An SSR core primer combination, kit and application for identifying the tea tree variety "Hongyan No. 12"

Abstract

The present invention discloses an SSR core primer combination, kit and application for identifying the tea tree variety "Hongyan No. 12". By using the SSR fluorescence labeling detection technology, the present invention screens out 3 pairs of SSR core primers, which can quickly identify and detect "Hongyan No. 12" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can be used for variety identification of "Hongyan No. 12", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety "Hongyan No. 12".

Description

Technical Field

[0001] The present invention relates to the technical field of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and an application for identifying the tea tree variety "Hongyan No. 12". Background Art

[0002] "Hongyan No. 12" was bred from the natural hybrid offspring of Tieguanyin by the single-plant breeding method by the Tea Research Institute of Guangdong Academy of Agricultural Sciences from 1990 to 2003, and was identified as a national variety by the National Tea Tree Variety Identification Committee in 2010. "Hongyan No. 12" is a clonal shrub-type medium-leaf early-growing black tea variety. The plant is tall, the tree posture is spreading, and the branches are relatively dense. The leaves are slightly obliquely arranged, oblong in shape, dark green in color, slightly raised on the leaf surface, flat in leaf body, wavy at the leaf margin, tapering at the leaf tip, with dense and shallow leaf teeth, and relatively hard and brittle leaf texture. The diameter of the corolla is 3.0 - 3.3 cm, with 6 - 8 white petals, medium-sized ovary, 3-lobed style, and medium fruit set. This variety is suitable for making green tea and oolong tea, and has excellent quality. When making oolong tea, the floral fragrance is high, strong and lasting, the taste is thick, smooth and refreshing, the soup color is yellowish green and bright, and the leaf bottom is tender and uniform; when making green tea, the appearance is green and moist, the aroma is lasting with floral fragrance, the taste is thick, mellow, fresh and refreshing, and the soup color and leaf bottom are green and bright.

[0003] Currently, for the identification of the tea tree variety "Hongyan No. 12", the identifier makes a judgment based on personal understanding of "Hongyan No. 12" and its external morphological characteristics. The identification result is easily affected by factors such as the development stage, cultivation measures, the personal ability of the identifier, and the growth environment of "Hongyan No. 12", and there is great uncertainty.

[0004] Due to the characteristics of high polymorphism, short test period, and not being affected by the environment, molecular marker technology has become the future development direction of variety identification and protection. Therefore, SSR molecular markers have good application prospects in variety specificity evaluation and protection. Summary of the Invention

[0005] In order to overcome the above-mentioned defects and deficiencies in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea tree variety "Hongyan No. 12".

[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea tree variety "Hongyan No. 12".

[0007] The second object of the present invention is to provide the application of the above SSR core primer combination in the preparation of an identification product for the tea tree variety "Hongyan No. 12".

[0008] The third object of the present invention is to provide the application of a product containing the above SSR core primer combination in the identification of the tea tree variety "Hongyan No. 12".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea tree variety "Hongyan No. 12".

[0010] The fifth object of the present invention is to provide a method for identifying the tea tree variety "Hongyan No. 12".

[0011] To achieve the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Hongyan No. 12", and the SSR core primer combination includes SSR core primers with nucleotide sequences shown as HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R; wherein: the primer sequence of HY12.SSR-1-F: TCGCACTCAAGTCGTACTCG; the primer sequence of HY12.SSR-1-R: ATGTCGGTCACAACCACTCG; the primer sequence of HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT; the primer sequence of HY12.SSR-2-R: CAACTTGGGCGTTGGAATCC; the primer sequence of HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT; the primer sequence of HY12.SSR-3-R: CGTTTAGCAGCACAAGGAAT.

[0012] The 5' end of the SSR core primer shown by the nucleotide sequence HY12.SSR-1-F, the 5' end of the SSR core primer shown by the nucleotide sequence HY12.SSR-2-F and / or the 5' end of the SSR core primer shown by the nucleotide sequence HY12.SSR-3-F are labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] Use of any of the above SSR core primer combinations in the preparation of an identification product for the tea tree variety "Hongyan No. 12".

[0015] Use of a product containing any of the above SSR core primer combinations in identifying the tea tree variety "Hongyan No. 12".

[0016] A kit for identifying the tea tree variety "Hongyan No. 12", comprising any of the above SSR core primer combinations.

[0017] The kit further includes HSTaq DNA polymerase, dNTPs, 10×Buffer, positive control reference, negative control reference, and ultrapure water.

[0018] A method for identifying the tea tree variety "Hongyan No. 12", which is identified by using any of the above SSR core primer combinations or kits.

[0019] The method described above includes the following steps:

[0020] S1. Extract the genomic DNA of the tea tree sample to be tested;

[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification with any of the above SSR core primer combinations;

[0022] S3. Type the PCR amplification products obtained in step S2 and discriminate the bands of the typing results:

[0023] The SSR core primers with nucleotide sequences shown as HY12.SSR-1-F and HY12.SSR-1-R amplify two characteristic bands of 195bp and 198bp, the SSR core primers with nucleotide sequences shown as HY12.SSR-2-F and HY12.SSR-2-R amplify two characteristic bands of 171bp and 173bp, and the SSR core primers with nucleotide sequences shown as HY12.SSR-3-F and HY12.SSR-3-R only amplify one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

[0024] The typing method in step S3 described above is to perform capillary electrophoresis on the PCR amplification products; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and supplemented with ddH2O to 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0025] Advantages and effects of the present invention:

[0026] The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea cultivar "Hongyan No. 12". By using the SSR fluorescence labeling detection technology, the present invention screens out 3 pairs of SSR core primers, which can quickly identify and detect "Hongyan No. 12" from other tea cultivars. The SSR core primer combination disclosed by the present invention can accurately identify the cultivar of "Hongyan No. 12", overcoming the uncertainty of identification based on external morphological characteristics, with reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the cultivar "Hongyan No. 12". Description of the Drawings

[0027] Figure 1 Capillary electrophoresis bands of 21 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R in Example 1.

[0028] Figure 2 Capillary electrophoresis bands of 21 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R in Example 1.

[0029] Figure 3 Capillary electrophoresis bands of 21 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R in Example 1.

[0030] Figure 4 Capillary electrophoresis bands of 32 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R in Example 2.

[0031] Figure 5 Capillary electrophoresis bands of 32 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R in Example 2.

[0032] Figure 6 Capillary electrophoresis bands of 32 tea cultivars / lines amplified by the specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R in Example 2. Detailed Embodiments

[0033] The following specific embodiments are used to further illustrate the present invention, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the technical field.

[0034] Unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.

[0035] Example 1 Obtaining of Specific Primer Sequences of "Hongyan 12"

[0036] I. Experimental Methods

[0037] 1. SSR Primer Design

[0038] The genomic sequences of the tea tree genomic database (http: / / tpia.teaplants.cn / ) were retrieved using MISA software to identify SSR loci in the genomic sequences. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.

[0039] 2. Extraction of DNA from Tea Tree Varieties

[0040] Twenty-one tea tree varieties / lines with similar genetic relationships and phenotypes, such as "Hongyan 12", "Hongyan 8", "Hongyan 10", "Hongyan 14", and "Meizhan", were preliminarily screened. The specific tea tree varieties / lines used in the preliminary screening are shown in Table 1 (obtained from the Tea Germplasm Resource Bank of Guangdong Province).

[0041] Table 1 Twenty-one Tea Tree Varieties / Lines Used in the Preliminary Screening

[0042]

[0043] DNA was extracted from the 21 tea tree varieties / lines (Table 1) used in the preliminary screening. The specific steps for DNA extraction are as follows:

[0044] a) Add liquid nitrogen to tea tree leaves and grind them thoroughly. Weigh approximately 100 mg of the ground powder.

[0045] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder. After quickly vortexing and mixing, place the centrifuge tube in a 65°C water bath for 15 min, and invert the centrifuge tube several times during the water bath to mix the samples.

[0046] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0047] d) Add an equal volume of absolute ethanol and mix thoroughly. Flocculent precipitates may appear at this time.

[0048] e) Transfer both the solution and the flocculent precipitate obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0049] f) Add 550 μL of protein removal solution RD to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.

[0050] g) Add 700 μL of washing solution PW to the RNase-Free adsorption column CR2, centrifuge at 12,000 rpm for 1 min, pour out the waste liquid, and place the RNase-Free adsorption column CR2 into the collection tube.

[0051] h) Repeat step g.

[0052] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12,000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube, and air-dry at room temperature for 5 - 10 min.

[0053] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into a centrifuge tube to obtain the genomic DNA of tea tree.

[0054] 3. PCR amplification

[0055] Using the genomic DNA of tea tree extracted in step 2 above as a template, perform PCR amplification using SSR fluorescence labeling detection technology. The primers include an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group is FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling is used in the present invention) and a downstream primer. The PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end generates a fluorescent PCR product.

[0056] For the PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O to make up 10 μL.

[0057] The PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0058] 4. Genotyping detection

[0059] Capillary electrophoresis detection: Add 9 μL of the mixed solution of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of PCR product to each well of the 96-well plate; denature at 95 °C for 3 min, and perform genotyping detection using the 3730XL DNA analyzer.

[0060] 5. Data analysis

[0061] Import the original data file obtained by the 3730XL DNA analyzer into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0062] II. Experimental results

[0063] Three pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F, and HY12.SSR-3-R. The primer sequences are shown in Table 2.

[0064] Table 2 Specific SSR core primer sequences

[0065]

[0066] The capillary electrophoresis band statistical results of these three pairs of specific SSR core primers amplifying 21 tea tree varieties / lines (Table 1) are shown in Table 3 and Figures 1 to 3 as follows. The results show that "Hongyan No. 12" showed characteristic bands, specifically:

[0067] (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195 bp and 198 bp;

[0068] (2) The specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171 bp and 173 bp;

[0069] (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplified one characteristic band of 184 bp.

[0070] The above results show that the three pairs of specific SSR core primers can amplify characteristic bands for the tea tree variety "Hongyan No. 12", so "Hongyan No. 12" can be distinguished from the other 20 tea tree varieties / lines with similar kinship and phenotypes.

[0071] Table 3 Capillary electrophoresis band statistics of three pairs of specific SSR core primers for 21 tea tree varieties / lines

[0072]

[0073] Example 2

[0074] Further verification of 3 pairs of specific SSR core primers

[0075] I. Experimental method

[0076] The 3 pairs of specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R, HY12.SSR-2-F and HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R for identifying "Hongyan No. 12" obtained by screening were further verified. 31 tea tree varieties currently popularized and applied in production were selected for amplification detection simultaneously with "Hongyan No. 12". The 32 tea tree varieties are specifically shown in Table 4.

[0077] Table 4 32 tea tree varieties currently popularized and applied in production

[0078]

[0079] The methods for extracting DNA of tea tree varieties, PCR amplification, genotyping detection and data analysis were carried out according to Example 1.

[0080] II. Experimental results

[0081] The capillary electrophoresis band statistical results of the 3 pairs of specific SSR core primers amplifying 32 tea tree varieties (Table 4) are shown in Table 5 and Figures 4 to 6 as follows. The results show that only "Hongyan No. 12" showed characteristic bands, specifically:

[0082] (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195 bp and 198 bp;

[0083] (2) The specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171 bp and 173 bp;

[0084] (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplified one characteristic band of 184 bp.

[0085] The above results show that the 3 pairs of specific SSR core primers can amplify specific allelic loci for the tea tree variety "Hongyan No. 12", so "Hongyan No. 12" can be distinguished from the other 31 tea tree varieties currently popularized and applied in production.

[0086] Table 5 Statistical analysis of capillary electrophoresis bands of 32 popularized tea tree varieties

[0087]

[0088] Example 3

[0089] A method for identifying "Hongyan No. 12" using a specific SSR core primer combination

[0090] 1. Extract the DNA of the tea tree variety "Hongyan No. 12" according to the method of Example 1;

[0091] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification with 3 pairs of specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R, HY12.SSR-2-F and HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R. The sequences of the 3 pairs of specific SSR core primers are as follows, and the 5' end of the upstream primer is labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0092] HY12.SSR-1-F: TCGCACTCAAGTCGTACTCG;

[0093] HY12.SSR-1-R: ATGTCGGTCACAACCACTCG;

[0094] HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT;

[0095] HY12.SSR-2-R: CAACTTGGGCGTTGGAATCC;

[0096] HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT;

[0097] HY12.SSR-3-R: CGTTTAGCAGCACAAGGAAT;

[0098] 3. The PCR amplification method is carried out according to Example 1:

[0099] Perform genotyping detection and data analysis on the PCR products obtained in step 2. Both the genotyping detection and data analysis methods are carried out according to Example 1.

[0100] 4. Result interpretation:

[0101] If the amplified products of 3 pairs of specific SSR core primers show the following characteristic bands respectively, it indicates that the tea tree variety to be tested is "Hongyan No. 12"; if the following characteristic bands do not appear respectively, it indicates that the tea tree variety to be tested is not "Hongyan No. 12":

[0102] (1) The specific SSR core primers HY12.SSR-1-F and HY12.SSR-1-R amplify two characteristic bands of 195bp and 198bp;

[0103] (2) The specific SSR core primers HY12.SSR-2-F and HY12.SSR-2-R amplify two characteristic bands of 171bp and 173bp;

[0104] (3) The specific SSR core primers HY12.SSR-3-F and HY12.SSR-3-R only amplify one characteristic band of 184bp.

[0105] Example 4

[0106] A kit for identifying the tea tree variety "Hongyan No. 12"

[0107] I. Composition

[0108] (1) 3 pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0109] HY12.SSR-1-F: TCGCACTCAAGTCGTACTCG;

[0110] HY12.SSR-1-R: ATGTCGGTCACAACCACTCG;

[0111] HY12.SSR-2-F: CTCCCTATCCATCCCCAGCT;

[0112] HY12.SSR-2-R: CAACTTGGGCGTTGGAATCC;

[0113] HY12.SSR-3-F: TGCCGTCGTTGAATGCAATT;

[0114] HY12.SSR-3-R: CGTTTAGCAGCACAAGGAAT;

[0115] (2) HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.

[0116] II. Usage Method

[0117] Perform detection and result interpretation according to the method of Embodiment 3.

[0118] The above embodiments are preferred embodiments of the present invention. However, the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. An SSR core primer combination for identifying the tea variety "Hongyan No. 12", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences HY12.SSR-1-F, HY12.SSR-1-R, HY12.SSR-2-F, HY12.SSR-2-R, HY12.SSR-3-F and HY12.SSR-3-R; wherein: the primer sequence of HY12.SSR-1-F is TCGCACTCAAGTCGTACTCG; the primer sequence of HY12.SSR-1-R is ATGTCGGTCACAACCACTCG; the primer sequence of HY12.SSR-2-F is CTCCCTATCCATCCCCAGCT; the primer sequence of HY12.SSR-2-R is CAACTTGGGCGTTGGAATCC; the primer sequence of HY12.SSR-3-F is TGCCGTCGTTGAATGCAATT; the primer sequence of HY12.SSR-3-R is CGTTTAGCAGCACAAGGAAT.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-1-F, the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-2-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence HY12.SSR-3-F is labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination according to any one of claims 1 to 3 in preparing an identification product of the tea variety "Hongyan No. 12", characterized in that: The SSR core primers represented by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195bp and 198bp, the SSR core primers represented by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171bp and 173bp, and the SSR core primers represented by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplified only one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

5. Use of a product comprising the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea variety "Hongyan No. 12", characterized in that: The SSR core primers represented by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195bp and 198bp, the SSR core primers represented by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171bp and 173bp, and the SSR core primers represented by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplified only one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

6. A kit for identifying the tea variety "Hongyan No. 12", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance, and ultrapure water.

8. A method for identifying the tea variety "Hongyan No. 12", characterized in that: Identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7. If the SSR core primers represented by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplify two characteristic bands of 195 bp and 198 bp, the SSR core primers represented by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplify two characteristic bands of 171 bp and 173 bp, and the SSR core primers represented by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplify only one characteristic band of 184 bp, it indicates that the tea tree sample to be tested is "Hongyan No. 12"; if other bands appear, it indicates that the tea tree sample to be tested is not "Hongyan No. 12".

9. A method for identifying the tea variety "Hongyan No. 12", characterized in that: The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band discrimination on the typing result: The SSR core primers represented by the nucleotide sequences HY12.SSR-1-F and HY12.SSR-1-R amplified two characteristic bands of 195bp and 198bp, the SSR core primers represented by the nucleotide sequences HY12.SSR-2-F and HY12.SSR-2-R amplified two characteristic bands of 171bp and 173bp, and the SSR core primers represented by the nucleotide sequences HY12.SSR-3-F and HY12.SSR-3-R amplified only one characteristic band of 184bp, indicating that the tea tree sample to be tested is "Hongyan No. 12"; the appearance of other bands indicates that the tea tree sample to be tested is not "Hongyan No. 12".

10. The method according to claim 9, characterized in that The typing method in step S3 is to perform capillary electrophoresis on the PCR amplification product; For PCR amplification, the total reaction system was 10 μL, including: 10×Buffer I 1 μL, 2.5 mM dNTPs 0.8 μL, 2.5 μM upstream primer 0.6 μL, 2.5 μM downstream primer 0.6 μL, TAKARA HSTaq 0.1 μL, DNA 1 μL, and ddH2O 10 μL; the PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

Images