Molecular markers of a major QTL qCST3 regulating salt tolerance in rice and its application

Abstract

The present application relates to the technical field of rice molecular assisted breeding, and specifically to a molecular marker and application of a major effect QTL qCST3 regulating rice salt tolerance, wherein the major effect QTL is located on rice chromosome 3 and is named qCST3 , with a physical position of 30.48 Mb-32.90 Mb; the SNP marker closely linked to it is located at position 33887916 of chromosome 3, where when this position is C, it indicates that the rice is salt-tolerant rice; and when it is T, it indicates that the rice is salt-sensitive rice. The new major effect QTL and its linked molecular marker proposed in this application can quickly determine the salt tolerance level of rice, thereby accelerating the screening and breeding process of rice varieties.

Description

Technical Field

[0001] The present application relates to the technical field of rice molecular assisted breeding, and in particular to a molecular marker of a major effect QTL qCST3 for regulating rice salt tolerance and its application. Background Art

[0002] At present, there are about 960 million hectares of salinized land in the world. With climate change and environmental degradation, the area of ​​salinized land is expanding, and salt tolerance has become one of the key issues in rice production. Soil salinization affects crop growth and even causes crop death in severe cases, endangering world food security. Oryza sativa L.) As a moderately salt-sensitive crop, when the soluble salt concentration in the soil reaches 3‰, it will have an adverse effect on the main metabolic activities of rice, resulting in a decrease in yield. Improving rice salt tolerance is an effective way to enhance varieties' resistance to salt stress and improve the efficiency of salinized land use.

[0003] Salt tolerance in rice is a complex quantitative model controlled by multiple genes. With the advancement of molecular marker technology in recent years, many scholars have conducted a large number of QTL studies on rice salt tolerance and identified major QTL SKC1, DST and other salt tolerance-related genes. However, the research on QTL positioning and gene cloning of rice salt tolerance still needs further in-depth exploration and analysis.

[0004] Locating new major QTLs related to rice salt tolerance and discovering molecular markers closely linked to them are of great significance for rice variety selection and improvement. Summary of the invention

[0005] The present application solves at least one of the problems of the related art from the following aspects.

[0006] To this end, the present invention proposes a major QTL for regulating rice salt tolerance, which is located on chromosome 3 of rice and is named QTCE3 , the physical location is 30.48 Mb-32.90 Mb.

[0007] The embodiments of the present application also propose a molecular marker tightly linked to the major QTL regulating rice salt tolerance as described in any embodiment of the present application, wherein the molecular marker is a single nucleotide polymorphism at position 33887916 of rice chromosome 3, and the single nucleotide polymorphism is T or C.

[0008] In some embodiments, the major QTL regulating rice salt tolerance or a molecular marker closely linked thereto is obtained with common wild rice P5 with salt tolerance and salt-sensitive indica rice variety Youzhan 8 as parents, wherein a wild rice chromosome segment substitution line (CSSL) population is constructed with wild rice P5 as the male parent and Youzhan 8 as the female parent, and salt tolerance is identified based on the CSSL population, and the extremely salt-tolerant individual plant ZST11 is screened out and backcrossed with the female parent to construct an F2 segregation population, and finally, the QTL is located using the BSA (bulked segregant analysis) mixed pool grouping analysis method to obtain the major QTL QTCE3 and molecular markers that are closely linked to it.

[0009] The embodiments of the present application also propose a reagent for detecting the salt tolerance of rice or a kit containing the reagent, wherein the reagent is used to detect the major effect QTL regulating the salt tolerance of rice as described in any embodiment of the present application and / or the molecular marker closely linked thereto, wherein the rice is determined to be salt-tolerant rice based on the presence of the QTL in the rice and / or the single nucleotide polymorphism of the molecular marker is C; the rice is determined to be salt-sensitive rice based on the absence of the QTL in the rice and / or the single nucleotide polymorphism of the molecular marker is T.

[0010] In some embodiments, the reagent is a primer.

[0011] In some embodiments, the reagent includes primers for detecting the molecular marker, the primers including: forward primer 1-T: CCGGGTTCAGGATGGAAACT, as shown in SEQ ID NO: 1; and / or forward primer 1-C: CCGGGTTCAGGATGGAAACC, as shown in SEQ ID NO: 2; and reverse primer: TGTTCTGCAGAGCTACACGG, as shown in SEQID NO: 3.

[0012] In some embodiments, the reagents include KASP primers for detecting the molecular markers, the KASP primers including: forward primer 1-T-FAM: 5'-FAM-GAAGGTGACCAAGTTCATGCTCCGGGTTCAGGATGGAAACT, as shown in SEQ ID NO: 4; forward primer 2-C-HEX: 5'-HEX-GAAGGTCGGAGTCAACGGATTCCGGGTTCAGGATGGAAACC, as shown in SEQ ID NO: 5; and reverse primer: TGTTCTGCAGAGCTACACGG, as shown in SEQ ID NO: 3.

[0013] The present application also proposes the use of the major effect QTL regulating rice salt tolerance as described in any embodiment of the present application, the molecular marker closely linked thereto, or the reagent for detecting rice salt tolerance, or the kit containing the reagent in one or more of the following:

[0014] i. Rice variety breeding; and

[0015] ii. Improve the salt tolerance of rice.

[0016] The embodiment of the present application also proposes a method for detecting salt tolerance of rice, comprising: extracting a nucleic acid sample of rice; based on the nucleic acid sample, detecting the major effect QTL regulating the salt tolerance of rice and / or the molecular markers closely linked thereto; and determining the salt tolerance of the rice according to the detection results, wherein based on the presence of the QTL in the rice and / or the single nucleotide polymorphism of the molecular marker being C, the rice is determined to be salt-tolerant rice; based on the absence of the QTL in the rice and / or the single nucleotide polymorphism of the molecular marker being T, the rice is determined to be salt-sensitive rice.

[0017] In some embodiments, the detecting is performed by sequencing and / or primer-based amplification or probe capture.

[0018] In some embodiments, the detection is performed by primers for detecting the molecular marker, the primers comprising: forward primer 1-T: CCGGGTTCAGGATGGAAACT, as shown in SEQ ID NO: 1; and / or forward primer 1-C: CCGGGTTCAGGATGGAAACC, as shown in SEQ ID NO: 2; and reverse primer: TGTTCTGCAGAGCTACACGG, as shown in SEQID NO: 3.

[0019] In some embodiments, the detection is performed using KASP primers for detecting the molecular marker, specifically comprising: based on the nucleic acid sample, performing KASP amplification using the KASP primers; and performing fluorescence detection and genotyping on the amplification product, wherein based on the single nucleotide polymorphism of the molecular marker being C, the rice is determined to be salt-tolerant rice; based on the single nucleotide polymorphism of the molecular marker being T, the rice is determined to be salt-sensitive rice, and the KASP primers include: a forward primer 1-T-FAM as shown in SEQ ID NO: 1, a forward primer 2-C-HEX as shown in SEQ ID NO: 2, and a reverse primer as shown in SEQ ID NO: 3.

[0020] The embodiments of the present application achieve the following beneficial effects:

[0021] This application locates a new major QTL associated with rice salt tolerance QTCE3 , and discovered a molecular marker closely linked to it. The marker is stable and highly reliable. The molecular marker can be used to quickly determine the salt tolerance level of rice, thereby accelerating the screening and breeding of rice varieties, and providing a basis for further research on rice molecular marker-assisted breeding, positioning and discovering key regulatory genes for salt tolerance traits. It is of great significance for rice variety selection and improvement, as well as improving rice yield under adverse stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 QTL positioning based on BSA mixed pool grouping analysis method according to Example 1 of the present application;

[0024] Figure 2 The QTL positioning results according to Example 1 of the present application are shown;

[0025] Figure 3 The growth of Pokkali, Youzhan No. 8 and ZST11 in Example 1 of the present application after 7 days of 10‰ salt treatment at the seedling stage is shown;

[0026] Figure 4 The growth conditions of Yanxian 156, D495, Youzhan 8, and ZST11 treated with 3‰ salt during the whole growth period according to Example 1 of the present application are shown;

[0027] Figure 5 The growth conditions of Yanxian 156, D495, Youzhan 8, and ZST11 treated with 5‰ salt during the whole growth period according to Example 1 of the present application are shown;

[0028] Figure 6 The results of KASP typing of multiple rice materials based on the SNP marker at position 33887916 of chromosome 3 developed according to Example 2 of the present application are shown. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art and are not intended to limit the present invention in any way.

[0030] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0031] In the embodiments of the present application, the "CSSL population" is a set of materials with the same genetic background as the recipient parent except for the introgressed fragments, formed by systematic backcrossing and selfing methods to allow the DNA fragments of the donor parent to be introgressed into the recipient parent (i.e., the recurrent parent) genome through recombination exchange, and molecular marker-assisted selection and other means. Since the CSSL has the advantages of fewer introgressed fragments and a relatively simple genetic background, the CSSL has become an important experimental material for modern genetic research, new variety breeding and improvement.

[0032] In the embodiments of the present application, "bulk segregant analysis (BSA)" is also called segregant group hybrid analysis or group segregation analysis. It was developed by Michelmore et al. in 1991. The DNA of two groups of phenotypic individuals (such as plant height, leaf width, stress resistance, etc.) were mixed into two DNA pools, and the allele frequencies of the two groups at the polymorphic sites (single nucleotide polymorphism, SNP) were compared by sequencing to see if there were significant differences. Then, high-density molecular markers were used to perform co-segregation analysis between markers and traits in the two pools, and the QTL / gene associated with the target trait was screened through SNP. With the development of gene sequencing technology and the reduction of sequencing costs, BSA technology has become a powerful tool for gene localization.

[0033] In the examples of the present application, "competitive allele-specific PCR (KASP)" is an endpoint fluorescent genotyping technology based on known SNPs, which can accurately detect double alleles of SNPs and InDels at specific sites in DNA samples. KASP is based on conventional PCR and fluorescence detection, and can meet the requirements of low, medium and high throughput genotyping on the basis of ordinary laboratory operations. The detection process does not require electrophoresis, which reduces the pollution of the environment and the harm to the human body during the experimental operation process. In addition, the technology uses a universal probe that can be used in conjunction with a variety of gene-specific primers without the need to synthesize probes for each specific site, greatly reducing the cost of the experiment. In the examples of the present application, unless otherwise specified, "single nucleotide polymorphism is T (or C) corresponding to sensitive or salt-tolerant rice varieties" means that the sample detects homozygous T or C, that is, the two alleles of the sample at the SNP site are T or C at the same time, and it is judged to be salt-sensitive rice or salt-tolerant rice.

[0034] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0035] Unless otherwise specified, the quantitative analysis experiments in the following examples were performed three times and the results were averaged.

[0036] Example 1- Mining and localization of major QTL qCST3 and its molecular markers

[0037] 1.1 Construction of F2 segregating population

[0038] A wild rice CSSL population was constructed using salt-tolerant common wild rice P5 as the male parent and salt-sensitive indica rice variety Youzhan 8 as the female parent. The wild rice CSSL population was used to identify salt tolerance and screen out the extremely salt-tolerant plant ZST11. The extremely salt-tolerant plant ZST11 was backcrossed with the female parent to construct an F2 segregating population.

[0039] The salt tolerance performances of parent Youzhan 8 and the extremely salt-tolerant individual ZST11 are as follows: Figures 3 to 5 As shown, the internationally recognized salt-tolerant variety Pokkali, the certified salt-tolerant variety Yanxian 156, and the salt-tolerant line D495 were used as positive controls.

[0040] Figure 3 The figure shows the growth of three rice plants at the seedling stage after 7 days of treatment with 10‰ salt. Figure 3It can be seen that compared with Youzhan No. 8, Pokkali and ZST11 still maintained normal growth after salt treatment, showing better salt tolerance, while Youzhan No. 8 was salt sensitive and wilted and yellowed after salt treatment.

[0041] Figure 4 The growth of Youzhan 8 and ZST11 during the whole growth period after 3‰ salt treatment is shown. Three replicates were set in each group, and Yanxian 156 and D495 were set as positive controls. Figure 4 It can be seen that under the growth conditions of 3‰ salt treatment, the rice panicle of ZST11 was longer, the grains were dense and more, and it showed a higher yield; while the opposite was true for Youzhan 8. Figure 5 The growth of Youzhan 8 and ZST11 during the whole growth period after 5‰ salt treatment is shown, and Yanxian 156 and D495 are also set as positive controls. Figure 4 The results of 3‰ salt treatment were Figure 5 Under the more severe 5‰ salt treatment conditions shown in the figure, ZST11 was still able to grow and bear fruit normally, and achieved a higher yield than Youzhan 8. Figure 3-Figure 5 These results indicate that ZST11 is a salt-tolerant variety, while Youzhan 8 is a salt-sensitive variety.

[0042] 1.2 QTL mapping and development of linkage markers

[0043] The F2 population was treated with 150 mM NaCl and the phenotypes were statistically analyzed. Thirty salt-tolerant plants and thirty salt-sensitive plants were selected to construct two extreme pools, T-Pool and S-Pool. The two pools were sequenced, and then the BSA pool grouping analysis method was used to locate QTLs. The results are shown in Figure 2. Figure 1 shown.

[0044] Depend on Figure 1 It can be seen that after positioning, a QTL from the wild rice replacement fragment with a confidence level of greater than 95% on chromosome 3 was detected, and the inventors named it qCST3. This QTL was shown to be a major effect QTL for rice salt tolerance, and its physical location was located in the 30.48 Mb-32.90 Mb interval of chromosome 3 (such as Figure 2 as shown).

[0045] Furthermore, based on the QTL, a linked molecular marker related to the QTL is developed. Specifically, the ED algorithm or SNP-index algorithm is used, and the standard process is referred to to compare whether the allele frequency (AF) of the polymorphic locus (SNP) of the two F2 groups is significantly different, locate the loci associated with the target trait and annotate them (Takagi H et.al2013).

[0046] After mining, a molecular marker closely linked to qCST3 was obtained, which showed a single nucleotide polymorphism at position 33887916 on rice chromosome 3. When the rice is salt-tolerant rice, the QTL exists, and the nucleotide at position 33887916 on chromosome 3 is C; when the rice is salt-sensitive (i.e., poor salt tolerance) rice, the QTL does not exist, and the nucleotide at position 33887916 on chromosome 3 is T.

[0047] 1.3 KASP detection primer design

[0048] Based on the SNP closely linked to qCST3, KASP primers were designed to detect this SNP.

[0049] KASP primers include:

[0050] Forward primer 1-T-FAM: 5'-FAM-GAAGGTGACCAAGTTCATGCTCCGGGTTCAGGATGGAAACT (SEQID NO: 4);

[0051] Forward primer 2-C-HEX: 5′-HEX-GAAGGTCGGAGTCAACGGATTCCGGGTTCAGGATGGAAACC (SEQ ID NO: 5); and

[0052] Reverse primer: TGTTCTGCAGAGCTACACGG (SEQ ID NO: 3).

[0053] Example 2- Validation of molecular markers of qCST3

[0054] The KASP genotyping test kit (FLU-ARMS for KASP2x PCR Mix V5F) of Guangzhou Good Biotechnology Co., Ltd. was used to perform KASP genotyping on 52 randomly selected materials from the two mixed pools according to the instructions in the manual to verify the SNPs closely linked to qCST3 in Example 2, wherein the reaction conditions and reaction system are shown in Tables 1 and 2, respectively. The KASP genotyping and phenotypic data of some materials are listed in Table 3. The KASP genotyping results are shown in Table 3. Figure 6 shown.

[0055] Table 1

[0056]

[0057] Table 2

[0058]

[0059] Table 3

[0060]

[0061] It can be seen from the typing results that the major effect QTL proposed in the embodiment of the present application and the molecular markers closely linked thereto have high stability and high credibility. The molecular markers can be used to quickly determine the salt tolerance level of rice, thereby accurately and efficiently screening highly salt-tolerant rice germplasm resources, overcoming the limitations of traditional phenotypic screening. The introduction of the QTL and molecular markers can accelerate the screening and breeding process of rice varieties, provide further research basis for rice molecular marker-assisted breeding, positioning and discovery of key regulatory genes for salt tolerance traits, etc., and are of great significance to rice variety selection and improvement, as well as improving rice yield under adverse stress.

[0062] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0063] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A reagent for detecting salt tolerance of rice or a kit containing the reagent for use in rice variety breeding, characterized in that: The reagent includes a KASP genotyping primer for KASP typing detection, and the KASP genotyping primer includes: Forward primer 1-T-FAM: 5′-FAM-GAAGGTGACCAAGTTCATGCTCCGGGTTCAGGATGGAAACT, as shown in SEQ ID NO: 4; Forward primer 2-C-HEX: 5′-HEX-GAAGGTCGGAGTCAACGGATTCCGGGTTCAGGATGGAAACC, as shown in SEQ ID NO: 5; and Reverse primer: TGTTCTGCAGAGCTACACGG, as shown in SEQ ID NO: 3, in Based on the single nucleotide polymorphism in the KASP typing result being homozygous CC, the rice is determined to be salt-tolerant rice; Based on the single nucleotide polymorphism in the KASP typing result being homozygous TT, the rice was determined to be salt-sensitive rice.

2. A method for detecting salt tolerance of rice, characterized in that: include: Extracting nucleic acid samples from rice; Based on the nucleic acid sample, performing KASP typing detection using the reagent as defined in claim 1 or a kit comprising the reagent; and According to the KASP typing results, the salt tolerance of the rice is determined. in Based on the single nucleotide polymorphism in the KASP typing result being homozygous CC, determining that the rice is salt-tolerant rice; Based on the single nucleotide polymorphism in the KASP typing result being homozygous TT, the rice is determined to be salt-sensitive rice.

3. The method according to claim 2, characterized in that The KASP typing test specifically includes: Based on the nucleic acid sample, performing KASP amplification using KASP genotyping primers; and The amplified products were subjected to fluorescence detection and genotyping.

Images