Nucleic acid combinations and detection methods for detecting fgfr2 gene fusion mutations in cholangiocarcinoma

Abstract

The application discloses a nucleic acid combination and a detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma. The application utilizes the characteristic that the breakpoints of FGFR2 driven fusion genes are mostly located at the end of the 17th exon of FGFR2, and develops a design method of a universal adapter based on digital PCR, so that all the fusions with the breakpoint at the end of the 17th exon of FGFR2 can be detected at one time. The application also specially designs a tail sequence Tail for the fusion specific primer, and the Tail is complementary to the sequence near the breakpoint of FGFR2 WT exon18, so that the amplification of FGFR2 WT cDNA is inhibited, and the amplification efficiency of FGFR2 fusion is greatly increased. The detection method of the application is convenient to operate, and has the characteristics of high sensitivity, high accuracy and low cost.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biomedical technology, and particularly relates to a nucleic acid combination and detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma. BACKGROUND

[0002] Intrahepatic cholangiocarcinoma (ICC) is an important subtype of cholangiocarcinoma (CCA), accounting for about 10-20% of all primary liver cancer. ICC is a deadly primary liver cancer, but the early symptoms of ICC are not obvious, and patients are usually diagnosed at the advanced and unresectable stage, with limited treatment options and poor prognosis, so there is an urgent need for timely diagnosis and treatment means.

[0003] With the development of sequencing technology, it is found that the generation of fusion genes is one of the important driving factors of cancer occurrence and progression.

[0004] In ICC, the main fusion mutation gene is Fibroblast Growth Factor Receptor 2 (FGFR2) driven fusion gene, and FGFR2 gene fusion mutation exists in more than 15% of ICC patients.

[0005] The fusion partner genes of FGFR2 in ICC are numerous, and more than 150 kinds have been found in current research; most of the FGFR2 driven fusion genes have a fixed mode in composition structure: at the N terminal, the fusion protein shares an almost identical FGFR2 part, including the complete kinase domain (FGFR2 exon1-17), at the C terminal, there is a dimerization / oligomerization domain provided by different fusion partner genes, including Bicaudal family RNA binding protein 1 (BICC1), adenosine homocysteinase 1 (AHCYL1) and Periphilin 1 (PPHLN1) and the like, and this mode shows that the breakpoints of FGFR2 driven fusion genes in cholangiocarcinoma are mostly located at the end of FGFR2 exon 17.

[0006] FGFR2 gene fusion with BICC1, AHCYL1 and other genes will continuously activate FGFR2 tyrosine kinase region and downstream signaling pathway, causing tumor occurrence. Clinical studies have found that small molecule targeted drugs such as Pemigatinib / Peimgatinib, Derazantinib / Derazantinib, Erdafitinib / Erdafitinib, Infigratinib / Infigratinib, Futibatinib / TAS-120, etc. can specifically act on FGFR2 gene fusion mutations, inhibit the activity of FGFR2 tyrosine kinase region, block its downstream signal transduction pathway, and inhibit tumor cell proliferation to achieve therapeutic effect. Therefore, detecting the FGFR2 fusion mutation state is the premise of guiding the use of targeted drugs, and it is of great significance to improve the survival rate of patients with cholangiocarcinoma, prolong the survival period and improve the quality of life.

[0007] Currently, the methods for detecting fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), real-time fluorescent PCR (RT-PCR), and next-generation sequencing (NGS) methods. The first two techniques are commonly used clinical auxiliary diagnostic methods, but the sensitivity is very limited. RT-PCR and NGS have higher sensitivity, both of which can reach 1%, but RT-PCR has limited fusion gene targets and cannot detect unknown fusions, and NGS can detect unknown fusion genes, but the detection cost is high and the detection period is long.

[0008] For example, Chinese patent document CN 112143815 B (application number 202011332715.9) discloses a nucleic acid composition and detection method for detecting human FGFR2 gene fusion mutations, which is a real-time fluorescent PCR (RT-PCR) detection method: first extract the RNA of the detection sample and reverse transcribe it into cDNA, then use the above-mentioned kit to perform real-time fluorescent PCR reaction with cDNA as template, finally determine the positive and negative of the detection sample according to the Ct value, which can simultaneously detect 18 kinds of fusion genes driven by FGFR2.

[0009] For example, Chinese patent document CN 112301115 B (application number 202011001862.8) discloses a detection method for FGFRs gene mutations based on high-throughput sequencing, including the following steps: extracting sample genomic DNA and total RNA; fragmenting genomic DNA and recovering fragmented DNA; total RNA is broken and / or primer hybridization according to total RNA quality control; synthesizing cDNA first strand; synthesizing cDNA second strand; mixing fragmented DNA and cDNA to construct a mixed library; hybridization and capture using capture probes; library amplification and purification after capture; high-throughput sequencing and mutation analysis.

[0010] Digital PCR (dPCR) is a new absolute quantitative technique, which can determine the absolute number of target molecules as low as a single copy by micro-uniting the sample, greatly improving the accuracy and sensitivity of detection, and is an effective detection method for fusion gene detection. However, the conventional dPCR detection has the same limitations as RT-PCR, that is, the detection target is limited, and unknown fusion cannot be detected. SUMMARY

[0011] The technical problem to be solved by the present application is that the conventional method for detecting fusion genes by digital PCR can only detect known fusions, and the detection target is limited. The present application provides a method for detecting FGFR2 gene fusion mutations in cholangiocarcinoma by digital PCR, which effectively breaks through the limitation of the detection target, and provides a nucleic acid combination for detecting FGFR2 gene fusion mutations in cholangiocarcinoma.

[0012] The technical solution for realizing the first object of the present application is a nucleic acid combination for detecting FGFR2 gene fusion mutations in cholangiocarcinoma, comprising the following primer and probe sequences:

[0013] The reverse transcription primer Uni-N6, wherein the Uni sequence is a fixed sequence artificially synthesized, and N represents a random primer. Optionally, the last base of the Uni sequence is A.

[0014] The Universal primer F primer is a sequence identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6.

[0015] The GSP primer-R-Tail primer, wherein the GSP primer-R primer is a sequence on the 1-17th exon of the FGFR2 transcript, and the Tail is a sequence complementary to a sequence close to the breakpoint of FGFR2 WT exon18. The specific sequence of the Tail can be adjusted, and the key is that the sequence is located on the part of FGFR2 exon18 close to Exon17, between the breakpoint and the WT probe; it can also be modified to increase the affinity, such as locked nucleotide LNA or thio modification S, etc.

[0016] The Fusion probe probe is a sequence on the 1-17th exon of the FGFR2 transcript.

[0017] The WT probe probe is any sequence on the 18th exon of the FGFR2 transcript.

[0018] The 5' end of the Fusion probe sequence is modified with a fluorescent group, the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and the WT probe sequences are different.

[0019] The 3' end of the Fusion probe sequence is modified with a quencher group, and the 3' end of the WT probe sequence is modified with a quencher group.

[0020] The length of each of the above primer or probe sequences is greater than or equal to 8 bases.

[0021] The GSP primer-R and the Fusion probe are two different sequences on the 1-17th exons of the FGFR2 transcript, and on the cDNA template, the Fusion probe is located in the upstream region of the GSP primer-R primer position.

[0022] As an option, the fluorescent group at the 5' end of the Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups.

[0023] As an option, the 3' end group of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, NFQ, Dabcyl, Eclipse quencher group, and MGB; the 3' end group of the WT probe sequence is one of BHQ1, BHQ2, BHQ3, NFQ, Dabcyl, Eclipse quencher group, and MGB; wherein MGB is a minor groove binder plus NFQ quencher group modification.

[0024] As an option, the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 1, SEQ ID NO. 8, or SEQ ID NO. 15, preferably SEQ ID NO. 1 or SEQ ID NO. 15, wherein N represents a random primer.

[0025] The gene sequence of the Universal primer F primer is SEQ ID NO. 2, SEQ ID NO. 9, or SEQ ID NO. 16;

[0026] The gene sequence of the GSP primer-R in the GSP primer-R-Tail primer is SEQ ID NO. 3, SEQ ID NO. 10 or SEQ ID NO. 17, and the gene sequence of the Tail is CGAGAGGTTGGCTGAGGTCCAAGTA or ACTGTTCGAGAGGTTGGCTGAGGTCCAAGTA. The gene sequence of the Fusion probe is SEQ ID NO. 6, SEQ ID NO. 11 or SEQ ID NO. 18.

[0027] The gene sequence of the WTprobe is SEQ ID NO. 7, SEQ ID NO. 12 or SEQ ID NO. 19.

[0028] In the Fusion probe and the WTprobe, "+" represents a locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, and 3'BHQ1 and 3'MGB are quencher group modifications.

[0029] The technical solution for achieving the second object of the application is a method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma by using the above nucleic acid combination. After the RNA of the sample to be tested is extracted, a fixed sequence Uni is introduced at the 5' end of the cDNA in the reverse transcription stage. In the digital PCR stage, the upstream primer Universal primer-F is combined with the Uni sequence, the downstream primer GSP primer R-Tail is combined with a sequence before the 3' end of the FGFR2 17th exon, the mutation probe Fusion probe is combined with a sequence between the downstream primer binding site and the 3' end of the FGFR2 17th exon, and the wild type probe WTprobe is combined with the FGFR2 18th exon.

[0030] After the amplification reaction is completed, the droplets after amplification are subjected to fluorescence signal detection, and the copy number of the FGFR2 wild type transcript and the fusion transcript is calculated by using the insertion-deletion analysis method. According to the fluorescence distribution of the droplets and the insertion-deletion analysis method, it is judged that: when the FGFR2 wild type transcript is amplified, double fluorescence labeled by the Fusion probe and the WTprobe is produced, when the FGFR2 fusion transcript is amplified, only single fluorescence labeled by the Fusion probe is produced, and the FGFR2 wild type transcript and the FGFR2 fusion transcript are distinguished; the total copy number of the mutant gene calculated by the insertion-deletion analysis is ≥1, and the positive detection is judged according to the fluorescence intensity, and the total copy number of the mutant gene is <1, and it is judged that there is no positive detection.

[0031] Further, the extracted RNA contains mRNA.

[0032] Wherein, when RNA is reversely transcribed into cDNA, the secondary structure of RNA is denatured by heating, and then rapidly cooled on ice; the reverse transcription reaction mixture is prepared on ice, and the reverse transcription reaction mixture comprises reverse transcription buffer, reverse transcription enzyme, Uni-N6 primer, RNA template and enzyme-free water.

[0033] Optionally, the reverse transcription reaction is carried out under the following conditions: first incubation at 37 DEG C for 15 min, incubation at 85 DEG C for 5 s, and finally incubation at 4 DEG C until the reverse transcription is completed.

[0034] Optionally, the digital PCR stage comprises the following steps:

[0035] S3-1, a PCR system is prepared, comprising primers and probes, PCR buffer, DNA polymerase, cDNA and enzyme-free water, wherein the primers and probes comprise Universal primer-F, GSP primer-R-Tail, Fusion probe and WT probe.

[0036] S3-2, the obtained PCR reaction system is prepared into droplets with uniform size by using a droplet generation instrument.

[0037] S3-3, the droplets are subjected to amplification reaction on a digital PCR instrument, after the reaction is completed, the amplified droplets are subjected to fluorescence signal detection, and the copy numbers of FGFR2 wild type transcript and fusion transcript are calculated by using insertion and deletion analysis method.

[0038] The present application has the following positive effects: the present application develops a design method of a universal adapter based on digital PCR, by using the characteristics that most of the breakpoints of FGFR2 driven fusion genes are located at the end of FGFR2 exon 17, and all (about 150) fusions with the breakpoint at the end of FGFR2 exon 17 can be detected at one time.

[0039] On the basis of the universal adapter, the detection method of the present application further solves the problem of competitive inhibition. The amplification of WT RNA can greatly inhibit the detection sensitivity of fusion RNA, therefore, a tail sequence Tail is specially designed for the fusion specific primer, the amplification efficiency of FGFR2 fusion is greatly increased by the complementarity between the Tail and the sequence close to the breakpoint of FGFR2 WT exon 18, so as to achieve the purpose of inhibiting the amplification of FGFR2 WT cDNA.

[0040] The application combines single-end anchoring and ddPCR amplification detection technology, which can effectively break through the problem of limited detection targets. The technical principle of the application is that a fixed sequence (Uni) is introduced at the 5' end of cDNA in the reverse transcription (RT) stage as the binding site of the universal primer (Universal primer-F), and after reverse transcription into cDNA, a sequence is selected on the FGFR2 1-17 exon (exon1-17) as the binding site of the downstream primer (GSP primer-R), which can completely amplify the entire region after FGFR2 17 exon during ddPCR. A sequence tail is added to the 5' end of the GSP primer-R in the application, which is complementary to a sequence near the breakpoint of FGFR2 WT exon18. At the same time, a sequence is selected between the downstream primer binding site and the 3' end of exon 17 as the binding site of the mutation probe (Fusion probe, 5' end fluorescent group labeled), and a sequence is selected on the 18th exon (exon18) as the binding site of the wild type probe (WT probe, 5' end fluorescent group labeled). The 5' end of the Fusion probe and the WT probe are labeled with different fluorescent groups, and the FGFR2 wild type transcript amplification produces double fluorescence labeled by Fusion probe and WT probe, and the FGFR2 fusion transcript amplification only produces single fluorescence labeled by Fusion probe, so as to distinguish FGFR2 fusion gene and FGFR2 wild type gene. Because the tail sequence at the 5' end of the fusion specific primer (GSP primer-R) is complementary to the sequence near the breakpoint of FGFR2 WT exon18, the FGFR2 WT cDNA amplification can be inhibited, and the amplification efficiency of FGFR2 fusion can be increased.

[0041] The detection method of the application is convenient to operate, and has the characteristics of high sensitivity, high accuracy, low cost and the like, and can be used as a reference for clinical drug use. BRIEF DESCRIPTION OF DRAWINGS

[0042] Figure 1 The principle diagram of the application.

[0043] Figure 2 FGFR2 GSP primer R group 1D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0044] Figure 3FGFR2 GSP primer R-Tail 1 Group 1 D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0045] Figure 4 FGFR2 GSP primer R-Tail 2 Group 1 D scatter plot: FAM channel (FGFR2 WT Type) and VIC channel (FAM cutoff: 17000; VIC cutoff: 13000).

[0046] Figure 5 FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 Group 2 D scatter plot (FAM cutoff: 17000; VIC cutoff: 13000).

[0047] Figure 6 FGFR2 GSP primer-R_NO.8 / GSP primer-R_NO.8-Tail 1 / GSP primer-R_NO.8-Tail 2 Three Group 2 D scatter plot (FAM cutoff: 20000; VIC cutoff: 11000).

[0048] Figure 7 FGFR2 GSP primer-R_NO.11 / GSP primer-R_NO.11-Tail 1 / GSP primer-R_NO.11-Tail 2 Three Group 2 D scatter plot (FAM cutoff: 25000, VIC cutoff: 8800).

[0049] Figure 8 FGFR2 GSP primer R-Tail 1 Reproducibility verification 2 D scatter plot (FAM cutoff: 20000; VIC cutoff: 13000).

[0050] Figure 9 FGFR2 GSP primer R-Tail 1 Different RNA input amount under the copy number linear relationship (FAM cutoff: 20000; VIC cutoff: 13000).

[0051] Figure 102D scatter plot for FGFR2 GSP primer R-Tail 1 clinical samples (FAM cutoff: 20000; VIC cutoff: 13000). DETAILED DESCRIPTION

[0052] The following description of several possible embodiments of the present application is intended to provide a basic understanding of the application and is not intended to identify key or critical elements of the application or to limit the scope of protection sought. It is readily understood that, according to the technical solutions of the present application, those skilled in the art can propose other implementation manners which can be mutually replaced without changing the essential spirit of the present application. Therefore, the following detailed description is only an exemplary description of the technical solutions of the present application, and should not be regarded as the whole or as a limitation or restriction on the technical solutions of the present application.

[0053] The following examples (1 and 2) and some of the primer probe sequence information involved in the test examples are as follows:

[0054]

[0055] In the table, Uni sequence is a fixed sequence artificially synthesized, N represents a random primer, + indicates a locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, and 3'BHQ1 is a quenching group modification.

[0056] The fluorescent group at the 5' end of the Fusion probe and the WT probe is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups, and the fluorescent groups at the 5' ends of the Fusion probe and the WT probe are different.

[0057] In addition to the above-mentioned BHQ1, the quenching group at the 3' end of the Fusion probe and the WT probe can also be one of BHQ2, BHQ3, Dabcyl, and Eclipse quenching groups; the group at the 3' end of the Fusion probe and the WT probe can also be modified with MGB, and the MGB is a small groove binder plus NFQ quenching group modification.

[0058] The Universal primer-F sequence is the same or partially same sequence as the Uni sequence of the RT primer (Uni-N6). The sequence in the table is the same sequence. The GSP primer-R sequence is the base sequence at positions 2886-2905 of the E1-17 region of the FGFR2 transcript (NM_022970.3). The Tail1 part of the GSP primer R-Tail 1 sequence is the reverse complement of the sequence at positions 2955-2980 of E18 of the FGFR2 transcript (NM_022970.3). The Tail2 part of the GSP primer R-Tail 2 sequence is the reverse complement of the sequence at positions 2955-2986 of E18 of the FGFR2 transcript (NM_022970.3). The GSP primer-R primer and the Fusion probe probe are two different sequences on the exon 1-17 of the FGFR2 transcript, and the Fusion probe probe is in the downstream region of the GSP primer-R primer. The WT probe probe is any sequence on the exon 18 of the FGFR2 transcript.

[0059] (Example 1)

[0060] See Figure 1 The method for detecting the FGFR2 gene fusion mutation in cholangiocarcinoma by digital PCR in the embodiment comprises the following steps:

[0061] S1, preparation of the genomic RNA of the sample to be tested.

[0062] The wax block of the sample to be tested is made into a tissue section of 10 μm. After deparaffinization, the Qiagen The genomic RNA is extracted from the sample to be tested by using the DSP FFPE Kit RNA extraction kit to obtain 20 μL of total RNA with a concentration of 100-300 ng / μL.

[0063] Any extraction method of the extracted RNA including mRNA can be selected.

[0064] Specifically, the RNA extraction method can be any one of the extraction methods such as the phenol-chloroform method, the silica gel column method, the magnetic bead method, the Trizol method and the RNeasy method, or a commercial extraction kit can be directly used.

[0065] S2, reverse transcription of the RNA into cDNA, and a fixed sequence Uni-N6 is introduced at the 5' end of the cDNA in the reverse transcription (RT) stage as the binding site of the upstream primer (Universal primer-F).

[0066] S2-1, heat the RNA at 65±5°C (65°C in this example) for 1.5-2.5 min (2 min in this example) to denature the secondary structure, and then rapidly cool on ice.

[0067] S2-2, prepare the reverse transcription reaction system as follows on ice:

[0068]

[0069]

[0070] The reverse transcription buffer (PrimeScript Buffer) and reverse transcriptase (PrimeScript RT Enzyme) are ordered from Baodai Biotechnology (Beijing) Co., Ltd. (item number: RR037A). The RNA input amount can be adjusted according to the sample type and experimental purpose. Then

[0071] S2-3, perform the reverse transcription reaction under the following conditions:

[0072] Temperature Time 37℃ 15 min 85℃ 5 sec 4℃ Incubate to the end of reverse transcription .

[0073] S3, digital PCR reaction.

[0074] S3-1, take 5 uL of the RT reaction product as the amplification template, add it to the PCR expression reagent, and prepare the following dPCR system at room temperature. After mixing uniformly, take 30 uL of the system into the droplet generation step.

[0075]

[0076]

[0077] Among them, 5X DNA Master mix is derived from Roche (item number: 09393544001), and 5X DNA Master mix includes reaction buffer, i.e., PCR buffer, DNA polymerase. The input amount of cDNA template and primer probe can be adjusted according to experimental requirements.

[0078] S3-2, use the Roche Digital LC sample splitter to prepare the obtained PCR reaction system into droplets with uniform size, and the size of the droplets is about 1 nL.

[0079] For the droplets, perform the amplification reaction and fluorescence signal detection on the Roche Digital PCR instrument under the following conditions:

[0080] ​

[0081] After the reaction, the copy number of FGFR2 wild type transcript and fusion transcript was calculated by the insertion-deletion analysis method of Digital PCR Analysis Software (Roche). The judgment was made in combination with the droplet fluorescence distribution: when the FGFR2 wild type transcript was amplified, VIC fluorescence and FAM fluorescence were generated at the same time, and when the FGFR2 fusion transcript was amplified, only VIC fluorescence was generated, thereby distinguishing the FGFR2 fusion transcript and the FGFR2 wild type transcript; the total copy number of mutant genes calculated by the insertion-deletion analysis was ≥1, and there was a positive detection in combination with the fluorescence intensity; the total copy number of mutant genes was <1, and there was no positive detection. Development Software (Roche). The judgment was made in combination with the droplet fluorescence distribution: when the FGFR2 wild type transcript was amplified, VIC fluorescence and FAM fluorescence were generated at the same time, and when the FGFR2 fusion transcript was amplified, only VIC fluorescence was generated, thereby distinguishing the FGFR2 fusion transcript and the FGFR2 wild type transcript; the total copy number of mutant genes calculated by the insertion-deletion analysis was ≥1, and there was a positive detection in combination with the fluorescence intensity; the total copy number of mutant genes was <1, and there was no positive detection.

[0082] (Example 2)

[0083] The detection method of this example is the same as that of Example 1, except that GSP primer-R-Tail 2 is used in the dPCR system, and therefore the dPCR system is as follows:

[0084]

[0085]

[0086] (Examples 3-4)

[0087] The detection method of Examples 3-4 is the same as that of Example 1, except that the primer probe sequence information used is as follows, wherein GSP primer-R_NO.8-Tail 1 is used in the dPCR system of Example 3 (i.e. the nucleic acid combination used in Example 3 is SEQ ID NO. 8, 9, 11, 12, 13), and GSP primer-R_NO.8-Tail 2 is used in the dPCR system of Example 4 (i.e. the nucleic acid combination used in Example 4 is SEQ ID NO. 8, 9, 11, 12, 14):

[0088]

[0089] (Examples 5-6)

[0090] The detection method of examples 5-6 is the same as example 1, except that the primer probe sequence information used is as follows, wherein the GSP primer-R_NO.11-Tail 1 is used in the dPCR system of example 5 (i.e. the nucleic acid combination used in example 5 is SEQ ID NO.15, 16, 18, 19, 20), and the GSP primer-R_NO.11-Tail 2 is used in the dPCR system of example 6 (i.e. the nucleic acid combination used in example 6 is SEQ ID NO.15, 16, 18, 19, 21):

[0091]

[0092] (Experimental Example 1), examples 1, 2, and the detection of the effectiveness of the scheme.

[0093] 1) FGFR2-Casp7 fusion cell line full-length RNA (8Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5Kb); 3) 1:1 mixture of FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA as positive template, normal liver cell line L02 RNA as negative control, reverse transcription according to the RT system of example 1, then take 5 μL RT product for PCR amplification.

[0094] The three groups of nucleic acid combinations tested are:

[0095] GSP-R group: SEQ ID NO.1, 2, 3, 6, 7.

[0096] Tail 1 group: SEQ ID NO.1, 2, 4, 6, 7.

[0097] Tail 2 group: SEQ ID NO.1, 2, 5, 6, 7.

[0098] After the program is completed, according to the droplet fluorescence distribution combined with insertion and deletion analysis method, it is judged whether there is positive detection, and the experimental results are shown in table 1 and table 2, and see Figure 2 to Figure 5 .

[0099] Table 1 FGFR2 GSP primer R / GSP primer R-Tail 1 / GSP primer R-Tail 2 group copy number display (FAM cutoff: 17000; VIC cutoff: 13000)

[0100]

[0101] Table 2 Difference between theoretical copy number and actual copy number of FGFR2-BICC1+Casp7 mixed at 1:1

[0102]

[0103] The results were interpreted mainly according to the fluorescence intensity reading results, and cluster analysis was performed using a 1D scatter plot. First, the fluorescence intensity of each negative experimental group was taken as a reference to divide the threshold of the two fluorescence channels (FAM+VIC). After dividing the threshold, the result graph can be divided into four quadrants. The first quadrant is the double-positive droplet area with simultaneous excitation of FAM and VIC fluorescence, the second quadrant is the single-positive droplet area with only FAM fluorescence excitation, the third quadrant is the droplet area without any excitation fluorescence, i.e. the negative droplet area, and the fourth quadrant is the single-positive droplet area with only VIC fluorescence excitation.

[0104] According to the principles of the present technology, FGFR2 wild-type template amplification will simultaneously excite FAM and VIC fluorescence, and the droplets will be gathered in the first quadrant. FGFR2 fusion template amplification will only excite VIC, and the droplets will be gathered in the fourth quadrant. Negative droplets without any excitation fluorescence should be gathered in the third quadrant.

[0105] From Figure 5 It can be seen that there are no positive droplets in the negative experimental group, indicating that there is no non-specific amplification in the system. In the GSP-R group, the first and fourth quadrants of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) show obvious droplet aggregation, i.e. double-positive droplets (green) and VIC single-positive droplets (blue), corresponding to FGFR2 wild-type detection and FGFR2 fusion detection, respectively. The results are as expected and effective.

[0106] From Figure 5 It can also be seen that in the Tail1 and Tail2 groups, in the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7), the original double-positive droplets have no green droplets in the first quadrant due to the inhibition of WT amplification. From Figure 3-4 It can also be seen that compared to Figure 2GSP-R group, the FAM channel WT amplification signal of the fusion positive template experiment group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) is significantly reduced, while the VIC channel fusion signal is significantly increased, and more points of signal are close to the high signal value 18400 due to good amplification effect, and the overall positive signal is more concentrated, and the difference of the copy number amplification can be further seen from Table 1. In addition, we also noticed that the last group of BICC1+Casp7 fusion cell lines full-length RNA 1:1 mixed, the average number of copies detected by 20 ng of the amplification was about the same as FGFR2-BICC1 and FGFR2-Casp7 respectively (Table 2). It shows that the bias for FGFR2 unknown fusion detection is small.

[0107] The above experimental results show that the present scheme can not only detect FGFR2 wild type target and FGFR2 fusion target at the same time, but also through the special design of the 5'tail of the fusion specific primer, by its complementarity with the sequence near the breakpoint of FGFR2 WT exon18, to achieve the purpose of inhibiting the amplification of FGFR2 WT cDNA, thereby greatly increasing the amplification efficiency of FGFR2 fusion. In addition to the two groups of FGFR2-driven fusion genes verified by the above experiments, the present scheme is also suitable for the detection of other FGFR2-driven fusion targets.

[0108] (Experimental Example 2), effectiveness detection of Examples 3-6.

[0109] I. Effectiveness detection of Examples 3 and 4.

[0110] 1) FGFR2-Casp7 fusion cell line full-length RNA (8Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5Kb); 3) FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA 1:1 mixture as positive template, normal liver cell line L02 RNA as negative control, according to the conditions of Example 1, reverse transcription of nucleic acid combination of Example 3 and Example 4, then take 5 μL RT product for PCR amplification.

[0111] The three groups of nucleic acid combinations of the experiment are:

[0112] GSP primer-R group NO. 8: SEQ ID NO. 8, 9, 10, 11, 12.

[0113] GSP primer-R group NO. 8_Tail 1: SEQ ID NO. 8, 9, 11, 12, 13.

[0114] GSP primer-R_NO.8_Tail 2 group: SEQ ID NO. 8, 9, 11, 12, 14.

[0115] After the program, according to the droplet fluorescence distribution combined with insertion and deletion analysis method, it is judged whether there is positive detection, and the experimental results are shown in Tables 3, 4 and see Figure 6 .

[0116] Table 3 FGFR2 GSP-R_NO.8 / GSP primer-R_NO.8_Tail 1 / GSP primer-R_NO.8_Tail 2 three groups of copy number display (FAM cutoff: 20000; VIC cutoff: 11000)

[0117]

[0118] Table 4 FGFR2-BICC1+Casp7 mixed according to 1:1 Theoretical copy number and actual copy number difference

[0119]

[0120] II. Example 5, 6 scheme effectiveness detection.

[0121] 1) FGFR2-Casp7 fusion cell line full-length RNA (8Kb); 2) FGFR2-BICC1 fusion cell line full-length RNA (5Kb); 3) FGFR2-Casp7 and FGFR2-BICC1 fusion cell line full-length RNA 1:1 mixture as positive template, normal liver cell line L02 RNA as negative control, according to the conditions of Example 1, Example 5 and Example 6 reaction primers for reverse transcription, and then 5 μL RT product is taken for PCR amplification.

[0122] The three groups of nucleic acid combinations of the test are:

[0123] GSP primer-R_NO.11 group: SEQ ID NO. 15, 16, 17, 18, 19.

[0124] GSP primer-R_NO.11_Tail 1 group: SEQ ID NO. 15, 16, 18, 19, 20.

[0125] GSP primer-R_NO.11_Tail 2 group: SEQ ID NO. 15, 16, 18, 19, 21.

[0126] After the procedure, based on the droplet fluorescence distribution and insertion / deletion analysis, it was determined whether there were any positive detections. The experimental results are shown in Tables 5 and 6, and refer to [reference needed]. Figure 7 .

[0127] Table 5 shows the copy numbers for the three groups: FGFR2 GSP-R_NO.11, GSP primer-R_NO.11_Tail 1, and GSP primer-R_NO.11_Tail 2.

[0128]

[0129] Table 6 shows the difference between the theoretical and actual copy numbers of FGFR2-BICC1+Casp7 mixed in a 1:1 ratio.

[0130]

[0131]

[0132] in conclusion:

[0133] 1. Primers NO.8 and NO.11 in Examples 3-6 showed some FAM single positive spots in the second quadrant. It is speculated that there are two reasons: 1) the VIC probe concentration is low, and FGFR2 WT binding is insufficient; 2) the WT FAM probe has insufficient specificity, which may bind to other primers to form primer dimers or extended product-primer polymers, resulting in false positives.

[0134] 2. From Figure 6 and Figure 7 It can be seen that primers NO.8 and NO.11 do not have the same specificity. Figure 5 The first set of primers was excellent, but the phenomenon of inhibiting WT amplification through Tail complementarity with WT was reproducible. In the GSP primer R-Tail 1 and GSP primer R-Tail 2 groups, the FAM value of double-positive droplets in the first quadrant of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) decreased due to the inhibition of WT amplification.

[0135] 3. As can be seen from Tables 3 and 5, compared with the GSP primer R group, the WT copy number of the fusion positive template experimental group (FGFR2-BICC1 / Casp7 / BICC1+Casp7) of these two groups was reduced to a certain extent, and the copy number of VIC channel fusion was also reduced. This may be related to the non-specific amplification of the primers themselves. Primer dimers and dimers generated during amplification can affect the detection of fusion signals.

[0136] 4. The same target was detected by the primer system in Example 1, 2, and the two primer systems in Example 3, 4 (NO. 8) and Example 5, 6 (NO. 11), but the copy number difference was quite different. Example 1 > Example 5, 6 (NO. 11) > Example 3, 4 (NO. 8), which indicated that the optimization of primers in this method was very important.

[0137] The above experimental results showed that the present scheme could not only detect FGFR2 wild type target and FGFR2 fusion target at the same time, but also through the special design of the fusion specific primer 5'tail, through its complementarity with the sequence near the breakpoint of FGFR2 WT exon18, the purpose of inhibiting the amplification of FGFR2 WT cDNA was achieved, thereby increasing the amplification efficiency of FGFR2 fusion.

[0138] (Experimental Example 3), Repetitive test

[0139] The complete FGFR2-Casp7 and FGFR2-BICC1 fusion cell line RNA 1:1 mixture was used as a positive template, and four gradient RNA input amount experimental groups of 20 ng, 10 ng, 5 ng and 2.5 ng were set, and 20 ng of normal liver cell line L02 RNA was used as a negative control, and the downstream primer Tail1 replaced GSP-R, 5 repeats for each group. According to the preparation of RT system in Example 1, reverse transcription was carried out, and then 5 μL of RT product was taken for PCR amplification. After the program ended, according to the insertion and deletion analysis method, the FGFR2 wild type and fusion copy number of each experimental group was counted. The results are shown in Table 7, see Figure 8 and Figure 9 .

[0140] Table 7 FGFR2 GSP primer R-Tail 1 different RNA input amount repetitive detection copy number (FAM cutoff: 20000; VIC cutoff: 13000)

[0141]

[0142] The above table from top to bottom is 2.5 ng, 5 ng, 10 ng and 20 ng experimental group, respectively.

[0143] From Figure 8 It can be seen that this scheme can realize the specific detection of FGFR2 fusion target for 2.5-20 ng of positive sample, and effectively inhibit the wild type copy number.

[0144] Table 7 shows that the difference of fusion detection of repeated groups at 2.5 ng input is 12%, which may be caused by the low RNA input. However, at 5 ng, 10 ng and 20 ng input, the difference of fusion and copy number detection of 5 repeated experiments is basically less than 10%, indicating that the repeatability of the scheme is good within the detection limit.

[0145] From Figure 9 It can be seen that the copy number of the system has good linear relationship under different RNA inputs, and the linear R 2 = 0.9883.

[0146] (Experimental Example 4), detection of clinical positive samples

[0147] Take 20 ng of each of 3 verified clinical RNA samples (clinical samples 1-3) that are positive for FGFR2-BICC1 and FGFR2-Casp7 fusion at the same time, and take 20 ng of normal hepatocyte line L02 RNA as a negative control. According to Example 1, prepare the RT system and perform reverse transcription. Then take 5 μL of the RT product for PCR amplification. After the program ends, use the insertion and deletion analysis method in the Roche digital PCR analysis software (Digital Development Software) to analyze the data, and the results are shown in Table 8, see Figure 10 .

[0148] Table 8 FGFR2 fusion and wild type transcript copy number of clinical positive samples

[0149]

[0150] From Figure 10 It can be seen from the results that there are obvious VIC single positive droplet clusters in the fourth quadrant of the result graphs of the 3 clinical samples, indicating that FGFR2 fusion targets exist in the 3 samples, which is consistent with the clinical detection results. And there is no droplet in the first quadrant, indicating that the wild type amplification is strongly inhibited when using this method.

[0151] The FGFR2 wild type copy number and fusion copy number in each sample obtained after data analysis and conversion are shown in Table 8, wherein fusion / wild type (copy / μL) is the analysis software output result, and fusion / wild type (copies) is the target copy number in the sample after conversion. The results show that in the system of 30 μL, the total copy number of mutant genes calculated from the 3 clinical samples is greater than 1 (total copy number = concentration (copy / μL) x volume (30 μL)), indicating that the fusion is positive. The above experimental results prove that the detection results of the scheme are consistent with the clinical detection results.

Claims

1. A nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma, comprising the following primer and probe sequences: reverse transcription primer Uni-N6, wherein the Uni sequence is a fixed sequence artificially synthesized, and N represents a random primer; Universal primer F primer, which is a sequence identical or partially identical to the Uni sequence of the reverse transcription primer Uni-N6; GSP primer-R-Tail primer, wherein the GSP primer-R primer is a sequence on the 1-17 th exon of the FGFR2 transcript, and Tail is a sequence complementary to a sequence close to the breakpoint of FGFR2 WT exon 18; Fusion probe, which is a sequence on the 1-17 th exon of the FGFR2 transcript; WT probe, which is any sequence on the 18 th exon of the FGFR2 transcript; when the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 1, the gene sequence of the Universal primer F primer is SEQ ID NO. 2, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 4 or SEQ ID NO. 5, the gene sequence of the Fusion probe is SEQ ID NO. 6, and the gene sequence of the WT probe is SEQ ID NO. 7; when the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 8, the gene sequence of the Universal primer F primer is SEQ ID NO. 9, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 13 or SEQ ID NO. 14, the gene sequence of the Fusion probe is SEQ ID NO. 11, and the gene sequence of the WT probe is SEQ ID NO. 12; when the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO. 15, the gene sequence of the Universal primer F primer is SEQ ID NO. 16, the gene sequence of the GSP primer-R-Tail primer is SEQ ID NO. 20 or SEQ ID NO. 21, the gene sequence of the Fusion probe is SEQ ID NO. 18, and the gene sequence of the WT probe is SEQ ID NO. 19; the 5' end of the Fusion probe sequence is modified with a fluorescent group, the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and the WT probe sequences are not identical. ​ ​ ​ ​ ​ ​ ​ ​ ​ The Fusion probe sequence has a quenching group modified at the 3' end, and the WT probe sequence has a quenching group modified at the 3' end. In Fusion probe and WT probe, "+" indicates locked nucleic acid (LNA) modification, 5'VIC and 5'FAM are fluorescent group modifications, 3'BHQ1 is a quencher group modification, and 3'MGB is a 3' end minor groove conjugate with NFQ quencher group modification.

2. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The last base of the Uni sequence in the reverse transcription primer Uni-N6 is A.

3. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: GSP primer-R and Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript, and on the cDNA template, the Fusion probe is located upstream of the GSP primer-R.

4. The nucleic acid combination for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to any one of claims 1 to 3, characterized in that: Each primer or probe sequence has a length of 8 bases or more.

Images