Application of KIF4B as biomarker for predicting prognosis of lung cancer patient

Abstract

The invention discloses an application of KIF4B as a biomarker for predicting prognosis of a lung cancer patient, relates to the technical field of biomedicine, and particularly relates to an application of KIF4B as a biomarker in preparation of NSCLC for prognosis and treatment. The research finds that the KIF4B gene is obviously and highly expressed in the NSCLC, and the expression of the KIF4B gene has obvious correlation with the prognosis, pathological grading, TN staging, invasion and infiltration and tumor size of the NSCLC; fluorescence multiple immunohistochemistry shows that the expression of the gene is in significant positive correlation with the expression of A549 and NCI-H1299 human NSCLC cell lines; the expression of the KIF4B gene is regulated in a targeted manner by using specific shRNA, and the expression level of the KIF4B gene is reduced, so that the proliferation and migration capabilities of NSCLC cells are greatly reduced, which indicates that the expression of the KIF4B gene is crucial to the NSCLC cells. The invention proves that the expression of the KIF4B gene is closely related to NSCLC cells, provides a new target source for prevention, diagnosis, detection and research of NSCLC, and provides a new drug preparation idea and clinical application prospect for NSCLC treatment.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of KIF4B as a biomarker in the preparation of prognostic therapeutic drugs for non-small cell lung cancer. Background Art

[0002] Non-small cell lung cancer (NSCLC) is a common type of lung cancer worldwide, accounting for about 85% of all cases, and has become one of the cancers with the highest incidence and mortality in my country. Although the development of targeted therapy and immunotherapy in recent years has brought new treatment options for NSCLC patients and improved the survival rate of patients, metastasis and recurrence after surgery still make the prognosis of a considerable number of patients poor, especially in the late stage and drug-resistant cases. Therefore, it is urgent to develop a safe and effective method to treat NSCLC and inhibit its metastasis.

[0003] The kinesin family (KIF) is a large family that relies on hydrolysis of ATP for energy and transports nutrients to cells through microtubule tracks. In recent years, it has been shown that its protein members are overexpressed in various types of cancer. Abnormal expression of KIF4B may participate in the occurrence and development of tumors by promoting cell proliferation and inhibiting cell apoptosis. However, there is no literature mentioning the role and specific regulatory mechanism of one of the members, KIF4B, in NSCLC. Therefore, KIF4B is expected to bring new breakthroughs in the precision treatment and prognosis evaluation of NSCLC, and provide new guidance for the targeted treatment of NSCLC. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention provides an application of KIF4B as a biomarker for predicting the prognosis of lung cancer patients, provides a new indicator for predicting the prognosis of lung cancer and immunotherapy response, and provides a new source of drugs for treating lung cancer.

[0005] The present invention is achieved through the following technical solutions:

[0006] Application of KIF4B gene as a biomarker in predicting the prognosis of lung cancer patients.

[0007] The use of products for detecting the above biomarkers in the preparation of a kit for predicting the prognosis of lung cancer patients.

[0008] Preferably, the kit performs diagnosis by detecting the expression of KIF4B gene in sample tissue of the subject.

[0009] Preferably, the expression of KIF4B gene is significantly downregulated in samples of patients with good prognosis for lung cancer.

[0010] The use of shRNA targeting the above biomarkers in the preparation of drugs for treating lung cancer.

[0011] A pharmaceutical composition for treating lung cancer comprises the above-mentioned shRNA and pharmaceutically acceptable excipients.

[0012] Preferably, the auxiliary material is one or more of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier and a lubricant.

[0013] Preferably, the pharmaceutical composition is an oral dosage form or a non-oral dosage form.

[0014] Preferably, the pharmaceutical composition is a tablet, capsule, powder, pill, granule, solution, suspension, syrup, injection, suppository, inhalant or spray.

[0015] Preferably, the lung cancer described in the present invention is non-small cell lung cancer.

[0016] The beneficial effects of the present invention are as follows:

[0017] The present invention provides the application of KIF4B gene in NSCLC tissue as a biomarker for lung cancer prognosis and immunotherapy prediction, and clarifies that high expression of KIF4B gene indicates a worse prognosis of NSCLC. KIF4B gene is significantly highly expressed in NSCLC, and has a significant positive correlation with the prognosis, pathological grade, TN stage, invasion and infiltration, and tumor size of NSCLC. Immunohistochemistry shows that its expression is significantly positively correlated with the expression of A549 and NCI-H1299 human NSCLC cell lines. Specific shRNA is used to target and regulate the expression of KIF4B gene, and the expression level of KIF4B gene is reduced, so that the proliferation and migration ability of lung cancer cells are greatly reduced, which shows that the expression of KIF4B gene is crucial for NSCLC cells, and provides a new target for the clinical treatment of lung cancer. The clinical prognosis of patients can be predicted by detecting the expression level of the biomarker, which has significant clinical application prospects. It provides a new target source for the prevention, diagnosis, detection and research of NSCLC, provides new ideas for drug preparation for the treatment of NSCLC and provides great clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a survival analysis curve diagram of patients expressing KIF4B in Example 1;

[0019] Figure 2 is the mRNA expression level of KIF4B in lung epithelial cells and lung cancer cells in Example 2;

[0020] Figure 3(A) Western Blot results and (B) mRNA expression levels of KIF4B knockdown in A549 and NCI-H1299 human NSCLC cells in Example 3;

[0021] Figure 4 The effect of KIF4B on the proliferation of A549 and NCI-H1299 cells in Example 3;

[0022] Figure 5 This is the effect of KIF4B on the migration of A549 and NCI-H1299 cells in Example 3. DETAILED DESCRIPTION

[0023] The present invention discloses the use of KIF4B as a biomarker in the preparation of prediction of prognosis and treatment of non-small cell lung cancer (NSCLC). Those skilled in the art can refer to the content of the present invention and appropriately improve the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the scope of the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described in the present invention without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0024] Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial sources.

[0025] The present invention will be further described below in conjunction with embodiments:

[0026] Example 1: Correlation between KIF4B gene and clinicopathological characteristics and prognosis of NSCLC patients

[0027] 1. Organize information

[0028] All liver tissue samples were from NSCLC patients receiving tumor immunotherapy at Huashan Hospital Affiliated to Fudan University. A total of 79 NSCLC tissue samples were tested in this example. All patients did not receive radiotherapy, chemotherapy, immunotherapy or other treatments before surgery or biopsy. The study of this example was approved by the Ethics Committee of Huashan Hospital Affiliated to Fudan University, and informed consent was provided by the patient or his guardian.

[0029] 2. Clinical chip IHC analysis

[0030] Tissue microarrays (YBR-HLugP89-M003 and YBR-HLug104-M002) (Shanghai Yiberui Biopharmaceuticals) were dewaxed with xylene and rehydrated with gradient ethanol. High temperature and high pressure antigen retrieval was performed at about 95°C for 10 min, and then cooled naturally to room temperature. Tissue microarrays were blocked with blocking buffer for 10 min, and primary antibodies (anti-KIF4B, affbiotech) were added at 4°C overnight. The next day, they were taken out and rewarmed for 30 min, and secondary antibody polymers were added at room temperature and incubated in the dark for 10 min, and DAPI colorimetric reagent was added. After redyeing and dehydration, the slides were scanned after sealing.

[0031] 3. Data Analysis

[0032] The Mann-Whitney U test was used to compare the differences in KIF4B expression levels between different groups. The Kaplan-Meier survival curve was used to estimate the overall survival (OS) of different groups, and the Log-rank test was used to compare whether the differences in the survival curves of each group were statistically significant. P<0.05 indicated that the difference was statistically significant.

[0033] 4. Experimental Results

[0034] Table 1 Correlation between KIF4B gene expression and clinical characteristics

[0035]

[0036] As shown in Table 1, high expression of KIF4B gene was significantly correlated with pathological grade, TN stage, invasion and infiltration, and tumor size (**P<0.01).

[0037] The survival analysis results are as follows Figure 1 As shown in the figure, the survival time of patients with high expression of KIF4B gene was significantly shortened (P<0.05), indicating that high expression of KIF4B gene was associated with poor prognosis.

[0038] Example 2: Expression of KIF4B gene in lung cancer cells

[0039] 1. Selection of lung epithelial cells and lung cancer cells

[0040] BEAS-2B, NCI-H1299, NCI-H1975, A549, and NCI-H520 cells were used for the experiments.

[0041] 2.qRT-PCR

[0042] Total RNA was extracted from cells using a total RNA extraction kit according to the instructions. After sample purification, the RNA concentration and purity were assessed using an Austen Nano-400A ultra-micro cycle analyzer to ensure that the OD 260 / 280 range was controlled between 1.8 and 2.1. RNA was reverse transcribed into cDNA using a RevertAid RT Reserve Transcription Kit (Thermo Fisher Scientific). qRT-PCR was performed using Maxima SYBR Green / ROX qPCR Master Mix (Thermo Fisher Scientific) on a QuantStudio 7Flex (Applied Biosystems, Life Technologies).

[0043] qRT-PCR primer sequences:

[0044] Forward primer (KIF4B): 5'-GCCATTTTGCTGCTCTACCC-3' (SEQ ID NO.1);

[0045] Reverse primer (KIF4B): 5'-ACGTGACATTTTCCAGGGGT-3' (SEQ ID NO. 2).

[0046] 3. Experimental results

[0047] like Figure 2 As shown, compared with the BEAS-2B lung epithelial cell line, the KIF4B gene was significantly overexpressed in the lung cancer cell lines NCI-H1299, NCI-H1975, A549, and NCI-H520, indicating that the high expression of the KIF4B gene in lung cancer can be used as a biomarker for lung cancer screening.

[0048] Example 3: Effect of interfering with KIF4B gene expression on lung cancer cell proliferation and migration

[0049] 1. Validation of KIF4B interference fragments

[0050] Two shRNA expression vectors (shKIF4B-1, shKIF4B-2) were constructed. A549 and NCI-H1299 human NSCLC cell lines were seeded into 6-well culture plates. The shKIF4B vector was transfected into the cell lines. Non-targeting control shRNA (shCtrl) was used as a negative control.

[0051] The shRNA targeting the KIF4B gene (shKIF4B) has the following nucleotide sequence:

[0052] shKIF4B-1:

[0053] Sense strand: GGCATTATTCCTAGGGTAATA (SEQ ID NO. 3);

[0054] Antisense strand: TATTACCCTAGGAATAATGCC (SEQ ID NO. 4);

[0055] shKIF4B-2:

[0056] Sense strand: CCAAGCTGAACCAAGAGATAT (SEQ ID NO. 5);

[0057] Antisense strand: ATATCTCTTGGTTCAGCTTGG (SEQ ID NO. 6).

[0058] 2.CCK-8 proliferation assay

[0059] The proliferation capacity of lung cancer cells was measured using the CCK-8 kit. Cells were seeded in a 96-well plate at 2.5 × 10 cells per well. 3 Cells were seeded and cultured for 0, 1, 2, 3, 4, and 5 days. 10 μL was added to each well of a 96-well plate and incubated at 37°C for 2 h. OD values ​​were read at 450 nm using a microplate reader.

[0060] 3. Cell scratching

[0061] The migration ability of lung cancer cells was evaluated by cell scratch assay. Lung cancer cells were seeded in 6-well plates. When the cells grew to 80%-90% confluence, scratches were made on the cell monolayer in a straight line with a sterile pipette tip. Subsequently, the cells were gently rinsed twice to remove floating cell debris, and serum-free medium was added to avoid the effect of cell proliferation on migration. The initial width of the scratch was recorded at 0 hours, and images of the scratch area were taken after 24 hours. The width change of the scratch was measured by ImageJ software, and the cell migration rate was calculated. The experiment was repeated three times.

[0062] 4. Statistical methods.

[0063] All data are expressed as mean ± standard error (SEM), and the differences between groups were analyzed by one-way analysis of variance (ANOVA) using GraphPad Prism 8.0. P values ​​< 0.05 were considered to be significantly different. Unless otherwise specified, all experiments were repeated three times or more.

[0064] 5. Experimental Results

[0065] like Figure 3As shown, after the KIF4B gene was interfered with, the expression of KIF4B in A549 and NCI-H1299 cells was significantly reduced, and the difference was statistically significant (*P at least <0.05). The results showed that the KIF4B gene was successfully knocked down.

[0066] like Figure 4 As shown, the proliferation ability of A549 and NCI-H1299 cells was significantly decreased after interfering with KIF4B gene expression (***P<0.001).

[0067] like Figure 5 As shown, the migration ability of A549 and NCI-H1299 cells was significantly reduced after interfering with KIF4B gene expression (**P at least < 0.01).

[0068] The above embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work should fall within the protection scope of the present invention.

Claims

1. Application of a product for detecting the expression level of the KIF4B gene in the preparation of a kit for predicting the prognosis of lung cancer patients.

2. The use according to claim 1, characterized in that: The kit performs diagnosis by detecting the expression level of the KIF4B gene in the sample tissue of the subject.

3. Use of shRNA targeting KIF4B gene in the preparation of drugs for treating lung cancer, characterized in that: The nucleotide sequence of the positive strand of the shRNA is shown in SEQ ID NO.3 or SEQ ID NO.

5.

4. A pharmaceutical composition for treating lung cancer, characterized in that: The invention comprises the shRNA according to claim 3, and pharmaceutically acceptable excipients.

5. The pharmaceutical composition according to claim 4, characterized in that The auxiliary material is one or more of a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, a surfactant, an adsorption carrier and a lubricant.

6. The pharmaceutical composition according to claim 4, characterized in that The pharmaceutical composition is in an oral dosage form or a non-oral dosage form.

7. The pharmaceutical composition according to claim 4, characterized in that The pharmaceutical composition is in the form of tablets, capsules, powders, pills, granules, solutions, suspensions, syrups, injections, suppositories, inhalants or sprays.

8. The pharmaceutical composition according to claim 4, characterized in that The lung cancer is non-small cell lung cancer.

Images