Molecular markers associated with resistance to northern leaf spot on maize chromosome 10 and their application

Abstract

The present invention relates to the field of agricultural biotechnology, and in particular to molecular markers related to resistance to corn chromosome 10 large leaf spot (NCLB) and their applications. Specifically, the present invention discloses a SNP site molecular marker related to corn NCLB resistance, and the molecular marker sequence is shown in SEQ ID NO.1. As shown in SEQ ID NO:1, the base of the 201bp site from the 5′ end of the sequence presents A / G polymorphism. The present invention constructs a corn multi-parent population with significant differences in NCLB resistance, and locates the site Chr10: SNP_69286576 located on chromosome 10 that is significantly related to NCLB resistance by GWAS analysis, and then digs out the functional gene Zm00001d024406 that regulates corn resistance to NCLB. The qRT-PCR results show that the expression level of this gene is significantly increased in both parents after artificial inoculation of Setosphaeria turcica. The results of the present invention are helpful to further study the regulation mechanism of corn NCLB resistance, and also provide technical support for breeding NCLB-resistant corn varieties.

Description

Technical Field

[0001] The present invention relates to the field of agricultural biotechnology, and in particular to a SNP molecular marker site associated with NCLB resistance on chromosome 10 of maize, and a protein or gene associated with the site and applications thereof. Background Art

[0002] Corn is one of the most important food crops in China, and has occupied more than one-third of the country's food crop planting area in the past five years. However, corn production has long been threatened by several important diseases, among which Northern Leaf Blight (NCLB) is one of the most important corn leaf diseases caused by the disease Setosphaeria turcica. Northern Leaf Blight causes corn yield losses by reducing the photosynthetic area of ​​corn leaves. The yield losses caused by the disease are generally related to the severity of the disease, ranging from 30% to 62%. Corn is infected before silking, and large-scale spread during the filling period causes the most serious yield losses. In summary, improving corn resistance to Northern Leaf Blight is a key goal of plant breeding and biotechnology-assisted improvement. Therefore, exploring functional genes closely related to resistance to Northern Leaf Blight can provide technical support for molecular marker-assisted selection of corn resistant to Northern Leaf Blight. Summary of the invention

[0003] In order to solve the above problems, the present invention provides a locus Chr10: SNP_69286576 located on chromosome 10 of maize that is significantly associated with NCLB resistance, and then excavates the functional gene Zm00001d024406 that regulates maize resistance to NCLB. The Zm00001d024406 gene discovered by the present invention is a functional gene that regulates maize resistance to northern leaf spot disease. The qRT-PCR results show that the expression level of this gene is significantly increased in both parents after artificial inoculation of the disease Setosphaeria turcica.

[0004] The invention provides a SNP site molecular marker associated with corn NCLB resistance, wherein the SNP site is located at Chr10: SNP_69286576 of corn, and the molecular marker sequence is shown in SEQ ID NO.1. As shown in SEQ ID NO:1, the base at the 201 bp site from the 5' end of the sequence presents A / G polymorphism.

[0005] Further, the present invention provides an application of a product for detecting the SNP site molecular marker in identifying or assisting in identifying corn NCLB resistance, wherein the application is to detect that when the genotype of the 201 bp site from the 5′ end of the sequence shown in SEQ ID NO: 1 is AA, a corn variety with significant NCLB resistance is obtained. In some specific embodiments, the product for detecting the SNP site molecular marker can be a detection product designed for the site of the present invention based on known single nucleotide polymorphism (SNP) detection methods such as Sanger sequencing, TaqMan probe method, ARMS-PCR method (Amplification Refractory Mutation System PCR), KASP (Kompetitive Allele-Specific PCR) method, etc.

[0006] Furthermore, the present invention provides a method for improving the resistance of corn to NCLB, using a gene editing tool to mutate the genotype of the 201bp site from the 5′ end of the sequence shown in SEQ ID NO: 1 to AA. In some specific embodiments, the gene editing tool can be a CRISPR / Cas9 system, a CRISPR / Cas12a system, a Prime Editor (PE), a ZFN technology (Zinc Finger Nucleases), a TALEN technology (Transcription Activator-Like Effector Nucleases) and other existing technical tools.

[0007] Furthermore, the present invention provides a maize NCLB resistance protein associated with the SNP site molecular marker, and the amino acid sequence of the protein is shown in SEQ ID NO.3.

[0008] Furthermore, the present invention provides a gene encoding the corn NCLB resistance protein, and the gene is shown as SEQ ID NO.2.

[0009] Furthermore, the present invention provides a kit, which contains reagents for detecting the protein or the gene.

[0010] Furthermore, the kit comprises primers for detecting the gene shown in SEQ ID NO.2.

[0011] Furthermore, in the kit, the primers are as shown in SEQ ID NO.4 and / or SEQ ID NO.5.

[0012] Furthermore, the present invention provides the use of any of the kits described above in identifying or assisting in identifying corn NCLB resistance, and the expression level of the protein or gene is positively correlated with the corn NCLB resistance.

[0013] Furthermore, the present invention provides the use of the SNP site molecular marker, or the protein, or the gene in molecular marker-assisted breeding of NCLB-resistant corn.

[0014] The beneficial effects achieved by the present invention are:

[0015] The present invention provides a molecular marker site Chr10: SNP_69286576 associated with NCLB resistance on chromosome 10 of maize, and a protein or gene Zm00001d024406 associated with the site and its application. The present invention uses the maize inbred line Ye107 with moderate resistance to NCLB as a common parent, and crosses it with three temperate and subtropical maize inbred lines with different resistance to NCLB, so as to construct a maize multi-parent population with significant differences in NCLB resistance. GWAS analysis is used to locate Chr10: SNP_69286576 located on chromosome 10 and significantly associated with NCLB resistance on chromosome 10, and then excavate the functional gene Zm00001d024406 that regulates maize resistance to NCLB. The qRT-PCR results show that the expression level of this gene is significantly increased in both parents after artificial inoculation with Setosphaeriaturcica. The results of the present invention are helpful for further studying the regulatory mechanism of corn leaf blight resistance, and also provide technical support for breeding corn varieties resistant to corn leaf blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0017] Figure 1 Figure 1 shows the correlation results of pop1, pop2 and pop3 with NCLB in three environments; a: Violin plot of the phenotypic distribution of RILs of pop1, pop2 and pop3 in three different environments (YS21, JH22, YS22) in response to NCLB; bd: Correlation analysis of NCLB in different environments of the same population of pop1, pop2 and pop3;

[0018] Figure 2 This is the evolutionary tree diagram of pop1, pop2 and pop3;

[0019] Figure 3 This is the principal component analysis result diagram of pop1, pop2 and pop3;

[0020] Figure 4 To use the study population for GWAS mining of resistance SNP graphs, among which the left graph in a to c is a Manhattan graph, the right graph is a QQ graph, a is the result of YS21S, b is the result of YS22S, and c is the result of BLUP;

[0021] Figure 5 This is the association diagram between SNP_69286576 site and functional gene Zm00001d024406;

[0022] Figure 6 It is the haplotype analysis diagram of SNPs related to NCLB resistance, and the coordinates in the figure are BLUP values;

[0023] Figure 7 Relative expression level of Zm00001d024406 gene 0.5~48h after inoculation of Setosphaeria turcica; the letters in the figure represent the difference compared with the control group, A represents p<0.05, b represents p<0.05, C represents p<0.01, and d represents p<0.001. DETAILED DESCRIPTION

[0024] To further illustrate the present invention, the NCLB resistance-related molecular marker site Chr10: SNP_69286576 on chromosome 10 of maize provided by the present invention, as well as the Zm00001d024406 protein or gene associated with the site and their applications are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0025] On the one hand, the present invention provides a SNP molecular marker site Chr10: SNP_69286576 associated with NCLB resistance on chromosome 10 of corn, and the site is referenced to genome B73 (RefGen_v4); in some specific embodiments, for the detection of the SNP site, the present invention provides a molecular marker sequence as shown in SEQ ID NO.1, and the base of the 201bp site from the 5′ end of the sequence as shown in SEQ ID NO:1 presents an A / G polymorphism. A person skilled in the art can design a corresponding product for detection based on the sequence as shown in SEQ ID NO.1 provided by the present invention, using a detection method known in the art, and based on the detection result, if the genotype of the site is detected to be AA, it is judged that the corn sample to be tested is a corn variety with significant NCLB resistance.

[0026] SEQ ID NO: 1:

[0027] 5'-TTAGAGACTTTGGGAGTAAATGCTTTATTCTAACTAAAAGAGGTAGAAAATCTAAATTTGCTCCTAAGGTTGTAGAAGGCTTTTTACTTGGTTATGACTCAAACACAAGGGCATATAGAGTCTTCAACAAATCCACTGGATTGGTTGAGGTTTCTTGTGACATTGTGTTTGGTGAGACTAATGGCTCCCAAGTGGATC AA[A / G]TTGATCTTTGATGAGCTAGATGATGAAGAGGCTCCATGCGTCGTGCTAAGGAACATGTCTGTTG GGGACTTATTCTCAAATGCTATGAGTTAAGAACAAGGCAACAAAAATGTTAAATGTTAAAGTCCT TCGTCCTTCGAAGCATTATTTCCCTTGGGATATAATGATTTTCGGATGAAGGTTATGAAGGACATACCT-3'

[0028] On the other hand, the present invention uses GWAS analysis to locate Chr10: SNP_69286576 located on chromosome 10 and significantly associated with NCLB resistance, and then excavates the functional gene Zm00001d024406 that regulates corn resistance to NCLB. The amino acid sequence of the Zm00001d024406 protein is shown in SEQ ID NO.3, and the gene sequence encoding the protein is shown in SEQ ID NO.2. The qRT-PCR results show that the expression level of this gene is significantly increased in both parents after artificial inoculation of the disease Setosphaeria turcica, that is, the expression level of the gene or protein is positively correlated with the resistance to corn leaf blight. In some specific embodiments, those skilled in the art can design corresponding detection products based on the sequences shown in SEQ ID NO.2 or SEQ ID NO.3 provided by the present invention, and screen corn varieties with significant NCLB resistance through the expression level of Zm00001d024406.

[0029] Example 1

[0030] 1.1 Plant materials

[0031] The experiment was carried out in 2021 and 2022 in Yanshan County, Yunnan Province (denoted as YS, 1540 m above sea level, 104.5°E longitude, 23.6°N latitude) and in 2022 in Jinghong City (denoted as JH, 606.5 m above sea level, 100.58°E longitude, 21.54°N latitude) with experimental fields planted under three different ecological environments. Three multi-parent populations were obtained by single-grain transmission: pop1 (Ye107×Zheng58), pop2 (Ye107×AN20) and pop3 (Ye107×HuangC); the information of the four parents (Ye107, Zheng58, AN20 and HuangC) is shown in Table 1. The common parent Ye107 is a key excellent inbred line bred from two lines from different heterosis groups in the Chinese breeding program. It has been used as a parent in many commercial hybrids planted in a considerable production area in China [Zhen, S., Gao, G., Wang, X., Ning, H., and Duan, X. (2004). Appraisal of drought-enduring quality of several maize inbred lines. J Maize Sci. (in Chinese) 12, 18-19.].

[0032] Among the three polyparental populations, pop1 had 196 recombinant inbred lines (RILs), pop2 had 148 RILs, and pop3 had 184 RILs, and finally 528 RILs with rich genetic variation were constructed. Parent information is shown in Table 1.

[0033] Table 1 Parent information

[0034]

[0035]

[0036] 1.2 Experimental design

[0037] A randomized block design (RCBD) was used in three time locations: Yanshan in 2021 (denoted as YS21S), Yanshan in 2022 (denoted as YS22S), and Jinghong in 2022 (denoted as JH22W), with three replications in each location. Each experimental field had a row length of 4.0m, a row spacing of 0.7m, a plant spacing of 0.25m, 14 plants per row, and 10 plants were sampled from the middle of each row. The corn in the experimental field was carried out according to local standard agronomic practices. The statistical method of northern leaf spot disease refers to [Li, C., Ling, F., Su, G. et al. Location and mapping of the NCLB resistance genes in maize by bulked segregant analysis (BSA) using whole genome re-sequencing. Mol Breeding 40, 92 (2020). https: / / doi.org / 10.1007 / s11032-020-01171-3].

[0038] 1.3 Heritability analysis

[0039] After preliminary processing of the phenotypic data collected at three locations, the Ime4 package in R software (V4.0.5) was used to perform correlation analysis on the NCLB grades in different groups and environments, and the mean, standard deviation, skewness, kurtosis, and coefficient of variation of NCLB were calculated, and a normal distribution test was performed. The broad-sense heritability was calculated with reference to the methods of [Knapp SJ. Confidence intervals for heritability for two-factor mating design single environment linear models. Theor Appl Genet. 1986; 72(5): 587-591.] and [Moran, P.; Smith, C. The correlation between relatives on the supposition of mendelian inheritance. Trans. Royal Soc. Edinb. 1918, 52, 438-899.].

[0040] DNA extraction and genome sequencing

[0041] First, genomic DNA from maize seedling leaves was extracted using the cetyltrimethylammonium bromide (CTAB) method. Subsequently, the genomic DNA isolated from each F9RIL was digested with restriction endonucleases PstI and MspI and then ligated with barcode adapters using T4 ligase (New England BioLabs). GBS DNA libraries were constructed and sequenced according to the GBS protocol.

[0042] All ligated samples were combined and purified using the QIAquick PCR purification kit (QIAGEN, Valencia, California, USA). Polymerase chain reaction (PCR) amplification was performed using primers matching the adapter. Finally, the PCR products were purified and quantified using the Qubit dsDNA HS assay kit (Life Technologies, Grand Island, New York, USA). After selecting 200-300bp PCR products using the Egel system (Life Technologies), the library concentration was estimated using the Qubit 2.0 fluorometer and the Qubit dsDNA HS assay kit (Life Technologies). Subsequently, sequencing reads were generated using TASSELv5.0 (Li C, Guan H, Jing X, et al. Genomic insights into historical improvement of heterotic groups during modern hybrid maize breeding. Nat Plants. 2022; 8 (7): 750-763.). Before TASSEL analysis, 80 poly(A) bases were attached to the 3' end of all sequencing reads. For comparative analysis, the B73 (RefGen_v4) reference genome sequence was used and analyzed using Sentieon software (parameter "bwamem-k 32-MR") (Pei S, Liu T, Ren X, Li W, Chen C, Xie Z. Benchmarking variant callers in next-generation and third-generation sequencing analysis. Brief Bioinform. 2021; 22(3): bbaa148). Samtools (using the parameter rmdup) was used to compare the results for sorting and deduplication. Finally, 549,531 high-quality SNPs were generated and annotated using the ANNOVAR (Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010; 38(16): e164.) software tool.

[0043] 1.5 Population structure, phylogenetic trees and PCA

[0044] In the population structure analysis, we used a model-based clustering algorithm in admix V1.3 [Mussmann, SM; Douglas, MR; Chafin, TK; Douglas, MEADMIXPIPE: Population analyses in ADMIXTURE for non-model organisms. BMC Bioinform. 2020, 21, 337.]. The preliminary analysis included multiple runs with continuous K values ​​ranging from 1 to 12, and five-fold cross-validation for each K value. The most likely K value was determined using the cross-validation value of admix. Inbred lines with membership probabilities greater than 0.5 were assigned to the corresponding clusters and visualized using TBtools software v1.098727 [Chen, C.; Chen, H.; Zhang, Y.; Thomas, HR; Frank, MH; He, Y.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant. 2020, 13, 1194–1202.]. Phylogenetic tree analysis was performed using Tassel v5.0 software, and 549,531 high-quality SNPs were used to assess the genetic relationships among 528 RILs. Principal component analysis (PCA) was performed using R package 4.3.2, and the results were visualized using the scatterplot3d package.

[0045] 1.6 Genome-wide association analysis

[0046] GWAS was performed using the efficient mixed model association (EMME) analysis method in the GEMMA (Genome-wide efficient mixed-model analysis for association studies) software package (Zhou X, Stephens M. Genome-wide efficient mixed-model analysis for association studies. Nat Genet. 2012; 44(7): 821-824. Published 2012 Jun 17.).

[0047] The present invention uses PLINK (Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am J Hum Genet. 2007; 81 (3): 559-575.) to calculate independent markers, with a parameter of -independent airwise 5050.2. The formula -log10 (1 / SNP number) is used to calculate the significance threshold -log10 (p)> 4.5 to identify significant SNPs associated with maize NCLB. SNPs that met or exceeded the threshold were extracted using bedtools v1.7 (Strable J, Wallace JG, Unger-Wallace E, et al. Maize YABBY Genes drooping leaf1 and drooping leaf2 RegulatePlantArchitecture. Plant Cell. 2017; 29(7): 1622-1641.), and candidate genes associated with maize NCLB were identified in the 100 kb regions upstream and downstream of the significantly associated SNPs based on the B73 (RefGen_v4) reference genome and annotation information. In the process of screening candidate genes, we referred to the screening distance of candidate genes in temperate maize by Zhang et al. (2016, 2022) [Zhang, X., et al., Characterizing the population structure and genetic diversity of maize breeding germ plasmin Southwest China using genome-wide SNP markers. BMC Genomics, 2016. 17(1): p. 697.][Zhang, X., et al., Genetic architecture of maize yield traits dissected by QTL mapping and GWAS in maize. The Crop Journal, 2022. 10(2): p. 436-446.].

[0048] 1.7 Haplotype analysis

[0049] Haplotype analysis of SNPs associated with NCLB in three environments was performed using Haploview v4.2 software. First, a haplotype map was constructed using high-density whole-genome SNPs, and the haplotypes of SNPs significantly associated with resistance to corn leaf blight were determined based on the location of these sites and the results of LD analysis. Finally, the genes within the haplotypes were annotated to identify functionally related gene loci.

[0050] 1.8qRT-PCR and gene expression

[0051] After RNA was extracted using the RNAprep Pure Plant Kit from TIANGEN, the first-strand cDNA was synthesized using the FastKingRT Kit (With gDNase). TM Quantitative PCR Detection System was used for qRT-PCR to determine the relative expression of candidate genes in different parents. The reaction system was 20 μL. Infected leaves were collected at 0.5, 1, 3, 6, 9, 12, 24 and 48 hours after artificial inoculation of maize, and uninoculated leaves of each parent were taken as controls. Two pairs of primer sequences were used to analyze the relative expression of the two candidate genes Zm00001d024406: F-10-06'CCCGAACAAAGACACGAA, R-10-06'CCAGTCCACCCAATGAGC, and GAPDH was used as the internal reference gene for qRT-PCR. The qRT-PCR reaction program was set using the three-step method: pre-denaturation stage at 95°C for 15 min; PCR reaction stage at 95°C for 10 s, 56°C for annealing for 20 s, and 72°C for extension for 30 s, during which signal collection was performed; melting curve stage at 95°C for 15 s, 60°C for 1 min, and 95°C for 1 s, during which fluorescence signals were collected every 0.5°C during the process of reaching 95°C, and 40 cycles were set.

[0052] 2. Results

[0053] 2.1 Phenotypic analysis of large spot disease

[0054] We planted three RIL populations, Pop1, Pop2, and Pop3, in three environments [Yanshan (2021 and 2022) and Jinghong (2022)] and identified the NCLB disease grade index. As shown in Table 2, based on the disease data of the three RILs populations investigated, we performed descriptive statistics. It can be seen that the absolute values ​​of the kurtosis and skewness of Pop1, Pop2, and Pop3 are all less than 1, indicating that their phenotypic frequencies are approximately normally distributed. The heritability of the NCLB disease grade index of the three populations under the three environments was 0.972, 0.939, and 0.946, respectively. The higher heritability makes the candidate genes identified by GWAS more reliable. Figure 1 From a, we can see that Pop1's disease grade distribution is closer to the lower end than Pop2 and Pop3. This indicates that Pop1's disease severity is lower and it is more resistant to disease. Figure 1 b to Figure 1 The lowest correlation coefficient among the three groups was 0.755 (Pop1YS21S and JH22W) and the highest was 0.986 (Pop2 YS21S and YS22S). Pop1, Pop2, and Pop3 all had high correlation coefficients in different environments, indicating that they had significant stability in responding to the invasion of NCLB in different environments, providing strong support for the reliability of GWAS analysis.

[0055] Table 2 Statistical analysis results of NCLB phenotype

[0056]

[0057] Note: W stands for winter, S stands for summer. Env stands for environment. Range stands for the range of plant disease levels within the population. SD stands for standard deviation. CV stands for coefficient of variation. 2 Represents heritability.

[0058] 2.2 Group structure of RIL groups

[0059] The present invention uses Admixture software to perform population structure analysis on 528 materials. The analysis results are as follows Figure 4 As shown, overall, the population structure, principal component analysis (PCA) and phylogenetic tree ( Figure 2 to Figure 4 ) were consistent with the results of the previous study. Based on pedigree or genetic background, RILs can be divided into three major clusters. When K = 3, the population structure of RILs became clear, with 196 RILs in pop1, 148 RILs in pop2, and 184 RILs in pop3. Phylogenetic tree analysis also showed three genetic clusters, which was consistent with the population structure based on kinship.

[0060] 2.3 Genome-wide association analysis of NCLB

[0061] The present invention uses 528 samples, 549531 effective SNPs markers (minimum allele frequency MAF ≥ 5%, missing value r 2 <0.8) GWAS analysis was performed. The threshold of -log10(P)>4.5 was set, and in the BLUP analysis, a site Chr10: SNP_69286576 significantly associated with NCLB resistance was identified.

[0062] 2.6 Identification and validation of candidate genes associated with NCLB

[0063] We screened candidate genes in the 100 kb upstream and downstream regions of the significant SNPs consistently identified in different environments. Finally, candidate genes that may be involved in regulating NCLB resistance were identified (Table 3). SNP_69286576 was identified in three environments (YS21S, YS22S, and BLUP) on chromosome 10. Candidate gene analysis identified the candidate gene Zm00001d024406, located upstream of SNP_69286576 ( Figure 5 ). Functional annotation showed that Zm00001d024406 encodes a ring-type E3 ubiquitin transferase that plays a role in programmed cell death in plants.

[0064] Table 3 Candidate genes associated with NCLB

[0065]

[0066] Haplotype analysis was performed on SNPs that were significantly associated with NCLB resistance and consistently identified in multiple environments. To determine the relationship between different haplotypes and NCLB resistance, haplotype analysis was performed on SNPs. SNP_69286576 is located in a terminal inverted repeat (TIR) ​​element extending to 37.353 kb, 82.450 kb downstream of the candidate gene Zm00001d024406, with an A / G substitution ( Figure 5 ). This SNP exhibits two haplotypes: Hap1 (GG) and Hap2 (AA) ( Figure 6 ). Haplotype Hap2(AA) showed better resistance to NCLB than Hap1(GG), and there was a significant difference in the resistance of the two haplotypes to NCLB. Therefore, Hap2 was considered to be a superior haplotype with enhanced resistance to NCLB. A total of 303 Hap1(GG) and 38 Hap2(AA) were detected among 528 RILs, and the Hap2 haplotype was only found in POP1 (Table 4). POP1 was considered to show better resistance to NCLB, which was confirmed by the distribution of disease scores of RILs in POP1, which showed lower disease severity compared with POP2 and POP3.

[0067] Table 4 Gene haplotype distribution

[0068]

[0069] To determine the effect of candidate gene Zm00001d024406 on NCLB resistance, we performed qRT-PCR analysis on this gene using the parents. The relative expression of this gene in different parents was measured by taking maize leaves at 0.5, 1, 3, 6, 9, 12, 24, and 48 hours after artificial inoculation, and taking untreated leaves of each parent as a control. The results are shown in Figure 2. Figure 7 Compared with the samples without pathogen inoculation, the expression level of Zm00001d024406 gene in the parents AN20 and Zheng58 increased significantly and stably after inoculation. The expression level of Zm00001d024406 in AN20 gradually decreased after 6 hours of inoculation, and the expression level in Zheng58 decreased after 12 hours.

[0070] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of a product for detecting SNP site molecular markers in identifying or assisting in identifying NCLB resistance in corn, characterized in that: The SNP site is located at Chr10: SNP_69286576 of corn, and the molecular marker sequence is shown in SEQ ID NO.

1. The base at the 201bp site from the 5' end of the sequence shown in SEQ ID NO:1 presents an A / G polymorphism; the application is to detect that when the genotype of the 201bp site from the 5' end of the sequence shown in SEQ ID NO:1 is AA, a corn variety with significant NCLB resistance is obtained.

Images