned purposes of the present application, the technical scheme adopted by the present application is:
[0011] In a first aspect of the present application, hsa_circ_0069335 is provided as a marker for predicting hand-foot-mouth disease complicated with nerve injury.
[0012]
[0013] Preferably, the hand-foot-mouth disease comprises hand-foot-mouth disease caused by enterovirus 71 (EV71) infection.
[0014] Preferably, the nerve injury comprises nerve injury of brain, spinal cord; specifically, can comprise aseptic meningitis, encephalitis, brainstem encephalitis, acute transverse myelitis, poliomyelitis-like syndrome, Guillain-Barre syndrome, acute cerebellar ataxia, and causes different degrees of neurological sequelae.
[0015] In a second aspect of the present application, the use of a substance for detecting hsa_circ_0069335 in the preparation of a product for predicting hand-foot-mouth disease complicated with nerve injury is provided.
[0016] Preferably, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of Northern blotting, PCR, biochip method, nucleic acid sequencing method;
[0017] Preferably, the substance is selected from one or more of the following: a probe specific to hsa_circ_0069335, a gene chip, a PCR primer.
[0018] Preferably, the probe is an RNA probe.
[0019] Preferably, the probe comprises at least one of the following: an isotope probe, a luciferase probe, a chemiluminescent probe.
[0020] Preferably, the PCR primer comprises a small RNA primer.
[0021] Preferably, the small RNA primer comprises at least one of the following: a stem-loop method primer or a polyA tailing method primer.
[0022] Preferably, the sequence of the small RNA primer is shown in SEQ ID NO: 10, 11.
[0023] Preferably, the detection sample of the product comprises blood.
[0024] Preferably, the blood comprises at least one of the following: serum, plasma, whole blood.
[0025] Preferably, the detection sample is derived from a mammal.
[0026] Preferably, the product further comprises a substance for detecting a marker of hand-foot-mouth disease complicated with nerve injury.
[0027] Preferably, the product comprises at least one of the following: a reagent, a kit, a test paper, a chip.
[0028] In a third aspect of the present application, a primer for detecting hsa_circ_0069335 is provided, and the sequence of the primer is shown as SEQ ID NO: 2, 3.
[0029] In a fourth aspect of the present application, a kit for predicting hand-foot-mouth disease complicated with nerve injury is provided.
[0030] Preferably, the kit comprises the primer according to the third aspect of the present application.
[0031] Preferably, the kit comprises a reaction buffer.
[0032] Preferably, the kit further comprises a positive control standard and a negative control standard.
[0033] In a fifth aspect of the present application, a use of a hsa_circ_0069335 activator in the preparation of a product for treating hand-foot-mouth disease complicated with nerve injury is provided.
[0034] Preferably, the hsa_circ_0069335 activator comprises at least one of a substance for increasing the content of hsa_circ_0069335, a substance for increasing the activity of hsa_circ_0069335, or a substance for inhibiting the degradation of hsa_circ_0069335.
[0035] Preferably, the substance for increasing the content of hsa_circ_0069335 comprises at least one of hsa_circ_0069335, a hsa_circ_0069335 mimetic, or an overexpression vector of hsa_circ_0069335.
[0036] In some embodiments of the present application, the medicament further comprises a pharmaceutically acceptable excipient. The excipient is generally recognized for this purpose and is a non-active ingredient of the medicament. A compilation of pharmaceutically acceptable excipients can be found in the Handbook of Pharmaceutical excipients (2nd edition, edited by A. Wade and P. J. Weller; American Pharmaceutical Association published, Washington and The Pharmaceutical 6Gess, London, 1994); the Chinese Pharmacopoeia-Pharmaceutical Excipients Name List, etc.
[0037] Preferably, the drug is administered by using one or more methods selected from the group consisting of oral administration, injection, gold-coated gene gun bombardment, plasmid DNA-carrying reproduction-deficient bacteria method, replication-deficient adenovirus-carrying DNA method or protein encoded by the target gene, electroporation, intravenous, intrapulmonary, mucosal, intranasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal administration.
[0038] Preferably, the dosage form of the drug comprises at least one of a capsule, a tablet, a microcapsule preparation, a freeze-dried powder injection preparation, an injection, a suppository, a spray, a powder, a soft capsule, a controlled-release preparation.
[0039] The beneficial effects of the present application are:
[0040] The present application first discovered the application of hsa_circ_0069335 as a marker in predicting hand-foot-mouth disease complicated with nerve injury. Among hand-foot-mouth disease patients infected with EV71 virus, the expression level of hsa_circ_0069335 in patients with nerve injury symptoms was significantly down-regulated compared with patients without nerve injury symptoms. Further, in the external verification cohort, the presence of hsa_circ_0069335 was completely undetectable in the blood samples of patients with nerve injury symptoms, and the area under the ROC curve was 1, indicating that the patient's blood hsa_circ_0069335 level as a marker for hand-foot-mouth disease complicated with nerve injury has excellent specificity and sensitivity. In addition, hsa_circ_0069335 as a circRNA, the 3' and 5' ends are connected to form a closed circular structure, losing the PolyA tail, and therefore not sensitive to exonucleases. Compared with linear mRNA, circular RNA can exist more stably. Compared with linear RNA, the closed circular structure of circRNA provides them with a longer half-life and resistance to RNase R, which makes them potential candidates for diagnostic biomarkers and therapeutic targets.
[0041] Further, the application proves that EV71 infection can cause pathological damage to the nervous system, such as neuronal vacuolar degeneration, partial neuronal atrophy, hippocampal brain tissue edema, and reduced number of Nissl bodies in the infarction area. In addition, EV71 infection causes obvious structural damage to Schwann cells, including reduced number of organelles, severe damage to rough endoplasmic reticulum and mitochondria. However, as the viral load of EV71 decreases, the degree of pathological damage is reduced. In vitro cell experiments show that EV71 infection can significantly reduce ATP levels and promote Schwann cell apoptosis, thereby inhibiting cell growth. As the infection time is prolonged and the viral load is reduced, the cell growth state gradually improves. At the same time, EV71 inhibits the expression of miR-29b at the mRNA and protein levels, and promotes the expression of PMP22, with the most significant change at 36 h of infection. As the viral load of EV71 decreases, the expression of miR-29b and PMP22 gradually recovers. In addition, EV71 can regulate the expression of hsa_circ_0069335, which binds and co-localizes with miR-29b. Therefore, EV71 infection can cause significant damage to the nervous system, which may be related to the hsa_circ_0069335 / miR-29b / PMP22 pathway. The application provides a new therapeutic target for nerve damage caused by EV71 infection. BRIEF DESCRIPTION OF DRAWINGS
[0042] The application will be further described below in conjunction with the drawings and examples, in which:
[0043] Figure 1 Fig. 1 is the pathological change results of the brain tissue of mice after EV71 infection; wherein (A) is the immunofluorescence image of EV71 detection. The laser scanning confocal microscope is used to observe the nuclear staining (DAPI, blue fluorescence) and EV71 (green fluorescence) of the brain tissue. The magnification is 20x; (B) is the relative expression level of EV71 analyzed by immunofluorescence staining; * P<0.05 VS D1. # p<0.05 D2 VS D3; (C) is the pathological change of the brain tissue detected by H&E staining. The magnification is 400x; (D) is the Nissl body condition of the brain tissue detected by Nissl staining. The magnification is 400x; (E) is the quantitative analysis of Nissl bodies in the brain tissue; * P<0.05 VS D1. # p<0.05 D2 VS D3.
[0044] Figure 2 Fig. 2 is the pathological change results of Schwann cells and myelin of mice infected with EV71 observed by electron microscopy.
[0045] Figure 3Results of EV71 inhibiting the growth of Schwann cells, wherein: (A) Growth curve of Schwann cells, MTS method was used to evaluate cell proliferation rate; (B) Intracellular ATP content of Schwann cells was detected by ATP detection kit; (C) Flow cytometry was used to detect the apoptosis of Schwann cells. The lower left quadrant shows live cells (Annexin V - / PI -); the lower right quadrant shows early apoptotic cells (Annexin V + / PI-), the upper right quadrant shows late apoptotic cells and necrotic cells (Annexin V + / PI+); (D) Proportion of apoptotic cells of Schwann cells; the proportion is expressed as the percentage of Annexin V positive cells; * P<0.05 compared with normal value or 0h.
[0046] Figure 4 Results of EV71 enhancing the apoptosis of Schwann cells, wherein: (A) Fluorescence microscope was used to observe the results of Schwann cells; TUNEL method was used to detect DNA fragments; green-stained cells have DNA fragments; cell nucleus (DAPI) is stained with blue fluorescence. Scale bar, 20 μm; (B) Proportion of apoptotic cells of Schwann cells. The proportion is expressed as the percentage of DNA fragments; * P<0.05 VS 0h.
[0047] Figure 5 Results of EV71 regulating the expression of miR-29b and PMP22, wherein: (A) mRNA expression level of miR-29b at different time points; (B) mRNA expression level of PMP22 at different time points; (C) Protein electrophoretogram of PMP22; (D) Protein quantitative analysis of PMP22; (E) Relative expression level of PMP22 was quantitatively analyzed by immunofluorescence staining; (F) Representative images of EV71 and PMP22 staining were detected by immunofluorescence method; Laser scanning confocal microscope was used to observe the nuclear staining (DAPI, blue fluorescence), EV71 (green fluorescence) and PMP22 (red fluorescence) of Schwann cells; scale bar, 20 μm; *P<0.05 VS 0h.
[0048] Figure 6 Results of miR-29b reversing the increase of PMP22 caused by EV71 infection, wherein: (A) mRNA expression levels of PMP22, cicrRNA and miR-29b; (B) Protein electrophoretogram of PMP22 expression; (C) Expression level of PMP22 was quantitatively analyzed by immunoblotting method. *P<0.05 vs EV71 infected cells.
[0049] Figure 7Results of the relationship between hsa_circ_0069335 and miR-29b, wherein: (A) schematic diagram of the potential binding site of miR-29b in hsa_circ_0069335 sequence, in the mutated hsa_circ_0069335, 5'-AGGUGGUGC-3' in hsa_circ_0069335 is changed to 5'-CAAGAAGAUG-3'; (B) dual luciferase reporter gene detection of the binding relationship between hsa_circ_0069335 and miR-29b; (C) intracellular localization of hsa_circ_0069335 and miR-29b was detected by FISH. The staining method of Schwann cells was observed by laser scanning confocal microscopy: nuclear staining (DAPI, fluorescent blue), miR-29b staining (fluorescent green) and hsa_circ_0069335 staining (fluorescent red); the scale bar is 20 μm; *P<0.05, compared with psiCHECK-2.
[0050] Figure 8 Results of the expression of hsa_circ_0069335 in serum of the application.
[0051] Figure 9 Results of the ROC curve of hsa_circ_0069335 in the external validation cohort of the application. DETAILED DESCRIPTION
[0052] The concept and the generated technical effects of the application will be described below in conjunction with the embodiments, so as to fully understand the purpose, features and effects of the application. Obviously, the described embodiments are only part of the embodiments of the application, but not all the embodiments. Based on the embodiments of the application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the application.
[0053] All experimental data are expressed as mean and standard deviation. SPSS 22.0 software was used for statistical analysis. LSD-t test was used for comparison between two groups, and single factor analysis of variance (ANOVA) was used for comparison among multiple groups. P<0.05 was considered statistically significant.
[0054] Example 1 Screening of markers
[0055] 1. Patient inclusion and exclusion criteria
[0056] 1.1 Differential gene screening cohort: Collecting children with hand-foot-mouth disease with severe brainstem encephalitis caused by enterovirus (EV) 71 infection, where the evidence of EV71 infection is based on positive results of reverse transcription polymerase chain reaction (RT-PCR) detection of EV71 in throat, anal swab or cerebrospinal fluid (CSF) samples, and no other pathogen infection; a total of 3 cases were enrolled. The control group was 3 cases of EV71 infection patients without neurological symptoms at the same time, and the two groups were matched by age to reduce bias. Differential RNA sequencing analysis was performed on the screening cohort.
[0057] 1.2 External validation cohort: Randomly collect EV positive samples from throat, anal swab or cerebrospinal fluid (CSF) samples in the biological library of our unit, excluding those with incomplete data, non-EV infection, combined with other pathogen infection, no neurological symptoms, a total of 7 cases of EV infected children samples were collected, according to the clinical detection data showed with brainstem encephalitis and other neurological involvement. Randomly selected 3 cases of EV reverse transcription polymerase chain reaction (RT-PCR) detection results were positive but had no neurological symptoms of children, and 5 cases of etiology were negative and had no other symptoms except fever as external test cases.
[0058] The informed consent of the patients was obtained for all related experiments, and approved by the Ethics Committee of Women and Children's Medical Center Affiliated to Guangzhou Medical University.
[0059] 2. RNA sequencing analysis
[0060] 3 cases of EV71 infection with brainstem encephalitis were used as the experimental group, and 3 cases of EV71 infection without neurological symptoms were used as the control group, and the two groups were matched by age to reduce bias.
[0061] RNA sequencing analysis was performed on the internal screening cohort.
[0062] Total RNA was extracted from blood samples using Magen Hipure Total RNA Mini Kit according to the manufacturer's instructions, and then the RNA concentration was detected by Qubit 3.0 and the RNA integrity was detected by Agilent 2100 Bioanalyzer. After that, the RNA was used for library generation using QIAseq miRNA Library Kit. RNA sequencing was performed using NextSeq CN500 SE75 according to the manufacturer's protocol. After that, micro RNA-seq data analysis was performed to identify genes that changed significantly at the RNA level. The expression of each gene was checked by fragment length, and the fragment length was mapped by read count. They were standardized by the fragment number per kilobase transcript per million mapped fragments (FPKM) variation method. Finally, the differentially expressed genes were screened and sorted according to the log2FC of the difference distribution of RNA sequence (log2FC>0, up-regulated genes; log2FC<0, down-regulated genes), P value, FDR, etc.
[0063] 3、Experimental results
[0064] This example collected blood samples from 3 patients with EV71 infection brainstem encephalitis and a control group. Except for 1 sample in the experimental group with low RNA concentration, the other 5 samples were successfully subjected to micro RNA sequencing. All brainstem encephalitis patients had acute onset, fever, and rapidly developed respiratory failure on the 2nd-3rd day of onset, requiring mechanical ventilation. 3 patients all left serious neurological sequelae, including respiratory insufficiency, coma, and eventually died. While the control group patients had good prognosis.
[0065] Through comparison of differentially expressed genes, this example found that the expression level of miR-29b-3p was significantly down-regulated in EV71 infected brainstem encephalitis patients compared with patients without brainstem encephalitis (Table 1). This finding suggests that miR-29b-3p may be involved in the neurological damage caused by EV71 infection.
[0066] Table 1 Difference of miR-29b-3p between EV71 infected patients and control group
[0067]
[0068] Example 2 Phenotype study of neurological pathological changes caused by EV71 virus infection
[0069] 1、Experimental materials
[0070] 1) Cell culture and virus
[0071] An African green monkey kidney cell line (Vero cells) was cultured in DMEM-high glucose medium supplemented with 10% fetal bovine serum at 37°C, 5% CO2. Enterovirus A71 strain GZ203KL21 / GD / CHN / 2010 was isolated from a HFMD patient in Guangzhou, China (GenBank No. MF362981). EV71 was amplified in Vero cells after infection. Virus was collected at 3 days post-infection, and the virus titer in Vero cells was routinely determined by microplate dilution method and calculated by Karber method.
[0072] 2) Animals
[0073] Sixteen pregnant ICR mice were purchased from the Experimental Animal Center of Guangzhou University of Chinese Medicine and were housed in individually ventilated cages and specific pathogen-free cages, respectively. All animal studies were approved by the Animal Care and Use Ethics Committee of the Women and Children's Medical Center of Guangzhou Medical University and were in accordance with the requirements of the Guide for the Care and Use of Laboratory Animals.
[0074] Twelve mice were randomly selected for EV71 infection, and four mice were selected every 24 h for subsequent experiments. The ICR newborn mice were intracranially inoculated with EV71 strains and the experimental procedure was as follows: after anesthesia, a hole was drilled in the anterior fontanel of the mouse, and then 2 μL of virus (2 x 10 ^9 / milliliter) suspension was stereotactically injected at a speed of 0.2 μL / min.
[0075] 2. Experimental methods
[0076] After EV71 virus infection of mice, brain tissue was analyzed at 1-3 days post-infection.
[0077] Hematoxylin-eosin (HE) staining: After euthanasia of the mice, their brain tissue was fixed with 4% paraformaldehyde for more than 24 h, then dehydrated, embedded, and sectioned. After deparaffination of the sections, nuclear staining was performed with hematoxylin, followed by cytoplasmic staining with eosin. After dehydration, the sections were sealed with neutral gum, and their histopathological changes were analyzed by taking photographs.
[0078] Nissl staining: After deparaffination, the paraffin sections were stained with toluidine blue for 5 min, then washed and differentiated with 1% glacial acetic acid. Subsequently, the sections were treated with xylene for 5 min, then sealed with neutral gum. Finally, microscopic examination and image acquisition analysis were performed.
[0079] Transmission electron microscopy (TEM) examination: Tissue samples were fixed sequentially with 2.5% glutaraldehyde and 1% osmium tetroxide buffer at 4°C for 2 h, followed by dehydration with ethanol and acetone at different concentration gradients. After soaking in 1:1 acetone and resin, the samples were embedded and polymerized with the embedding agent. Ultrathin sections were then prepared and stained with uranium acetate solution at room temperature for 10–20 min. After washing, the sections were stained with lead citrate solution for 15 min, and finally observed under a TEM microscope.
[0080] Immunofluorescence: Paraffin sections were dewaxed with xylene and ethanol, and then antigen retrieval was performed using citrate antigen retrieval buffer. The sections were then treated with an autofluorescence quencher for 5 min and incubated with BSA for 30 min. After removing the blocking solution, the sections were incubated overnight at 4°C with anti-enterovirus 71 antibody (1:500), followed by incubation at room temperature in the dark with FITC-labeled secondary antibody (1:200). Finally, cell nuclei were fixed with DAPI, sections were sealed with an antifluorescence quencher, and observed under a fluorescence microscope. The levels of PMP22 and EV71 in mouse Schwann cells were detected using a similar method, with cell slides incubated overnight at 4°C with either anti-PMP22 (1:500) or anti-enterovirus 71 antibody.
[0081] 3. Experimental Results
[0082] To observe the damage caused by EV71 in mice, this study injected EV71 into mice and observed changes in their nervous system. Immunofluorescence detection of EV71-infected mice revealed that the fluorescence intensity in the hippocampus was most significant on day 1 after infection, and decreased with increasing infection time. Figure 1 The presence of AB in the middle indicates that viral load decreases with prolonged infection time. HE testing of the hippocampus showed that EV71 infection can lead to neuronal vacuolar degeneration, partial neuronal atrophy, and cerebral edema. Figure 1 (C). Meanwhile, Nissl staining results showed that EV71 infection reduced the number of Nissl bodies in the infarct area (C). Figure 1 middle DE).
[0083] Then, the structural changes in Schwann cells and myelin sheath were observed using electron microscopy. EV71 infection caused significant damage to cell structure, with some cells swelling and dissolving; the number of organelles decreased, rough endoplasmic reticulum degranulated, mitochondria severely swollen, and mitochondrial cristae ruptured and dissolved. Figure 2 However, as the viral load of EV71 decreases, the degree of cellular structural damage also decreases. Uninfected EV71 myelin sheaths are morphologically intact, densely structured, and have clear boundaries; in EV71-infected myelin sheaths, the number of intercellular myelin sheaths is reduced, the myelin sheath structure is unclear, the myelinated nerve fibers are irregularly shaped and loosely arranged, and the myelin sheath thickness is significantly thinner. Figure 2 ).
[0084] With the decrease of EV71 viral load, the pathological changes of myelin sheath were improved. This data showed that the pathological damage of brain tissue gradually decreased with the decrease of EV71 viral load.
[0085] Example 3 EV71 infection inhibits the growth of Schwann cells
[0086] 1. Experimental method
[0087] 1) Preliminary isolation and culture of Schwann cells
[0088] The ganglion was isolated from the brain of ICR mice at 1-3 days after birth, digested with trypsin, and then cultured in DMEM medium containing 10% fetal bovine serum and 2 mM glutamine for 30 min. After removing the adherent fibroblasts, 2 mL of cell suspension was taken, the seeding density was 0.2 x 10 5 cells / mL, inoculated into a 35 mm plastic culture dish coated with rat tail glue, and cultured in a 37°C incubator containing 10% CO2. On the third day of cell culture, cell division inhibitors 5-fluoro-2-deoxyuridine (15 μg / mL) and uridine (35 μg / mL) were added to further remove fibroblasts. After continuous culture for 48 h, fresh culture medium was replaced, and then replaced with half of the fresh culture medium every week. High-purity Schwann cells with a purity of 95% were obtained after 15 days of culture, and S-100 immunohistochemical staining was positive (Table 2).
[0089] Table 2 Proportion of S-100 positive cells in cultured mouse Schwann cells
[0090]
[0091] 2) MTS analysis
[0092] The cell concentration was adjusted to 1 x 10 5 cells / mL, and then inoculated into a 96-well plate at 100 μL per well. After cell adhesion, cells at different time points (0, 24, 48, and 72 h) were collected, and cell proliferation was detected using cellTiter96 AQ single solution cell proliferation detection reagent (Promega). After incubation with the detection solution for 4 h, the optical density (OD) value at 490 nm was read using a multiscan MK3
[0093] 3) Intracellular ATP content determination
[0094] The ATP content in cells was detected using an ATP detection kit (Beyotime). First, 200 μL lysis solution was added to each well of a 6-well plate for cell lysis, and then centrifuged at 4°C and 12000 g for 5 min. 100 μL ATP detection working solution was added to the supernatant, which was placed at room temperature for 3-5 min, and then the relative light unit (RLU) value was measured using a luminometer.
[0095] 4) Flow cytometry detection of apoptosis
[0096] Annexin V-FITC apoptosis detection kit (KeyGEN) and DeadEnd™ fluorescent TUNEL system (Promega) were used to detect cell apoptosis, respectively. First, the cells (including cells falling off in the culture medium) were collected and resuspended, and the cell density was adjusted to 1×10 6 cells / mL, and then 0.5 ml of cell suspension (5×10 5 cells) was mixed with 1.25 μL of Annexin V-FITC, and reacted at room temperature for 15 min in the dark. Then, the cell precipitate obtained by centrifugation at 1000×g for 5 min was resuspended and mixed with 10 μL propidium iodide, and then analyzed by flow cytometry. The experimental steps for detecting cell apoptosis using the TUNEL kit (Promega) are as follows: 4% formaldehyde solution was used for fixation at 4°C for 25 min, and 0.2% Triton X-100 was used for incubation at room temperature for 5 min; after washing with PBS, 100 μL of equilibration buffer was used for equilibration at room temperature for 10 min, and then 50 μL of TdT working solution was used for incubation at 37°C in a humidified box for 60 min in the dark. The cells were washed with 2X SSC solution and PBS, respectively, and DAPI staining solution was used for incubation at room temperature in the dark for 10 min, and then blocked with a fluorescent anti-quenching agent, and observed under a fluorescence microscope.
[0097] 2) Experimental results
[0098] Schwann cells are an important part of the myelin sheath. In order to study the damage of EV71 to the myelin sheath, we infected Schwann cells with EV71 in vitro and observed the changes in Schwann cells. MTS test showed that EV71 infection significantly inhibited cell proliferation, but this inhibitory effect weakened over time (Fig. 1A). EV71 infection significantly reduced ATP production at 48 h, 60 h and 72 h. However, there was no difference in ATP production between EV71 infected cells and the control group at 84 h (Fig. 1B). EV71 infection promoted apoptosis in a time-dependent manner, with the highest level of apoptosis at 36 h of infection, and then the level of apoptosis gradually decreased as time went on (Fig. 1C). Figure 3 Figure 3 Figure 3 (CD). At 60 h after infection, there was no significant difference in apoptosis levels between the infected and uninfected groups. These results were also confirmed by the TUNEL assay. Apoptosis levels peaked at 36 h of EV71 infection and gradually decreased over time. Figure 4 (AB). This result indicates that cell growth status gradually improves as EV71 viral load decreases.
[0099] Example 4: EV71 infection downregulates miR-29b expression and promotes PMP22 expression
[0100] 1. Experimental Methods
[0101] 1) Quantitative Real-Time PCR
[0102] Total RNA was extracted from mouse Schwann cells using Trizol, and then reverse transcribed into cDNA using the EasyScript First-Strand cDNA Synthesis SuperMix kit. Specific primers were added during the reverse transcription to detect miR-29b, PMP22, and cicrRNA. Quantitative PCR was performed using SYBR Green qPCR SuperMix (Vazyme), with three replicates per sample. Two [samples were analyzed]. ΔΔCt The relative expression levels of each gene were calculated using this method. The specific primer sequences are as follows:
[0103] miR-29b-3p:UAGCACCAUUUGAAAUCAGUGUU (SEQ ID NO: 2)
[0104] miR-29b-3p-F: 5'-ACACTCCAGCTGGGTAGCACCATTTGAAATCAG-3' (SEQ ID NO: 3).
[0105] miR-29b-3p-R: 5'-CTCAACTGGTGTCGTGGA-3' (SEQ ID NO: 4).
[0106] miR-29b-3p-RT: 5' CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACACTGA 3' (SEQ ID NO: 5).
[0107] PMP22-F: 5'-CTGCCAGCTCTTCACTCTCA-3' (SEQ ID NO: 6).
[0108] PMP22-R: 5'-GTTGACATGCCACTCACTGT 3' (SEQ ID NO: 7).
[0109] mmu_circRNA-F: 5'-CACAGCAGAAATATCACCGGATCGTC-3' (SEQ ID NO: 8).
[0110] mmu_circRNA-R: 5'-TTATTTGTAGGTGTTCATTCAGTGGC-3' (SEQ ID NO: 9).
[0111] 2) Western blotting
[0112] The mouse Schwann cells were lysed with RIPA buffer (Beyotime) to obtain total proteins. Then, the protein concentration was determined using the Micro BCA Protein Assay Kit (Sai Mei). Subsequently, the proteins were subjected to SDS-PAGE and membrane transfer. After removing the transfer solution, the membrane was incubated with anti-pmp22 antibody (1:500; Bioss) or anti-GAPDH antibody (1:1000; Bioss) at 4°C overnight, and then horseradish peroxidase (HRP)-labeled secondary antibody (1:4000; southern biotech) was added and incubated at room temperature for 2 hours. Next, the protein bands were detected using BeyoECL Plus (Beyotime) and analyzed using a gel image processing system. Density analysis was performed using Quantity One (Bio-Rad).
[0113] 3) Overexpression of miRNA-29b
[0114] The chemically synthesized miRNA-29b was purchased from Guangzhou Ribo Company (item number MIMAT000100), and the miR-29b fragment was transfected into the Schwann cells after EV71 infection of the cells.
[0115] 2, Experimental results
[0116] It was found that EV71 infection was related to PMP22, and miR-29a could target and regulate the expression of PMP22. Sequencing analysis showed that among the miR-29 family, miR-29b had a high matching degree with PMP22. Therefore, the relationship between EV71 and miR-29b-3p / PMP22 was further explored in this embodiment. EV71 inhibited the expression of miR-29b-3p and promoted the expression of PMP22. At 36 h after EV71 infection, the expression level of miR-29b was the lowest, and the expression level of PMP22 was the highest. After 36 h of EV71 infection, the expression of miR-29b gradually increased, and the expression of PMP22 gradually decreasedFigure 5 Figure 6 shows the results of Western blot analysis of PMP22 expression in Schwann cells infected with EV71 for 24 hours (A-B). Western blot analysis also showed similar results (C-D). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly as the infection time was prolonged (E-F). Figure 5 Figure 6 shows the results of Western blot analysis of PMP22 expression in Schwann cells infected with EV71 for 24 hours (A-B). Western blot analysis also showed similar results (C-D). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly as the infection time was prolonged (E-F). Figure 5 Figure 6 shows the results of Western blot analysis of PMP22 expression in Schwann cells infected with EV71 for 24 hours (A-B). Western blot analysis also showed similar results (C-D). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly as the infection time was prolonged (E-F).
[0117] Further, this embodiment tests whether the increase in miR-29b expression can reduce the increase in PMP22 caused by EV71 infection. At the mRNA level, the expression of PMP22 and cicrRNA in EV71 infected cells was significantly increased, while overexpression of miR-29b-3p reversed this phenomenon, resulting in downregulation of the expression of PMP22 and cicrRNA in EV71 infected cells (A). Figure 6 Figure 6 shows the results of Western blot analysis of PMP22 expression in Schwann cells infected with EV71 for 24 hours (A-B). Western blot analysis also showed similar results (C-D). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly as the infection time was prolonged (E-F). Figure 6 Figure 6 shows the results of Western blot analysis of PMP22 expression in Schwann cells infected with EV71 for 24 hours (A-B). Western blot analysis also showed similar results (C-D). However, from the results of immunofluorescence detection, the average fluorescence intensity of PMP22 did not change significantly as the infection time was prolonged (E-F).
[0118] Example 5 EV71 can affect the expression of hsa_circ_0069335
[0119] 1. Experimental methods
[0120] 1) Luciferase reporter assay
[0121] Hsa_circ_0069335 sequence was cloned into psiCHECK-2 vector (Promega) and mutated for potential miR-29b binding sites to obtain expression vectors containing wild-type or mutant Hsa_circ_0069335 sequence. These vectors were co-transfected with relevant miRNAs, and then luciferase activity was detected using luciferase reporter detection system (Promega).
[0122] 2) Fluorescence in situ hybridization (FISH)
[0123] Cell slides were incubated with PBS containing 0.3% Trition X-100 at room temperature for 20 min, and then with 4% paraformaldehyde at room temperature for 20 min. After PBS washing, incubate with RNA hybridization buffer at 55°C for 2h, then add 20µL denatured probe working solution and hybridize overnight at 37°C. PBS wash 3 times, DAPI staining at room temperature for 5 min. Finally, seal the slide with fluorescent anti-quenching agent and observe under a microscope.
[0124] 2. Experimental results
[0125] This embodiment further screens the circRNA that can target miR-29b-3p, and identifies the differentially expressed circRNA in EV71 infection based on the RNA sequencing results in embodiment 1. At the same time, the circRNA that can bind to miR-29b is analyzed by software. A total of 6 circRNAs that can target miR-29-3p are screened, and the intersection of two circRNAs is selected, in which hsa_circ_0069335 has the highest matching degree with miR-29b. The results are shown in Table 3.
[0126] Table 3 Screening of target circRNA of miR-29b-3p
[0127]
[0128] The sequence of the above-mentioned circRNA has been disclosed in the database cicrbank (http: / / www.circbank.cn / ), and can be queried according to the circBank ID or circBase ID, and the relevant sequence is unique.
[0129] The dual-luciferase reporter gene experiment shows that miR-29b can bind to hsa_circ_0069335, and then significantly reduce the luciferase activity. Figure 7 The FISH detection finds that miR-29b and hsa_circ_0069335 are co-localized, and mainly localized in the cytoplasm. Figure 7 Therefore, the function of hsa_circ_0069335 is related to miR-29b and is regulated by EV71.
[0130] Example 6 Verification of hsa_circ_0069335 as a marker
[0131] 1. Sample collection
[0132] The clinical detection samples of the patients in the external verification set were collected. Due to the differences in detection and treatment of different patients, the specific samples are as follows:
[0133] 7 cases of EV infection complicated with brainstem encephalitis (A1-A7): 2 samples of whole blood sediment (A1-A2), 4 samples of serum (A3-A6), and 1 sample of cerebrospinal fluid (A7).
[0134] 3 cases of EV infection without neurological symptoms (B6-B8, cerebrospinal fluid). 5 cases of negative etiology, in which 5 patients collected 5 samples of whole blood sediment and serum respectively (B1-B5).
[0135] 2. Experimental method
[0136] PCR amplification was used to detect the expression of hsa_circ_0069335 in the two groups.
[0137] PCR primer sequences are as follows:
[0138] hsa_circ_0069335-F: 5'-TCCCATATCTTTAGGGCAAGTG-3' (SEQ ID NO: 10);
[0139] hsa_circ_0069335-R: 5'-CCTGTAATGACGACGAGCAA-3' (SEQ ID NO: 11).
[0140] 3. Experimental results
[0141] 1) Cerebrospinal fluid samples
[0142] No expression of hsa_circ_0069335 was detected in the cerebrospinal fluid samples of the experimental and control groups.
[0143] 2) Cell precipitate
[0144] Table 4. Cell precipitate detection results
[0145]
[0146] In this group, the difference between the cell precipitate groups was large, and the standard error was high, so it could not be determined that the analysis and detection value was high.
[0147] 3) Serum samples
[0148] Table 5. Serum sample detection results
[0149]
[0150] The results are shown in Table 5, and the expression of hsa_circ_0069335 in the EV infection group was significantly lower than that in the control group. No expression of hsa_circ_0069335 was detected in the serum samples of the EV infection group. Figure 8 Further, the ROC curve was drawn for the verification data of the serum standard, and the results are shown in Table 5.
[0151] Figure 9 Since hsa_circ_0069335 cannot be detected in the serum samples of the EV71 infection experimental group, the AUROC result is 100%, which can be used as a specific marker for determining whether the EV71 infection hand-foot-mouth disease patient has nervous system damage.
[0152] Since hsa_circ_0069335 cannot be detected in the serum samples of the EV71 infection experimental group, the AUROC result is 100%, which can be used as a specific marker for determining whether the EV71 infection hand-foot-mouth disease patient has nervous system damage.
[0153] Meanwhile, the RNA sequencing data of Example 1 was backtracked, which might be due to the RNA sequencing data was not high in the abundance of hsa_circ_0069335, and the sequencing effect of the specific primer was not as good as that, the data result was close to the background value, and the result of hsa_circ_0069335 was not significant. In summary, EV71 infection inhibits the growth of Schwann cells, myelin formation is impaired, leading to significant damage to the nervous system, which may be related to the hsa_circ_0069335 / miR-29b / PMP22 pathway. This finding may provide a key molecular target for early warning and treatment of severe HFMD, thereby accelerating the development of drugs for treating patients with severe HFMD.
Claims
1. Use of a substance for detecting the expression level of hsa_circ_0069335 in the preparation of a product for predicting the critical brainstem encephalitis of hand-foot-mouth disease caused by enterovirus 71 infection.
2. The use according to claim 1, characterized in that: the substance comprises a substance used in one or more detection methods selected from the group consisting of PCR, biochip method.
3. The use according to claim 2, characterized in that: the substance is selected from one or more of the following: a specific probe for hsa_circ_0069335, a gene chip, a PCR primer.
4. The use according to claim 1, characterized in that: the detection sample of the product comprises blood.
5. The use according to claim 4, characterized in that: the blood comprises at least one of serum, plasma, whole blood.
Citation Information
Patent Citations
Application of embryo FYN related substrate EFS in prevention and treatment of enterovirus 71 type infection
CN105311645A
Methods and kits for detecting a risk for developing neurological or neurophysiological disorders
US20240117432A1