Cyclohexene derivative with attraction effect on dichocrocis punctiferalis as well as preparation method and application of cyclohexene derivative

Abstract

According to the cyclohexene derivative with the attraction effect on dichocrocis punctiferalis and the preparation method and application of the cyclohexene derivative, the compound has excellent dichocrocis punctiferalis attraction activity and is very suitable for being used for preparing dichocrocis punctiferalis attractants or pesticide compositions for preventing and treating dichocrocis punctiferalis.

Description

Technical Field

[0001] The invention belongs to the technical field of pesticides, and in particular relates to a cyclohexene derivative having an attractant effect on peach borer, a preparation method and an application thereof. Background Art

[0002] Planting attractant plants is one of the methods of integrated pest management. Pests have a clear preference for such plants. Reasonable planting can attract pests and protect the main crops from harm. In order to reduce the damage caused by pests and diseases, ensure food security and high and stable crop yields, my country has become the largest producer and user of chemical pesticides. The high-load input of chemical pesticides has caused serious environmental pollution, food safety and pest resistance problems. Therefore, the concept of integrated pest management was proposed to give full play to the role of natural control factors and control pests below the level of economic damage.

[0003] The peach borer is an insect of the genus C. punctatus in the family Pyralidae of the order Lepidoptera. It is known as "nine out of ten fruits are infested". When the larvae bore into the fruit, when the damage is serious, a large number of fruits fall and become infested, which seriously affects the edible value, commercial value and export of fruits. It is difficult to control them chemically because the larvae are highly hidden and resistant to pesticides.

[0004] β-Phellandrene released by sunflowers has a strong attractant effect on the adult peach borer. After the orchard released β-Phellandrene attractant, the population of peach borer in the orchard decreased by more than 83% and the fruit infestation rate decreased by 82%. The commodity price of β-Phellandrene is extremely expensive (40,000-50,000 yuan / gram), and the high cost makes it impossible to use this product in production. In addition, β-Phellandrene is a racemate (a racemate is a mixture of equal amounts of left-handed and right-handed forms), and there are no chiral commodities of β-Phellandrene and its structural analogues to replace it.

[0005] Plant-derived pest attractants have been listed as biological pesticides by the Ministry of Agriculture and Rural Affairs. The development of such products is in line with the concept of green control of plant diseases and insect pests advocated by the country. The main factors limiting the development and application of such products include: the high upstream R&D costs of such compounds lead to high downstream application costs, and the field attractant effect is not ideal. At present, the development of plant-derived pest attractant products using attracting plants is in its infancy. Therefore, this field is in urgent need of providing new pest attractant products as green pest control products. Summary of the invention

[0006] The invention aims to provide a peach borer attractant with excellent activity.

[0007] In a first aspect, the present invention provides a compound of formula I, a stereoisomer thereof, or a pesticide acceptable salt thereof for use in preparing a peach borer attractant or a pesticide composition for controlling peach borer.

[0008]

[0009] in:

[0010] X 1 CR a R b , O or S; R a and R b Independently selected from the group consisting of H, D, C1-C4 alkyl or halogenated C1-C4 alkyl;

[0011] n is 0, 1, 2 or 3;

[0012] Each R 1 , R 2 and R 3 Independently selected from hydrogen, D, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, =C(substituted or unsubstituted C1-C6 alkyl)2, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C3-C6 cycloalkyl, phenyl, substituted or unsubstituted C1-C6 alkyl-OCO-; wherein the substitution refers to that one or more H on the group is independently substituted by a group selected from the following group: D, halogen, C1-C4 alkyl or halogenated C1-C4 alkyl;

[0013] R 5 and R 6 Independently selected from hydrogen, D, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C3-C6 cycloalkyl, phenyl, substituted or unsubstituted C1-C6 alkyl-OCO-; wherein the substitution refers to that one or more H on the group is independently substituted by a group selected from the following group: D, halogen, C1-C4 alkyl or halogenated C1-C4 alkyl;

[0014] Dashed lines represent chemical bonds or their absence;

[0015] Provided that the compound is not

[0016] In another preferred embodiment, the compound includes one or more technical features selected from the following group:

[0017] R 1 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-;

[0018] R 2Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-;

[0019] R 3 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-;

[0020] R 5 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, and C1-C4 alkyl-OCO-;

[0021] R 6 Selected from hydrogen, methyl, ethyl, propyl (such as n-propyl, isopropyl), butyl (such as n-butyl, sec-butyl, tert-butyl), pentyl (such as n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl and C1-C4 alkyl-OCO-.

[0022] In another preferred embodiment, X 1 is CH2, CH(C1-C4 alkyl) or O, preferably X 1 It is CH2 or CHCH3.

[0023] In another preferred embodiment, n is 0, 1 or 2.

[0024] In another preferred embodiment, each R 1 , R 2 , R 3 , R 5 and R 6 In the above, only one or two are not H; preferably, the substituents at the ortho or para position of the C atom connected to X1 are not H, preferably R 1 and R 5 Not for H.

[0025] In another preferred embodiment, n is 1, the dotted line represents a chemical bond or does not exist, and R 1 Not H and R 2 , R 3 , R5 and R 6 For H.

[0026] In another preferred embodiment, n is 0, 1 or 2, the dotted line represents a chemical bond or does not exist, R 2 and R 5 Any one that is not H and R 1 , R 3 and R 6 For H.

[0027] Preferably, a compound, a stereoisomer thereof, or a pesticide acceptable salt thereof is provided for preparing a peach borer attractant or a pesticide composition for controlling peach borer, wherein the compound is selected from the following group:

[0028]

[0029] In another preferred embodiment, the compound is selected from the following group:

[0030]

[0031] In another preferred embodiment, the compound is

[0032] In another preferred embodiment, the pesticide composition comprises the compound, its stereoisomer, or its pesticide-acceptable salt, and a pesticide-acceptable carrier.

[0033] The second aspect of the present invention is a method for luring peach borer, which comprises applying any compound described in the first aspect of the present invention, its stereoisomer, or its pesticide acceptable salt or a pesticide composition containing the same to crops or a planting environment, thereby luring peach borer.

[0034] The third aspect of the present invention provides a peach borer trapping device, the trapping device comprises at least one open container and an attractant placed therein, the attractant is the compound of formula I described in the first aspect of the present invention, its stereoisomer, or its pesticide acceptable salt, or a pesticide composition containing the same.

[0035] In another preferred embodiment, the peach borer can enter the container through at least one opening, and the attractant can diffuse outward through at least one opening (which may be the same as or different from the opening through which the peach borer enters).

[0036] In another preferred embodiment, the device also includes chemicals (such as pesticides) or physical devices (such as cages, nets, glue, ultraviolet lamps, high temperatures, electric shocks) for capturing or killing peach borers that enter the container.

[0037] A fourth aspect of the present invention provides a method for controlling peach borer, wherein the trapping device described in the third aspect of the present invention is placed near crops to control peach borer.

[0038] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 :Development of GOBP1 and GOBP2 proteins

[0040] Figure 2 Experimental setup in a light-on environment

[0041] Figure 3 Experimental setup in dark environment (with red incandescent light)

[0042] Figure 4 Experimental results on behavioral selection of Peach Borer on compounds DETAILED DESCRIPTION

[0043] The inventors have conducted extensive and in-depth research, and through a large number of screenings and tests, provided a class of cyclohexene derivatives with excellent peach borer attracting activity, and a preparation method and use thereof, and completed the present invention on this basis.

[0044] the term

[0045] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0046] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0047] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0048] As used herein, the term "room temperature" or "normal temperature" refers to a temperature of 4-40°C, preferably, 25±5°C.

[0049] The prefix "C u-v " indicates that the following groups have u to v carbon atoms, such as "C 1-6" can be C1, C2, C3, C4, C5 or C6. For example, "C 1-6 "Alkyl" means that the alkyl group has 1 to 6 carbon atoms.

[0050] The term "plurality" refers to 2 or more, such as 2, 3, 4, 5 or 6.

[0051] The term "halogen" or "halo" refers to fluorine, chlorine, bromine, iodine.

[0052] In the present invention, the term "alkyl" means a saturated linear or branched hydrocarbon moiety, and the alkyl used herein or as part of other groups thereof has 1 to 6 carbon atoms (i.e., C1-C6 alkyl), 1 to 4 carbon atoms (i.e., C1-C4 alkyl) or 1 to 3 carbon atoms (i.e., C1-C3 alkyl). Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl and hexyl, etc.; preferably ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl and tert-butyl.

[0053] In the present invention, the term "alkoxy" refers to an -O-(alkyl) group. For example, the term "C1-C6 alkoxy" refers to a straight or branched alkoxy group having 1 to 6 carbon atoms (including 1-3 carbon atoms), including, but not limited to, methoxy, ethoxy, n-propoxy, isopropoxy and butoxy.

[0054] In the present invention, the term "alkenyl" refers to a straight chain or branched hydrocarbon moiety containing at least one double bond. For example, the term "C2-C6 alkenyl" refers to a straight chain or branched alkenyl group having 2 to 6 carbon atoms (including 2-4 carbon atoms or 2-3 carbon atoms) and containing one or two double bonds, including but not limited to ethenyl, propenyl, butenyl, isobutenyl, pentenyl and hexenyl.

[0055] In the present invention, the term "alkynyl" refers to a straight chain or branched alkynyl group containing one triple bond. For example, the term "C2-C6 alkynyl group" refers to a straight chain or branched alkynyl group containing one or two triple bonds having 2 to 6 carbon atoms (including 2-4 carbon atoms or 2-3 carbon atoms), including butynyl, acetylene, propynyl, butynyl, isobutynyl, pentynyl (2-methyl 3-butynyl, 2-pentynyl, 3-pentynyl) and hexynyl, etc.

[0056] Divalent groups such as "alkylene", "alkenylene" and "alkynylene" refer to divalent groups formed by the loss of one H atom from an alkyl, alkenyl or alkynyl group, and the above-defined alkyl, alkenyl or alkynyl groups may be applied to alkylene, alkenylene and alkynylene, respectively.

[0057] In the present invention, the term "cycloalkyl" refers to a saturated monocyclic, bridged or spirocyclic cyclic hydrocarbon moiety, for example, the term "C3-C6 cycloalkyl" refers to a monocyclic cyclic alkyl having 3 to 6 carbon atoms in the ring, including but not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. The term "bridged ring group" includes but is not limited to bicyclo[1,1,1]pentanyl, bicyclo[2,1,1]hexanyl, bicyclo[2,2,1]heptanyl, bicyclo[2,2,2]octanyl, bicyclo[3,2,2]octanyl, etc.

[0058] In the present invention, the term "aryl" refers to a hydrocarbon moiety containing one or more aromatic rings. 10 The term "aryl" refers to an aromatic ring group having 6 to 10 carbon atoms and containing no heteroatoms in the ring, such as phenyl, naphthyl, etc.

[0059] In the present invention, the term "heterocyclyl" refers to a saturated or unsaturated, non-aromatic cyclic group containing at least one (such as 1, 2, 3 or 4) ring heteroatom (such as N, O or S), such as tetrahydropyridyl, pyrrolinyl, dihydropyridyl, dihydrofuranyl, dihydrothiophenyl, morpholinyl.

[0060] In the present invention, the term "heteroaryl" refers to an aromatic cyclic group containing at least one (such as 1, 2, 3 or 4) ring heteroatom (such as N, O or S), for example furanyl, pyrrolyl, thienyl, oxazolyl, imidazolyl, thiazolyl, pyridyl, quinolyl, isoquinolyl, indolyl, pyrimidinyl, pyranyl.

[0061] The term "substituted" means that one or more hydrogen atoms in a specific group are replaced by any substituent mentioned in the specification of the present invention. If not specifically stated, the "substituted" means that one or more (such as 2, 3 or 4) hydrogen atoms on the group are independently replaced by a group selected from the group consisting of H, D, halogen, C1-C4 alkyl or halogenated C1-C4 alkyl.

[0062] Active ingredients

[0063] The present invention provides a compound of formula (I), its stereoisomers, or its pesticide acceptable salts:

[0064]

[0065] Among them, n, X1, R 1 , R 2 , R 3 , R 5 and R 6 As defined above.

[0066] In another preferred embodiment, n, X1, R 1 , R 2 , R3 , R 5 and R 6 are independently selected from the corresponding groups in the example compounds.

[0067] In another preferred embodiment, the compound is any one of the compounds in the examples.

[0068] The present invention is intended to include salts of compounds. A "pesticide-acceptable salt" may have more than one charged atom, and multiple charged atoms may have multiple counterions. In an exemplary embodiment, a salt form of the compound is produced that can convert an otherwise oily or viscous compound into a more easily handled solid material. In another exemplary embodiment, converting the free base of the compound of the present invention into the corresponding salt can increase the solubility of the compound in an aqueous medium, while being able to affect biological properties such as bioavailability, pharmacokinetics, and pharmacodynamics. Therefore, any salt form, such as a pharmaceutically acceptable salt of the compound of the present invention, including a salt of an inorganic acid or a salt of an organic acid is within the scope of the present invention. At the same time, various crystalline forms such as the pharmaceutically acceptable salts of the compound of the present invention are also within the scope of the present invention. Any prodrug of the compound of the present invention is also within the scope of the present invention. For example, R and R t It may be any group that is cleavable in vivo to produce an amine, such as a primary or secondary amine.

[0069] As used herein, the term "agrichemically acceptable salt" refers to salts that are suitable for contact with the tissues of humans and lower animals without excessive toxicity, irritation, allergic reactions, etc. and commensurate with a reasonable benefit / risk ratio within the scope of reasonable medical judgment. Pharmaceutically acceptable salts are well known in the art. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pesticide-acceptable non-toxic acid addition salts are salts formed by amino groups with inorganic acids (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid) or with organic acids (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid) or by using other methods used in the art (such as ion exchange). Other pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like.

[0070] Solvate refers to a combination or complex of one or more solvent molecules and the compounds of the present invention. Examples of solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and ethanolamine. The compounds of the present invention may exist in a non-solvated form or in a solvated form with a pharmaceutically acceptable solvent such as water, ethanol, etc., so the present invention will include both solvated and non-solvated forms.

[0071] Some compounds exist as tautomers. Tautomers are in equilibrium with each other. For example, amide-containing compounds can exist in equilibrium with imidic acid tautomers. No matter which tautomer is shown, no matter how the equilibrium properties between tautomers are, it is understood by those of ordinary skill in the art that compounds contain all or each tautomer of the compound. Therefore, amide-containing compounds are understood to contain their imidic acid tautomers. Similarly, imidic acid-containing compounds are understood to contain their amide tautomers.

[0072] The compounds of the present invention may contain asymmetric centers or chiral centers, and therefore different stereoisomeric forms exist. The compounds may be chiral, racemic or may exist as compositions comprising one or more stereoisomers. The present invention includes enantiomers, diastereomers, racemic mixtures, mixtures enriched in enantiomers and mixtures enriched in diastereomers. All stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers and hindered isomers, and mixtures thereof such as racemic mixtures, will form a part of the present invention. In addition, asymmetric carbon atoms may be present in substituents such as alkyl. All of these isomers and mixtures thereof are intended to be included in the present invention. If a specific enantiomer of the compounds of the present invention is desired, it may be prepared by asymmetric synthesis, or by derivatization with a chiral auxiliary, wherein the resulting diastereomeric mixture is separated and the auxiliary group is split to provide a pure desired enantiomer. Alternatively, when the molecule contains a basic functional group such as an amino group, or an acidic functional group such as a carboxyl group, diastereomeric salts may be formed with an appropriate optically active acid or base, followed by separation of the diastereomers so formed by fractional crystallization or chromatography known in the art, and subsequent recovery of the pure enantiomers. In addition, separation of enantiomers and diastereomers may be achieved using chromatography on a chiral stationary phase.

[0073] In this article, when the stereochemistry of any particular chiral atom is not determined, all stereoisomers are considered. In addition, the present invention relates to all geometric and positional isomers. The compounds of this invention can exist in different tautomeric forms, and all these forms are included within the scope of the present invention. All stereoisomers of the compounds of this invention are expected to include mixtures or pure or substantially pure forms.

[0074] In this article, unless otherwise stated, structures depicted herein are also intended to include compounds that differ only in the presence of one or more isotopically enriched atoms. In addition to therapeutic uses, such compounds can be used, for example, as analytical tools or probes in biological assays. Any formula or structure given herein is also intended to represent unlabeled forms of the compound as well as isotopically labeled forms. Isotopically labeled compounds have structures described by the formulas given herein, except that one or more atoms are replaced by atoms with selected atomic masses or mass numbers. Examples of isotopes that can be incorporated into the compounds of the present disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as, but not limited to, 2 H (deuterium, D), 3 H (tritium), 11 C. 13 C. 14 C. 15 N. 18 F. 31 P. 32 P. 35 S.36 Cl and 125 I. Various isotopically labeled compounds of the present disclosure, for example, incorporating radioactive isotopes such as 3 H and 14 C, can be used in metabolic studies, reaction kinetics studies, detection or imaging techniques such as positron emission tomography (PET) or single photon emission computed tomography (SPECT), including drug or substrate tissue distribution analysis or radiotherapy of patients.

[0075] Composition and application thereof

[0076] The term "active substance of the present invention" or "active compound of the present invention" refers to the compound of the present invention, its stereoisomers, or pesticidally acceptable salts, which have a significant attraction effect on peach borer (Dichocrocis punctiferalis).

[0077] Therefore, the present invention provides the use of the active ingredient of the present invention as an attractant for peach borer.

[0078] The active substance of the present invention can be prepared into a peach borer attractant composition in a conventional manner, such as a solution, emulsion, foam, powder, paste and granule, etc. Aerosols are microcapsules of natural or synthetic materials impregnated with active substances in polymers.

[0079] These preparations can be produced by known methods, such as mixing the active compound with an extender, which is a liquid, liquefied gas or solid diluent or carrier and can be mixed with any surfactant to form a formulation. In addition, when water is used as an extender, an organic solvent can be used as a cosolvent.

[0080] When a liquid is used as a diluent or carrier, it is basically suitable, such as aromatic hydrocarbons, such as xylene, toluene or alkylnaphthalene; chlorinated aromatic or aliphatic hydrocarbons, such as chlorobenzene, vinyl chloride or methylene chloride; aliphatic hydrocarbons, such as cyclohexane or paraffin; alcohols, such as ethanol or ethylene glycol and their ethers or polymers; ketones, such as acetone, methyl ethyl ketone, methyl isobutyl ketone or cyclohexanone; other polar solvents, such as N,N-dimethylformamide, dimethyl sulfoxide or water.

[0081] Liquefied gas diluents or carriers refer to liquids that will become gases at normal temperature and pressure, such as aerosol propellants, such as halogenated hydrocarbons as well as butane, propane, nitrogen and carbon dioxide.

[0082] Solid carriers can be ground natural minerals such as clay, quartz, talc, montmorillonite, activated clay, kaolin or diatomaceous earth, and ground synthetic minerals such as dispersed silicic acid, silicates and alumina. Solid carriers for particles are aged and graded natural zircons such as calcite, pumice, marble, sepiolite and dolomite, as well as inorganic and organic coarse powders and synthetic particles, organic materials include sawdust, coconut shells, corn cobs and tobacco stems and crushed particles thereof, etc.

[0083] Nonionic and anionic emulsifiers can be used as emulsifiers and / or foam formers, such as polyoxyethylene-fatty acid esters, polyoxyethylene-fatty alcohol ethers, alkylaryl polyethylene glycols, alkyl sulfonates, alkyl sulfates, aryl sulfonates and albumin hydrolysates. Dispersants include lignin sulfite waste liquor and methylcellulose.

[0084] Binders such as carboxymethylcellulose and natural or synthetic polymers in the form of powders, granules or emulsions, such as gum arabic, polyethylene and polyvinyl acetate, may be used in the formulations.

[0085] Colorants that may be used include inorganic dyes such as iron oxide, cobalt oxide and Prussian blue; organic dyes such as azo dyes or metal phthalocyanine dyes, and trace nutrients such as salts of iron, manganese, zinc, boron, copper, cobalt and aluminum.

[0086] The active compound of the present invention can be used in a mixture with other active compounds, such as pesticides.

[0087] The active compounds of the present invention can be used in a mixture with synergists to enhance the activity of the compounds of the present invention.

[0088] These preparations usually contain 0.001-99.999% by weight, preferably 0.1-99.9% by weight, more preferably 0.5-90% by weight of the active compound of the present invention. The content of the active compound in the use form prepared from the commercial preparations can vary within a wide range.

[0089] The active substance or composition of the present invention can be used as an attractant to prepare a trapping device for peach borer, and the trapping device includes a container with at least one opening and an attractant placed therein. The peach borer can enter the container through at least one opening, and the attractant can diffuse outward through at least one opening (which can be the same as or different from the opening through which the peach borer enters). Preferably, the device also includes a drug or device for killing the peach borer entering the container, including but not limited to chemical drugs such as pesticides, etc., and physical methods such as cages, nets, viscose, ultraviolet lamps, high temperatures, electric shocks, etc. These can be set as needed by those skilled in the art.

[0090] Host plants of peach borer include sorghum, corn, millet, sunflower, castor, ginger, cotton, peach, persimmon, walnut, chestnut, fig, pine, etc. The active substance or composition of the present invention can be placed near these plants, especially in a trap (which can be set near or on the plant) to lure peach borer away from these plants themselves and further capture or kill them.

[0091] Preparation method of the compound of the present invention

[0092] The target compound of the present invention can be obtained by reacting the compounds represented by formula A, formula B and formula C. The conditions of the method, such as raw materials, solvents, temperature, ratio and reaction time, are not limited to the following embodiments.

[0093] C1-C10 can be prepared according to formula 1: using para-substituted cyclohexanone as a raw material, 2-iodoacylbenzoic acid (IBX) as an oxidant, DMSO as a solvent, reacting at 70±10 degrees, and purifying to obtain para-substituted 2-cyclohexenone (B); methyltriphenylphosphine and n-butyllithium generate a phosphine ylide reagent at 0±4 degrees, and the 2-cyclohexenone obtained in the previous step undergoes a wittig reaction with the phosphine ylide reagent to obtain the final product C.

[0094] C10-C21 can be prepared according to formula 2: using para-substituted cyclohexanone as a raw material, a wittig reaction is carried out with a phosphine ylide reagent to obtain the final product C10-C21.

[0095] C23-C29 can be prepared according to formula 3: cycloenone undergoes 1,4-addition with isopropylmagnesium chloride under the catalysis of cuprous iodide and lithium chloride, acidic hydrolysis to obtain 3-substituted cyclic ketone, and finally undergoes wittig reaction with phosphine ylide reagent to obtain the final product.

[0096]

[0097] The main advantages of the present invention include:

[0098] The invention provides a series of novel compounds with excellent peach borer attracting activity.

[0099] Compared with β-phellandrene, the compound of the invention is easy to prepare, has low production cost and is very suitable for large-scale use.

[0100] The present invention will be further described below in conjunction with specific implementation. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0101] The target products in the following Examples 1 to 18 were confirmed by nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry.

[0102] Example 1 Synthesis of (rac)-β-phellandrene

[0103]

[0104] Place a magnetic stirrer in a 50 mL round-bottom flask, add 4-isopropylcyclohexanone (140 mg, 1 mmol) and 2-iodoacetylbenzoic acid (420 mg, 1.5 mmol), and add DMSO (3 mL), place the mixture in an oil bath at 60 ° C and stir for 6 hours. Detect the progress of the reaction by TLC, move to room temperature after the reaction is complete, and filter the precipitated solid through diatomaceous earth. The filtrate is extracted with ethyl acetate, and the combined organic layer is washed with saturated sodium bicarbonate, saturated brine, and water in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product is purified by column chromatography to obtain (rac)-4-isopropylcyclohex-2-ene-1-one (developing solvent is PE:EA=20:1→PE:EA=5:1). The target product is confirmed by nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry.

[0105] Its physical and chemical properties are as follows: yellow oil, yield is 81%. 1 H NMR (400MHz, CDCl3) δ6.89 (dd, J=10.3, 2.0Hz, 1H), 6.00 (d, J=10.3Hz, 1H), 2.51 (dt, J=16.7, 4.4Hz, 1 H),2.42–2.31(m,1H),2.09–1.93(m,1H),1.88–1.66(m,2H),1.38–1.16(m,1H),0.96(t,J=6.5Hz,6H).

[0106] Place a magnetic stirrer in a 10mL Schlenk reaction tube and dry the reaction tube. Add methyltriphenylphosphonium iodide (98%, 456mg, 1.1mmol) and replace the nitrogen. Then, under nitrogen protection, add dry THF (3mL) and start stirring. Cool the mixture to 0°C, then add n-BuLi (1.6M, 652μL, 1mmol) dropwise and stir at this temperature for 40 minutes. Add the above-mentioned (rac)-4-isopropylcyclohex-2-ene-1-one (138mg, 1mmol) in THF (1mL) cold solution dropwise, and stir the reaction mixture at room temperature for 1 hour. Detect the reaction progress by TLC, and stop the reaction after the reaction is complete. Add methanol aqueous solution to the reaction mixture to quench, and extract the resulting mixture with CH2Cl2. The combined organic layer is washed with water and saturated brine in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product was purified by column chromatography (developing solvent: PE→PE:EA=30:1) to obtain the target product (rac)-β-phellandrene.

[0107] Its physical and chemical properties are as follows: colorless oil, yield is 46%. 1 H NMR (400MHz, CDCl3) δ6.15(dd,J=10.0,2.6Hz,1H),5.75(d,J=10.1Hz,1H),4.78(m,J=9.4Hz,2H),2.44(dt,J=15.0,4.2Hz,1H) ,2.35–2.23(m,1H),2.09–2.02(m,1H),1.77(dq,J=13.1,4.3Hz,1H),1.70–1.60(m,1H),1.47–1.33(m,1H),0.95–0.84(m,3H).

[0108] Example 2 Synthesis of 3-(tert-butyl)-6-methylenecyclohex-1-ene

[0109]

[0110] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-(tert-butyl)cyclohex-2-en-1-one are as follows: yellow oil, yield 80%. 1 H NMR (400MHz, CDCl3) δ7.11–7.15(m,J=3.5Hz,1H),6.14(d,J=10.3Hz,1H),2.63(dd,J=16.6,3.9Hz,1H ),2.51–2.38(m,1H),2.31(d,J=10.3Hz,1H),2.26–2.17(m,1H),1.94–1.76(m,1H),1.11–1.05(m,9H).

[0111] The physical and chemical properties of 3-(tert-butyl)-6-methylenecyclohex-1-ene are as follows: yellow oil, yield 50%. 1 H NMR (400MHz, CDCl3) δ6.21 (dd, J=10.2, 2.8Hz, 1H), 5.89 (d, J=10.2, 2.0Hz, 1H), 4.87–4.71 (m, 2H), 2.60 –2.42(m,1H),2.40–2.25(m,1H),2.07–1.99(m,1H),1.97–1.86(m,1H),1.45–1.36(m,1H),0.94(s,9H).

[0112] Example 3 Synthesis of 3-ethyl-6-methylenecyclohex-1-ene

[0113]

[0114] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-ethylcyclohex-2-en-1-one are as follows: yellow oil, and the yield is 74%. 1 H NMR(400MHz, CDCl3) δ6.90(dd,J=10.3,2.6Hz,1H),6.09–5.91(m,1H),2.52(dt,J=16.8,4.9Hz,1H),2.45–2.29(m,2H),2.14( dq,J=10.3,4.9Hz,1H),1.77–1.65(m,1H),1.59(dt,J=14.3,7.1Hz,1H),1.49(dt,J=14.1,7.3Hz,1H),1.03(t,J=7.4Hz,3H).

[0115] The physical and chemical properties of 3-ethyl-6-methylenecyclohex-1-ene are as follows: light yellow oil, yield 35%. 1 H NMR (400MHz, CDCl3) δ6.11(dd,J=9.9,2.4Hz,1H),5.73(dt,J=10.2,2.0Hz,1H),4.75(m,J=11.3Hz,2H),2.42(dt,J=15.1, 4.8Hz,1H),2.34–2.24(m,1H),2.16–1.92(m,1H),1.85(tt,J=11.0,5.4Hz,1H),1.47–1.19(m,3H),0.94(t,J=7.5Hz,3H).

[0116] Example 4 Synthesis of 3-methylene-6-(tert-pentyl)cyclohex-1-ene

[0117]

[0118] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-(tert-pentyl)cyclohex-2-en-1-one are as follows: yellow oil, yield 82%. 1 H NMR (400MHz, CDCl3) δ7.08–6.91(m,1H),6.15–5.88(m,1H),2.56–2.41(m,1H),2.39–2.21(m ,2H),2.08–1.97(m,1H),1.81–1.64(m,1H),1.35(td,J=7.5,3.6Hz,2H),0.95–0.79(m,9H).

[0119] The physical and chemical properties of 3-methylene-6-(tert-pentyl)cyclohex-1-ene are as follows: light yellow oil, yield 50%. 1 H NMR(400MHz, CDCl3) δ6.21(dd,J=10.1,3.1Hz,1H),5.87(dd,J=10.3,2.0Hz,1H),4.82–4.69(m,2H),2.50(dt,J=14.8, 3.8Hz,1H),2.39–2.25(m,1H),2.13(dd,J=11.6,3.6Hz,1H),1.92–1.80(m,1H),1.46–1.32(m,3H),0.91–0.85(m,9H).

[0120] Example 5 Synthesis of (4-methylenecyclohex-2-enyl)benzene

[0121]

[0122] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-phenylcyclohex-2-ene-1-one are as follows: brown solid, with a yield of 75%. 1 H NMR (400MHz, CDCl3) δ7.47–7.22(m,6H),7.03(m,J=10.1,2.9,1.4Hz,1H),6.20(dd,J=10.1,2.6Hz ,1H),3.76(ddt,J=9.9,5.1,2.7Hz,1H),2.66–2.46(m,2H),2.45–2.34(m,1H),2.17–2.01(m,1H).

[0123] The physical and chemical properties of (4-methylidenecyclohex-2-enyl)benzene are as follows: yellow oil, yield 48%. 1H NMR (400MHz, CDCl3) δ7.41–7.08(m,6H),6.32(dd,J=9.8,2.3Hz,1H),5.85(d,J=8.4Hz,1H),4.85 (m,J=16.3Hz,2H),2.48–2.29(m,2H),2.13–2.01(m,10H),1.76–1.60(m,1H),1.58–1.46(m,1H).

[0124] Example 6 Synthesis of 3-methylene-6-propylcyclohex-1-ene

[0125]

[0126] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-propylcyclohex-2-en-1-one are as follows: yellow oil, yield 65%. 1 H NMR (400MHz, CDCl3) δ6.83 (m, J=10.3Hz, 1H), 5.94 (dd, J=10.1, 2.5Hz, 1H), 2.46 (dt, J=16.7, 4.8Hz, 1H), 2.34–2.26 (m, 1H), 2.13–2.03(m,1H),1.65(tdd,J=13.2,9.3,4.4Hz,1H),1.51–1.37(m,4H),1.23(td,J=7.2,0.8Hz,1H),0.93(t,J=6.8Hz,3H).

[0127] The physical and chemical properties of 3-methylene-6-propylcyclohex-1-ene are as follows: yellow oil, yield 45%. 1 H NMR (400MHz, CDCl3) δ6.11(dd,J=9.9,2.4Hz,1H),5.72(d,J=9.9Hz,1H),4.75(m,J=11.7Hz,2H),2.42(dt,J=15.0,4.9Hz,1H), 2.29(dddd,J=15.2,11.7,5.4,2.1Hz,1H),2.18(s,1H),1.85(dt,J=14.8,4.9Hz,1H),1.38–1.27(m,5H),0.92(t,J=6.8Hz,3H).

[0128] Example 7 Synthesis of 3-(4-ethylcyclohexyl)-6-methylidenecyclohex-1-ene

[0129]

[0130] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-(4-ethylcyclohexyl)cyclohex-2-en-1-one are as follows: yellow oil, yield 50%. 1 H NMR (400MHz, CDCl3) δ6.93 (dd, J=10.4, 2.5Hz, 1H), 6.00 (d, J=10.3Hz, 1H), 2.5 9–2.42(m,1H),2.33(ddd,J=23.0,12.1,5.5Hz,2H),2.00(dd,J=13.3,5.0Hz,1H ),1.80(td,J=14.0,3.1Hz,4H),1.73–1.62(m,1H),1.41(ddt,J=12.2,7.7,4.9 Hz,1H),1.23(dq,J=14.7,7.5Hz,3H),1.16–1.01(m,3H),0.88(t,J=7.4Hz,3H).

[0131] The physical and chemical properties of 3-(4-ethylcyclohexyl)-6-methylidenecyclohex-1-ene are as follows: yellow oil, yield 42%. 1 HNMR (400MHz, CDCl3) δ6.12(dd,J=10.0,2.7Hz,1H),5.77(d,J=10.1Hz,1H),4.73(m,J=8.3Hz,2H),2.43(dt,J=15.0,4.6Hz ,1H),2.33–2.20(m,1H),1.82–1.65(m,6H),1.51–1.38(m,1H),1.24–1.16(m,3H),1.12–0.96(m,3H),0.86(t,J=7.4Hz,5H).

[0132] Example 8 Synthesis of 3-methylene-6-pentylcyclohex-1-ene

[0133]

[0134] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-pentylcyclohex-2-en-1-one are as follows: yellow oil, and the yield is 73%. 1 H NMR (400MHz, CDCl3) δ7.00(m,J=10.4Hz,1H),6.11(dd,J=10.2,2.6Hz,1H),2.63(dq,J=13.6,4.3Hz,1H),2.50(ddt,J =21.7,12.5,5.1Hz,2H),2.32–2.21(m,1H),1.83(dtd,J=17.5,8.5,4.4Hz,1H),1.58–1.41(m,8H),1.09–0.99(m,3H).

[0135] The physical and chemical properties of 3-methylene-6-pentylcyclohex-1-ene are as follows: yellow oil, yield 73%. 1 H NMR (400MHz, CDCl3) δ6.10(d,J=9.9Hz,1H),5.72(dd,J=10.0,2.8Hz,1H),4.75(d,J=11.8Hz,2H),2.42(dt,J=15.1,4.9Hz,1H),2 .29(ddt,J=15.0,11.8,2.8Hz,1H),2.16(t,J=6.7Hz,1H),1.85(dq,J=14.8,4.9Hz,1H),1.39–1.25(m,9H),0.89(t,J=6.8Hz,3H).

[0136] Example 9 Synthesis of 4-methylenecyclohex-2-ene-1-carboxylic acid ethyl ester

[0137]

[0138] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-isopropyl-4-methylenecyclohexane are as follows: light yellow oil, with a yield of 30%. 1 H NMR (400MHz, CDCl3) δ6.38 (dd, J=9.9, 8.4Hz, 1H), 6.31 (dd, J=9.9, 1.Hz, 1H), 5.13 ( d, J=1.3Hz, 1H), 4.87 (d, J=1.3Hz, 1H), 4.16 (qd, J=6.4, 2.7Hz, 2H), 3.28 (dtd, J=8. 4,5.3,1.9Hz,1H),2.49(dd,J=9.2,6.4Hz,1H),2.39(dd,J=9.2,6.4Hz,1H),2.02(d dd,J=9.2,6.4,5.3Hz,1H),1.85(ddd,J=9.2,6.4,5.3Hz,1H),1.24(t,J=6.4Hz,3H).

[0139] Example 10 Synthesis of 4'-butyl-4-methylene-[1,1'-bi(cyclohexane)]-2-ene

[0140]

[0141] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-isopropyl-4-methylenecyclohexane are as follows: light yellow oil, with a yield of 30%. 1H NMR (400MHz, CDCl3) δ6.05(dd,J=9.9,1.8Hz,1H),5.90(ddd,J=10.1,8.4,1.8Hz,1H),5.13(d,J=1.3Hz,1H),4.88(d,J=1 .3Hz,1H),2.36(dd,J=9.2,6.5Hz,1H),2.29–2.20(m,2H),1.85–1.72(m,2H),1.63–1.18(m,18H),0.90(t,J=7.0Hz,3H).

[0142] Example 11 Synthesis of 1-isopropyl-4-methylenecyclohexane

[0143]

[0144] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-isopropyl-4-methylenecyclohexane are as follows: colorless oil, yield 70%. 1 H NMR (400MHz, CDCl3) δ4.58(s,2H),2.36–2.26(m,2H),2.08–1.93(m,2H),1.86–1.73(m,2H),1.46( dq,J=13.2,6.5Hz,1H),1.22–1.16(m,1H),1.06(qd,J=12.5,4.1Hz,2H),0.87(s,3H),0.86(s,3H).

[0145] Example 12 Synthesis of 1-methyl-4-(tert-pentyl)cyclohexane

[0146]

[0147] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-methyl-4-(tert-pentyl)cyclohexane are as follows: colorless oil, yield is 68%. 1 H NMR (400MHz, CDCl3) δ4.57(s,2H),2.39–2.25(m,2H),2.04–1.92(m,2H),1.84–1. 75(m,2H),1.25(q,J=7.2Hz,3H),1.06(qd,J=12.7,3.8Hz,2H),0.83–0.77(m,9H).

[0148] Example 13 Synthesis of 1-methyl-4-propylcyclohexane

[0149]

[0150] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-methyl-4-propylcyclohexane are as follows: colorless oil, yield 50%. 1 H NMR (400MHz, CDCl3) δ4.58 (s, 2H), 2.28 (d, J = 13.4Hz, 2H), 2.01 (td, J = 13.4, 4.6Hz, 2H), 1.80 (dd, J = 13. 0,3.8Hz,2H),1.36–1.24(m,3H),1.23–1.13(m,2H),0.98(qd,J=12.5,4.0Hz,2H),0.88(t,J=7.2Hz,3H).

[0151] Example 14 Synthesis of 4-methylenecyclohexane-1-carboxylic acid ethyl ester

[0152]

[0153] The specific operation steps are the same as those in Example 1. The physical and chemical properties of ethyl 4-methylenecyclohexane-1-carboxylate are as follows: light yellow oil, and the yield is 99%. 1 H NMR (400MHz, CDCl3) δ4.73–4.57(m,2H),4.25–4.02(m,2H),2.43(ddt,J=11.1,8.8,3.6Hz, 1H),2.33(dt,J=10.2,3.6Hz,2H),2.12–1.94(m,4H),1.67–1.50(m,2H),1.29–1.21(m,3H).

[0154] Example 15 Synthesis of 1-methyl-6-methylene-4-(prop-1-en-2-yl)cyclohex-1-ene

[0155]

[0156] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-methyl-6-methylene-4-(prop-1-en-2-yl)cyclohex-1-ene are as follows: colorless oil, yield 46%. 1 H NMR(400MHz, CDCl3)δ5.69(d,J=4.3Hz,1H),4.90(s,1H),4.79(s,1H),4.75–4.73(m,2H),2.53–2.4 1(m,1H),2.35–2.17(m,3H),2.12–2.02(m,1H),1.82(dt,J=2.4,1.4Hz,3H),1.75(t,J=1.1Hz,3H).

[0157] Example 16 Synthesis of 1-isopropyl-4-methyl-2-methylenecyclohexane

[0158]

[0159] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-isopropyl-4-methyl-2-methylenecyclohexane are as follows: colorless oil, yield 75%. 1 H NMR (400MHz, CDCl3) δ4.73(s,1H),4.62(s,1H),2.32(dd,J=12.6,3.9Hz,1H),2.00(dq,J=13.3,6.6Hz,1H),1.8 5–1.77(m,2H),1.76–1.65(m,2H),1.32–1.27(m,1H),1.26–1.17(m,1H),1.16–1.06(m,1H),0.98–0.90(m,9H).

[0160] Example 17 Synthesis of 4-methyl-2-methylene-1-(propan-2-ylidene)cyclohexane

[0161]

[0162] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 4-methyl-2-methylene-1-(prop-2-ylidene)cyclohexane are as follows: colorless oil, yield 15%. 1 H NMR(400MHz, CDCl3)δ4.99(s,1H),2.34(dd,J=12.9,6.1Hz,0H),2.28–2.18(m,1H),2.12–1.98(m,0H),1.96–1.78 (m,0H),1.70(t,J=1.1Hz,3H),1.61–1.53(m,0H),1.41(dddd,J=12.8,8.6,6.7,6.0Hz,1H),0.92(d,J=7.2Hz,2H).

[0163] Example 18 Synthesis of 1-ethylidene-4-(tert-pentyl)cyclohexane

[0164]

[0165] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-ethylidene-4-(tert-pentyl)cyclohexane are as follows: colorless oil, yield 33%. 1H NMR(400MHz, CDCl3)δ5.12(d,J=6.9Hz,1H),2.67(dt,J=13.6,3.1Hz,1H),2.24–2.17(m,1H),1.98(t,J=13.6Hz,1H), 1.83–1.72(m,2H),1.69–1.62(m,1H),1.57(d,J=4.8Hz,4H),1.31–1.18(m,2H),1.11–0.91(m,2H),0.86–0.75(m,6H).

[0166] Example 19 Synthesis of 1-ethylidene-4-propylcyclohexane

[0167]

[0168] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-ethylidene-4-propylcyclohexane are as follows: colorless oil, yield 35%. 1 H NMR (400MHz, CDCl3) δ5.13(q,J=6.8Hz,1H),2.59(dt,J=13.6,4.5Hz,1H),2.16(dt,J=13.2,4.6Hz,1H),2.06–1.94(m,1H),1.87–1.63 (m,3H),1.57(dt,J=6.7,2.0Hz,3H),1.40(ddd,J=14.6,7.1,3.5Hz,1H),1.35–1.28(m,3H),1.22–1.12(m,3H),0.88(t,J=7.3Hz,3H).

[0169] Example 20 Synthesis of 1-ethylidene-4-isopropylcyclohexane

[0170]

[0171] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 1-ethylidene-4-isopropylcyclohexane are as follows: colorless oil, yield 31%. 1H NMR (400MHz, CDCl3) δ5.13(q,J=6.7Hz,1H),2.63(dt,J=13.8,2.7Hz,1H),2.19(dt,J=15.5,2.7Hz,1H),2.06–1.91(m,1H),1.79–1.62(m,3 H),1.57(dt,J=6.9,1.6Hz,3H),1.45(td,J=13.1,6.8Hz,1H),1.20(ddt,J=11.9,6.0,3.3Hz,1H),1.10–0.94(m,2H),0.86(d,J=6.8Hz,6H).

[0172] Example 21 Synthesis of 3-ethylidene-6-isopropylcyclohex-1-ene

[0173]

[0174] The specific operation steps are the same as those in Example 1. The physical and chemical properties of 3-ethylidene-6-isopropylcyclohex-1-ene are as follows: colorless oil, yield 34%. 1 H NMR (400MHz, CDCl3) δ6.43(d,J=7.3Hz,0.33H,minor isomer),6.05(d,J=10.0Hz,1H,major isomer),5.74(d,J=10.1Hz,0.32H,minor isomer),5.59(d,J=12.7Hz,0.99H,major isomer),5.36–5.24(m,1.94H,major isomer),5.17(t,J=7.2Hz,0.36H,minor isomer),2.57(dt,J=15.3,4.8Hz,1.07H,major+minor isomer),2.36–2.22(m,0.73H,major+minor isomer),2.14–1.97(m,2.95H,major+minor isomer),1.75(tt,J=9.0,4.6Hz,1.90H,major+minor isomer),1.67(d,J=7.0Hz,4.29H,major+minor isomer),1.60–1.51(m,1.65H,major+minor isomer),1.38(dtd,J=12.5,9.5,6.3Hz,2.99H,major+minor isomer),0.98–0.82(m,9.85H,major+minor isomer).

[0175] Examples 22-29 of the present invention were synthesized according to the following synthesis methods. The present invention is further described below in conjunction with specific compounds. The experimental methods not specified in the following compounds are usually carried out under conventional conditions. Unless otherwise specified, percentages and parts are calculated by weight.

[0176] The target products in the following Examples 23-30 were confirmed by nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry.

[0177] Example 22-23 Synthesis of 3-isopropylcyclohexanone and 1-isopropyl-3-methylenecyclohexane

[0178]

[0179] CuI (190 mg; 1 mmol) and LiCl (84 mg; 2 mmol) THF were added to a dry 100 mL Schlenk reaction bottle, cooled to 0 ° C, 2-cyclohexanone (960 mg; 10 mmol) and TMSCl (1.38 mL; 10 mmol) were added, and stirring continued for 1 h, and cooled to -78 ° C. Then, i-PrMgCl-LiCl (1.30 M; 8 mL, 11 mmol) was added and stirring continued for 4 h. NH4Cl aqueous solution was added to quench, heated to room temperature, and the reaction solution was extracted with EA. The organic phase was washed several times with NH4Cl aqueous solution until the aqueous phase remained colorless and then dried with Na2SO4. The solvent was removed by rotary evaporation to obtain a crude product. The crude product was treated with a mixture of EtOH and water (1:1, 30 mL) and HCl (2 M, 20 mL) and stirred at room temperature overnight. EA was added, the phases were separated, and the aqueous phase was extracted with EA. The organic phase was dried over anhydrous sodium sulfate and filtered to obtain a mother liquor. The solvent was removed by rotary evaporation to obtain 3-isopropylcyclohexanone as a colorless liquid (1.25 g) with a yield of 90%. 1 H NMR (400MHz, CDCl3) δ2.40–2.29(m,2H),2.22(ddt,J=13.7,8.6,4.2Hz,1H),2.12–2.00( m,2H),1.84(d,J=13.4Hz,1H),1.67–1.48(m,3H),1.43–1.28(m,1H),0.92–0.81(m,6H).

[0180] Place a magnetic stirrer in a 10mL Schlenk reaction tube and dry the reaction tube. Add methyltriphenylphosphonium iodide (98%, 456mg, 1.1mmol) and replace the nitrogen. Then, under nitrogen protection, add dry THF (3mL) and start stirring. Cool the mixture to 0°C, then add n-BuLi (1.6M, 652μL, 1mmol) dropwise and stir at this temperature for 40 minutes. Add the above-mentioned 3-isopropylcyclohexanone (140mg, 1mmol) in THF (1mL) cold solution dropwise, and stir the reaction mixture at room temperature for 1 hour. Detect the reaction progress by TLC, and stop the reaction after the reaction is complete. Add methanol aqueous solution to the reaction mixture to quench, and extract the resulting mixture with CH2Cl2. The combined organic layer is washed with water and saturated brine in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product was purified by column chromatography (developing solvent: PE→PE:EA=30:1) to obtain the target product 1-isopropyl-3-methylenecyclohexane (53 mg) in a yield of 40%. 1 H NMR (400MHz, CDCl3) δ4.59(s,1H),2.26(t,J=9.5Hz,0H),1.92(td,J=12.8,4.6Hz,1H),1.82(dt,J=12.4,3.7Hz,0H),1 .72(d,J=11.7Hz,1H),1.47(dq,J=12.9,6.5Hz,0H),1.31–1.21(m,1H),1.14–1.06(m,1H),0.88(dd,J=6.8,1.7Hz,6H).

[0181] Example 24-25 Synthesis of 3-isopropylcyclohexanone and 1-isopropyl-3-methylenecyclohexane

[0182]

[0183] Place a magnetic stirrer in a 50 mL round-bottom flask, add 3-isopropylcyclohexanone (840 mg, 3 mmol) and 2-iodoacetylbenzoic acid (2.25 g, 9 mmol), and add DMSO (18 mL), place the mixture in an oil bath at 60 ° C and stir for 48 hours. Detect the progress of the reaction by TLC, move to room temperature after the reaction is complete, and filter the precipitated solid through diatomaceous earth. The filtrate is extracted with EA, and the combined organic layer is washed with saturated sodium bicarbonate, saturated brine, and water in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product is purified by column chromatography to obtain 5-isopropylcyclohex-2-ene-1-one (187 mg) and 3-isopropylcyclohex-2-ene-1-one (115 mg) (developing solvent is PE:EA=30:1→PE:EA=10:1). The target product is confirmed by nuclear magnetic resonance spectrum and high-resolution mass spectrometry.

[0184] Place a magnetic stirrer in a 10mL Schlenk reaction tube and dry the reaction tube. Add methyltriphenylphosphonium iodide (98%, 456mg, 1.1mmol) and replace the nitrogen. Then, under nitrogen protection, add dry THF (3mL) and start stirring. Cool the mixture to 0°C, then add n-BuLi (1.6M, 652μL, 1mmol) dropwise and stir at this temperature for 40 minutes. Add the above-mentioned cold solution of 5-isopropylcyclohex-2-ene-1-one (140mg, 1mmol) in THF (1mL), and stir the reaction mixture at room temperature for 1 hour. Detect the reaction progress by TLC, and stop the reaction after the reaction is complete. Add methanol aqueous solution to the reaction mixture to quench, and extract the resulting mixture with CH2Cl2. The combined organic layer is washed with water and saturated brine in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product was purified by column chromatography (developing solvent: PE→PE:EA=30:1) to give the target product 5-isopropyl-3-methylenecyclohex-1-ene (40 mg) in a yield of 30%. 1 H NMR(400MHz, CDCl3) δ6.13(dt,J=9.2,0.8Hz,1H),5.75(dtd,J=9.2,6.4,1.8Hz,1H),5.00(s,2H),2.62–2.4 0(m,1H),2.31–2.06(m,2H),2.07–1.84(m,1H),1.79(m,1H),1.61(dt,J=7.9,6.2Hz,1H),1.20–0.45(m,6H).

[0185] According to the above steps, another product, 1-isopropyl-3-methylenecyclohex-1-ene, was obtained. 1H NMR (400MHz, CDCl3) δ6.04(q,J=0.9Hz,1H),5.03(s,2H),2.72-2.55(m,2H),2.49-2.30(m,3H),1.32(tt,J=7.2,6.6Hz,2H),1.00(d,J=6.9Hz,6H).

[0186] Example 26-27 Synthesis of 3-isopropylcyclopentanone and 1-isopropyl-3-methylenecyclopentane

[0187]

[0188] The specific operation steps are the same as those in Example 22. 3-isopropylcyclopentanone: 1 H NMR (400MHz, CDCl3) δ2.47–2.27(m,1H),2.25–2.08(m,1H),1.96–1.79(m,1H),1.60–1.44(m,1H),0.98(d,J=6.6Hz,1H),0.95(d,J=6.7Hz,6H).

[0189] The specific operation steps are the same as those in Example 23. 1-isopropyl-3-methylenecyclopentane: 1 H NMR (400MHz, CDCl3) δ4.77(s,1H),2.31–2.22(m,2H),2.18–2.09(m,1H),2.02–1.94(m,1H),1.88–1.78(m,1H),1.71(m,1H) ,1.66–1.54(m,J=6.7Hz,1H),1.47(ddt,J=12.5,7.2,5.2Hz,1H),0.86(dd,J=6.6,1.5Hz,3H),0.81(dd,J=6.7,1.5Hz,3H).

[0190] Example 28-29 Synthesis of 3-isopropylcycloheptanone and 1-isopropyl-3-methylenecycloheptane

[0191]

[0192] The specific operation steps are the same as those in Example 22. 3-isopropylcycloheptanone: 1 H NMR (400MHz, CDCl3) δ2.63-2.48(m,1H),2.42-2.19(m,3H),1.80(m,1H),1.73-1.63 (m,2H),1.62-1.21(m,5H),0.86(dd,J=6.6,1.5Hz,3H),0.81(dd,J=6.7,1.5Hz,3H).

[0193] The specific operation steps are the same as those in Example 23. 1-isopropyl-3-methylenecycloheptane: 1 H NMR (400MHz, CDCl3) δ4.75 (s, 2H), 2.26 (ddt, J = 13.9, 7.9, 1.0Hz, 1H), 2.16-2.01 (m, 1H), 1.9 0(ddt,J=13.7,7.9,0.9Hz,7H),1.63-1.29(m,3H),1.23-1.13(m,1H),0.88-0.84(m,4H),0.83 -0.78(m,4H).

[0194] Embodiments 30-31 of the present invention can be obtained by reacting the compounds represented by formula a, formula e, formula f, and formula g. The conditions of the method, such as raw materials, solvents, temperature, ratio, and reaction time, are not limited to the following compounds.

[0195] The present invention is further described below in conjunction with specific compounds. The experimental methods not specified in the following compounds are usually carried out under conventional conditions. Unless otherwise specified, percentages and parts are calculated by weight.

[0196] The target products in the following Examples 30-31 were confirmed by nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry.

[0197] Example 30 Synthesis of (R)-β-phellandrene

[0198]

[0199] Place a magnetic stirrer in a 10 mL Schlenk reaction tube and dry the reaction tube. Dissolve (R,R)-bis-(1-phenylethyl)amine (225 mg, 1 mmol) in anhydrous THF (5 mL), cool the resulting solution to -78 °C, and then drop n-BuLi (2.5 M, 400 μL, 1 mmol). After 20 minutes at -78 °C, add TMSCl (256 μL, 2 mmol, 2 equiv), and cool the resulting mixture to -110 °C. Add a solution of 4-isopropylcyclohexanone (140 mg, 1 mmol, 1 equiv) in THF (1 mL) dropwise, and stir at -110 °C for 2 hours. Then, add Et3N (2 ml) to quench the reaction mixture, and warm the mixture to room temperature. The resulting mixture is extracted with CH2Cl2 (3×20 mL), and the combined organic layers are washed with water and brine, dried over Na2SO4, filtered, and concentrated under reduced pressure. The obtained crude silyl enol ether can be directly used in the next reaction without further purification.

[0200] In a 50 mL round-bottom flask with a magnetic stirrer, crude silyl enol ether, 2-iodobenzoic acid (560 mg, 2 mmol, 2 equiv), 4-methoxypyridine-N-oxide hydrate (286 mg, 2 mmol, 2 equiv), and DMSO (3 mL) were added. After stirring for 1 hour, water and ethyl acetate were added to quench. The resulting mixture was extracted with ethyl acetate, and the combined organic layer was washed with water and saturated brine in turn, dried over Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by column chromatography to obtain (R)-4-isopropylcyclohex-2-en-1-one (developing solvent: PE:EA = 20:1 → PE:EA = 5:1). The target product was confirmed by nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry.

[0201] Place a magnetic stirrer in a 10mL Schlenk reaction tube and dry the reaction tube. Add methyltriphenylphosphonium iodide (98%, 456mg, 1.1mmol) and replace the nitrogen. Then, under nitrogen protection, add dry THF (3mL) and start stirring. Cool the mixture to 0°C, then add n-BuLi (1.6M, 652μL, 1mmol) dropwise and stir at this temperature for 40 minutes. Add the above-mentioned (R)-4-isopropylcyclohex-2-ene-1-one (138mg, 1mmol) in THF (1mL) cold solution dropwise, and stir the reaction mixture at room temperature for 1 hour. Detect the reaction progress by TLC, and stop the reaction after the reaction is complete. Add methanol aqueous solution to the reaction mixture to quench, and extract the resulting mixture with CH2Cl2. The combined organic layer is washed with water and saturated brine in turn, dried over Na2SO4, filtered and concentrated under reduced pressure. The crude product was purified by column chromatography (developing solvent: PE→PE:EA=30:1) to obtain the target product (R)-β-phellandrene.

[0202] Example 31 Synthesis of (S)-β-phellandrene

[0203]

[0204] The specific operation steps are the same as those in Example 30.

[0205] Test Example 1: Biological Activity Test of Ligand Compounds of the Present Invention

[0206] Method for synthesizing protein of the present invention

[0207] 1 Extraction and reverse transcription of total RNA from C. persicae

[0208] 1.1 Extraction of total RNA from antennae of C. persicae

[0209] The experiment used RNase free pipette tips and 1.5mL. The mortar was burned with alcohol before use and quickly cooled with liquid nitrogen. The desktop and pipette used in the experiment were all wiped clean with alcohol cotton. Gloves and masks were required throughout the experiment to prevent RNase contamination, causing RNA degradation and affecting the extraction quality. The Takara Bio Total RNA Rapid Extraction Kit was selected, and the operation steps are as follows:

[0210] (1) Add 50-100 mg of sample to a mortar pre-cooled with liquid nitrogen, grind the sample with a mortar, and continuously add a small amount of liquid nitrogen during grinding until the sample is ground into powder. Then carefully transfer the ground sample to a sterilized 15 mL centrifuge tube (600 μL Buffer RL and 12 μL DTT were added to the centrifuge tube in advance), and repeatedly blow with a pipette until there is no obvious precipitation in the lysate. Place the centrifuge tube at 4 °C and 12000 r / min.

[0211] (2) Place the gDNA Eraser Spin Colimn (provided with the kit) on a 2 mL Collection Tube C (provided with the kit). Use a pipette to transfer the supernatant (RNA is present in the supernatant) to the gDNA Eraser Spin Colimn and centrifuge at 12,000 rpm for 1 min.

[0212] (3) Add the same volume of ethanol (70%) to the 2 mL Collection Tube containing the filtrate and mix the solution. Discard the gDNAEraser Spin Colimn.

[0213] (4) Transfer the mixed solution to the RNA Spin Column and place it in a 2 mL Collection Tube. Centrifuge at 12000 r / min for 1 min, discard the filtrate in the Collection Tube, and place the RNA Spin Column back in the 2 mL Collection Tube. (Note: The RNA Spin Column can only hold liquids with a volume of less than 600 μL. If the mixed solution is larger than 600 μL, it needs to be added in batches).

[0214] (5) Add 500 μL of Buffer RWA to the RNA Spin Column, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.

[0215] (6) Add 600 μL of Buffer RWB to the RNA Spin Column, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate. Repeat this step once.

[0216] (7) Place the RNA Spin Column back on the 2 mL Collection Tube and centrifuge at 12,000 rpm for 2 min (empty), then discard the Collection Tube.

[0217] (8) Place the RNA Spin Column on a 1.5 mL RNase Free Collection Tube, carefully add 100 μL of RNase Free dH2O to the center of the RNase Free Collection Tube membrane, let stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 2 min to elute the RNA on the RNA Spin Column membrane.

[0218] (9) If you want to obtain a higher concentration of RNA, you can add the eluate back to the RNA Spin Column.

[0219] Let stand at room temperature for 5 minutes, repeat the previous step, and store the extracted RNA at -80℃.

[0220] (10) The integrity of total RNA was checked by 1% agarose gel electrophoresis.

[0221] (11) UV-visible spectrophotometer was used to detect the concentration and purity of total RNA.

[0222] 1.2 Reverse transcription synthesis of first-strand cDNA

[0223] The antennae total RNA was used as a template for reverse transcription to synthesize the first strand of cDNA. The first strand cDNA synthesis kit of Dalian Bao Biotechnology was selected, and the operation process was as follows: On an ice bath, prepare the first step of reverse transcription reaction solution according to Table 1, gently mix, and centrifuge briefly to allow the solution to pool at the bottom of the reaction tube.

[0224] Table 1 Reverse transcription reaction system

[0225]

[0226]

[0227] Reaction conditions are as follows: 37°C for 15 min (reverse transcription reaction)

[0228] 8 5℃5s (inactivation reaction of reverse transcriptase)

[0229] 4℃

[0230] The reverse transcription product was stored at -20°C or lower until use.

[0231] 2 Cloning of Odor Binding Protein GOBO1 and GOBP2 Genes of Concha Marinii

[0232] 2.1 Primer design and PCR reaction

[0233] According to the gene sequences of GOBP1 and GOBP2 of Concha boraginis found in NCBI, full-length primers of odorant binding proteins GOBP1 and GOBP2 were designed using Primer 3input.

[0234] GOBP1-F TACTTCAACCTGATCACCGA (SEQ ID No:1)

[0235] GOBP1-R CCTCCTCGAACTGCTTCT(SEQ ID No:2)

[0236] GOBP2-F TGGTTGTACTTCGGTTTTGGTG(SEQ ID No:3)

[0237] GOBP2-R AATTTCAGGAGAG(SEQ ID No:4)

[0238] 2.2 PCR amplification

[0239] Using the cDNA synthesized in the previous step as a template, the target gene was specifically amplified using Tsingke's gene amplification product 1×T3 SuperPCR Mix as follows:

[0240]

[0241] After mixing, put it into the gene amplification instrument and set the program as follows: ①98℃, 2mins; ②98℃, 10s; ③Tm±5℃, 10s; ④72℃, 10s (repeat steps ②-④, a total of 34 cycles); ⑤72℃, 2mins; ⑥4℃, ∞. After the reaction is completed, the PCR product is obtained.

[0242] 2.3 Recovery of target genes

[0243] The PCR product obtained in the previous step was subjected to 1% gel electrophoresis, and the gel at the target band was completely cut out and placed in a 1.5 mL centrifuge tube. A universal DNA recovery kit (Tiangen Biochemical Technology Co., Ltd.) was used to recover DNA according to the instructions.

[0244] 2.4 Ligation of target gene and external vector

[0245] The vector used was the pClone 007 kit from Qingke Xinye Biotechnology Co., Ltd. The operation method is as follows:

[0246]

[0247] Add dd H2O to 10.0 μL, mix well, put into the gene amplification instrument, and set the program to: 25°C, 5 mins. After the program is completed, the connection product is obtained.

[0248] 2.5 Conversion

[0249] (1) Place 50 μL of Trans 5α competent cells on ice, add the ligation product obtained in the previous step, and pipette

[0250] Mix by gently pipetting and let stand on ice for 30 mins.

[0251] (2) Heat the sample in a 42°C metal bath for 45 seconds and then place on ice for 2 minutes.

[0252] (3) Add 500 μL of LB liquid culture medium without antibiotics, place in a constant temperature oscillator, set the program to 37°C, 225 rpm / min, and incubate for 1 h.

[0253] (4) Take 100 μL of the incubated bacterial solution and transfer it to LB (containing ampicillin) solid culture medium and spread it evenly on the plate. 10 μL of ampicillin can be added during the spreading process.

[0254] (5) Incubate the culture medium from the previous step (with the culture dish turned upside down) in a 37°C incubator overnight for 12-15 hours.

[0255] 2.6 Bacteria test

[0256] Use a pipette tip to pick up a single colony from the culture medium after overnight culture and dissolve it in 10 μL sterile water. Use the 2×T5Super PCR Mix kit to perform PCR amplification as follows:

[0257]

[0258] After mixing the above reagents, put them into the gene amplification instrument and set the program ①98℃, 2mins; ②98℃, 10s; ③Tm±5℃, 10s; ④72℃, 10s (repeat steps ②-④, a total of 34 cycles); ⑤72℃, 2mins; ⑥4℃, ∞. After the program is completed, the product is detected by 1% gel electrophoresis, and the remaining bacterial solution with the correct band is selected and added to 1mL LB liquid culture medium containing ampicillin antibiotics, and placed in a constant temperature oscillator at 37℃ and incubated at 225rpm / min for 4-6h. Take out 500μL of the incubated bacterial solution and put it into a 1.5mL centrifuge tube, and send it to the company for sequencing (Nanjing Detai Bioengineering Co., Ltd.). After confirming that the sequence is correct, the bacterial solution can be expanded for use.

[0259] 2.7 Plasmid extraction

[0260] Plasmid extraction was performed using the TIANprep Midi Plasmid Kit according to the instructions.

[0261] 3. Prokaryotic expression vector construction

[0262] 3.1 Design of homologous recombination primers

[0263] Design of homologous recombination primers: After removing the signal peptide of the target gene, design homologous recombination primers according to the instructions of the homologous recombination kit.

[0264] GOBP1-F: CGGGATCCGACCACAAGATCAT(SEQ ID No:5)

[0265] GOBP2-R:CCAAGCTTCTAAGTCTCCGACTG(SEQ ID No:6)

[0266] GOBP2-F:AGCGAATTCGTGAAGAGCACTGCT(SEQ ID No:7)

[0267] GOBP2-R:CCGAAGCTTTCAGTATCTCTCCAT(SEQ ID No:8)

[0268] 3.2 Homologous recombination gene expansion:

[0269] Using the plasmid obtained in the previous step as a template, use a high-fidelity enzyme (2× High-Fidelity Master Mix) to clone the target gene as follows:

[0270]

[0271] After mixing, put it into the gene amplification instrument and set the program: ①98℃, 2mins; ②98℃, 10s; ③Tm±5℃, 10s; ④72℃, 10s (repeat steps ②-④, a total of 34 cycles); ⑤72℃, 5mins; ⑥4℃, ∞. After the reaction is completed, the obtained PCR product is detected by 1% gel electrophoresis and the target band is recovered.

[0272] 3.3 Double restriction enzyme digestion vector

[0273] This experiment uses the pET-32a expression vector, which is about 5900 bp in length. Use the selected restriction endonuclease to cut the vector as follows:

[0274]

[0275] Add ddH2O to 20 μL, mix well and put into the gene amplification instrument, set the program to 37°C, 1h, and after the program ends, the vector enzyme digestion product is obtained.

[0276] 3.4 Ligation of homologous recombination gene and restriction digestion vector

[0277] Connect the vector product digested in the previous step with the target gene recovered from the gel as follows:

[0278] Reagents Volume

[0279]

[0280] After mixing, put it into the gene amplification instrument and set the program to 50°C for 20 minutes. After the program is completed, the connection product is obtained.

[0281] 3.5 Conversion

[0282] (1) Place 50 μL of Trans 5α competent cells on ice, add the ligation product obtained in the previous step, and mix by gently pipetting with a pipette tip. Let stand on ice for 30 mins.

[0283] (2) Heat the sample in a 42°C metal bath for 45 seconds and then place on ice for 2 minutes.

[0284] (3) Add 500 μL of LB liquid culture medium without antibiotics, place in a constant temperature oscillator, set the program to 37°C, 225 rpm / min, and incubate for 1 h.

[0285] (4) Take 100 μL of the incubated bacterial solution and transfer it to LB solid medium (containing ampicillin antibiotics) and spread it evenly.

[0286] Plates can be coated with 10 μL of ampicillin.

[0287] (5) Incubate the culture medium from the previous step (with the culture dish turned upside down) in a 37°C incubator overnight for 12-15 hours.

[0288] 3.6 Bacteria inspection

[0289] Use a pipette tip to pick up a single colony from the culture medium after overnight culture and dissolve it in 10 μL sterile water. Use the 2×T5Super PCR Mix kit to perform PCR amplification as follows:

[0290]

[0291] After mixing the above reagents, put them into the gene amplification instrument and set the program ①98℃, 2mins; ②98℃, 10s; ③Tm±5℃, 10s; ④72℃, 10s (repeat steps ②-④, 34 cycles in total); ⑤72℃, 2mins; ⑥4℃, ∞. After the program is completed, the product is tested by 1% gel electrophoresis, and the remaining bacterial solution with the correct band is selected and added to 1mL LB liquid culture medium containing ampicillin antibiotics, and placed in a constant temperature oscillator at 37℃ and incubated at 225rpm / min for 4-6h. Take out 500μL of the incubated bacterial solution and put it into a 1.5mL centrifuge tube, and send it to the company for sequencing (Nanjing Detai Bioengineering Co., Ltd.). After confirming that the sequence is correct, the bacterial solution can be expanded for use.

[0292] 3.7 Plasmid extraction

[0293] Plasmid extraction was performed using the TIANprep Midi Plasmid Kit according to the instructions.

[0294] 3.8 Expression of recombinant plasmid

[0295] Add the correctly sequenced bacterial solution to 10mL of LB (containing ampicillin) liquid culture medium, place it in a constant temperature oscillator, set the program to 37°C, 225rpm / min, and culture for 8-10h. After the culture is completed, take 5mL of the bacterial solution and add it to 200mL of LB (containing ampicillin) liquid culture medium, then put it in a constant temperature oscillator, and culture the bacterial solution in the same way as above. When the absorbance value of the bacterial solution at a wavelength of 600nm reaches 0.6-0.8, put it in a water bath full temperature oscillator, and explore the induction conditions by changing the concentration of IPTG, induction temperature, oscillator speed and induction time.

[0296] 3.9 Purification of recombinant protein and verification by SDS-PAGE gel

[0297] (1) Obtaining recombinant protein: Place the induced bacterial solution in a precooled refrigerated centrifuge, set the program to 4°C, 4000×g, and centrifuge for 20 minutes. Discard the supernatant as much as possible. Add 20mL PBS buffer to the precipitate and fully dissolve the precipitate. Use an ultrasonic disruptor, set the program to 200W, 30 minutes, and sonicate the resulting turbid solution. Place the clear solution after sonication in a precooled refrigerated centrifuge, set the program to 4°C, 9000×g, and centrifuge for 20 minutes to separate the supernatant protein solution and the protein precipitate.

[0298] (2) Protein purification: Use Ni-NTA purification columns to purify soluble proteins according to the operating instructions.

[0299] (3) Determination of protein concentration: Use the BCA protein concentration detection kit to determine the concentration of the purified protein according to the operating instructions.

[0300] (4) Verification of SDS-PAGE gel: Prepare electrophoresis gel according to the instructions of the SDS-PAGE gel electrophoresis kit. Take 40 μL of supernatant protein (if it is a precipitate sample, use a pipette tip to take a small amount of precipitate and mix it in 40 μL PBS) in a 1.5 mL centrifuge tube, add 10 μL 5× Loading Buffer, and mix thoroughly. Use a metal bath and set the program to heat at 100°C for 5 mins to denature the protein. Use a normal temperature centrifuge and set the program to 5000×g. After centrifugation for 1 min, the sample is ready. When loading, take 15 μL of solution into the gel well. Set the protein electrophoresis instrument program to: 130V, 60mins. After the program is completed, remove the gel and stain it with Coomassie Brilliant Blue for more than 1 hour. Use a destaining solution to decolorize the gel until clear bands can be seen. Finally, use a spectrophotometer to measure the OD value of the renatured protein and calculate the protein concentration according to the Lambert-Beer method.

[0301] 3.10 Verification of recombinant protein by Western blotting

[0302] (1) Prepare electrophoresis gel according to the instructions of the SDS-PAGE gel electrophoresis kit. Take 40 μL of supernatant protein (if it is a precipitate sample, use the tip of the pipette to take a small amount of precipitate and mix it in 40 μL PBS) in a 1.5 mL centrifuge tube, add 10 μL of 5× Loading Buffer, and mix thoroughly. Use a metal bath and set the program to heat at 100°C for 5 mins to denature the protein. Use a normal temperature centrifuge and set the program to 5000×g. After centrifugation for 1 min, the sample is ready. When loading the sample, take 15 μL of the solution into the gel well. Set the protein electrophoresis instrument program to: 130V, 60 mins. After the program is completed, remove the gel and stain it with Coomassie Brilliant Blue for more than 1 hour. Use a destaining solution to destain the gel until clear bands can be seen.

[0303] (2) Transfer: Cut the electrophoresis gel containing the complete target band, and cut the PVDF membrane of the same size at the same time. Soak the PVDF membrane with CH3OH for 2 minutes, activate it and rinse it in the electrotransfer solution. Then spread the PVDF membrane on the gel (be careful not to have bubbles), put it in the transfer folder, cover it with filter paper and black cotton in turn, close the lid, put it in the electrotransfer tank (pay attention to the color correspondence, that is, the positive and negative poles correspond), pour in the electrotransfer solution, and set the program to 100mA, 60mins.

[0304] (3) Blocking: After the transferred PVDF membrane is washed 2-3 times with 1×TBST, it is placed in a 5% skim milk powder solution and blocked at 4°C for more than 1 h, and then washed 2-3 times with 1×TBST.

[0305] (4) Primary antibody incubation: Place the PVDF membrane in 20 mL of primary antibody (His tag Goat Anti-Rabbit, diluted to 1 / 1000) and incubate at 4°C for more than 1 h.

[0306] (5) Washing: After the primary antibody incubation, wash with 1× TBST 2-3 times.

[0307] (6) Secondary antibody incubation: Place the PVDF membrane in 20 mL of secondary antibody (Goat Anti-Rabbit IgG, diluted to 1 / 10000) and incubate in a shaker at room temperature for about 1 hour. After the secondary antibody incubation, use 1×TBST to elute 2-3 times.

[0308] (7) ECL development: Take 1 mL of each of solution A and solution B in the ECL colorimetric reagent kit into a centrifuge tube and mix thoroughly. Use a pipette to evenly add the colorimetric reagent to the front of the PVDF membrane and let it stand for 2 minutes away from light. Remove the PVDF membrane, use a gel imaging instrument to observe the results and take photos to record the results. Figure 1 shown.

[0309] Test Example 1 Binding of Concha oleracea liquid protein and ligand

[0310] The peach borer is known as "nine out of ten fruits are infested". It is difficult to control it chemically because of the characteristics of the larvae such as strong concealment and strong resistance to pesticides. Odor molecules enter the lymph through the small holes on the antennae, are bound by the insect OBP or CSP, and are transported to the membrane around the olfactory receptor neurons, where the signals are integrated and transmitted to the higher-level central nervous system, which then issues instructions to regulate the insect to make corresponding olfactory responses. Fluorescence competition binding experiments are often used to test the effect of insect OBP binding to odor compounds.

[0311] Add 250 μL of PBS buffer to a black 96-well plate, then add a certain amount of odorant-binding protein solution to make its final concentration 2 μM. Then add 1-NPN working solution with a concentration of 1 mM to the well plate so that the final concentration of the probe in the solution is 2 μM. Place the well plate in a microplate reader, measure the maximum fluorescence value and record it. Then add β-phellandrene structural analogues with a concentration of 1 mM to the protein-probe mixed solution so that their final concentrations are 4 μM, 8 μM, 12 μM, 16 μM, 20 μM, 24 μM, 28 μM, 32 μM, 36 μM, and 40 μM respectively. Mix well with a pipette tip and let it stand for 2 min. Measure the maximum fluorescence value and record it, repeating three times. Assume that OBP1 and OBP2 have 100% activity and the binding ratio with the ligand substance is 1:1. According to the IC 50 value (the concentration of the ligand corresponding to when the fluorescence intensity of the protein-probe complex solution decreases by half), calculate the binding constant of the protein with the β-phellandrene structural analogue. The calculation formula is as follows: Ki = [IC 50 / (1 + [1-NPN] / K1-NPN), where [1-NPN] is the concentration of free 1-NPN and K1-NPN is the dissociation constant of the protein-probe complex.

[0312] In addition to the compounds described above, the following commercially available compounds are also included

[0313]

[0314] Table 1 Binding of the compounds represented by general formulas (Ⅰ) and (Ⅱ) and commercially available compounds to the liquid protein of Conogethes punctiferalis

[0315]

[0316]

[0317] Note: IC 50 represents the concentration of the ligand when the fluorescence intensity decreases to 50% of the initial fluorescence intensity; Int(%) is the percentage of the relative fluorescence value at a concentration of 40 μMol / L; when the concentration of the odorant ligand reaches 40 μMol / L, the fluorescence intensity of the GOBP1 and GOBP2 complexes with 1-NPN still decreases by less than 50%, and the dissociation constants Ki of GOBP1 and GOBP2 with these odorants cannot be calculated. The data units in the table are μMol / L.

[0318] Among them, Ki < 50 indicates that the compound responds to the protein and the compound has biological activity; 20 < Ki < 50 indicates that the compound has a good response to the protein and the compound has good biological activity; Ki < 20 indicates that the compound has a strong response to the protein and the compound has very good biological activity.

[0319] Test Example 2: Behavioral testing of preferred ligand compounds

[0320] 1 Experimental Materials

[0321] Female adult of Concha oleracea, C1 (β-phellandrene), C4, C6, C11, liquid paraffin (AR)

[0322] 2 Experimental methods

[0323] 2.1 Insect farming

[0324] After sterilizing, the peach borer egg masses were transferred to plastic buckets and incubated at a temperature of (26±1)℃ and a relative humidity of 75±7%. The larvae were fed with fresh corn. After emergence, the adults were collected in insect-raising buckets and fed with gauze soaked in 10% honey water at the bottom of the bucket. Thirty healthy and active female peach borer adults were selected for testing in each treatment group.

[0325] 2.2 Testing olfactory behavioral responses

[0326] Liquid paraffin (AR) was used as the solvent for all test samples. The standard was prepared into a 1 mg / mL mother solution and placed in a centrifuge tube for later use. All samples to be tested were prepared and used immediately before the test. The test was conducted from high concentration to low concentration. The test group was the drug to be tested, and the control group was liquid paraffin (AR).

[0327] The mated female adults of P. oleracea were tested for olfactory behavior using a Y-shaped olfactometer. The main arm of the Y-shaped olfactometer is 15 cm long, the two side arms are 15 cm long, the angle between the two side arms is 75°, and the inner diameter of the main and side tube arms is 2.0 cm. 10 μL of the test solution was evenly dropped on the qualitative filter paper (1.0 cm × 1.0 cm), and the qualitative filter paper with the same amount of liquid paraffin was used as a control. The filter paper was placed on the top of the side arm of the Y-shaped olfactometer. From left to right, the two side arms were connected in sequence to a gas humidification bottle filled with distilled water, a gas purification bottle filled with activated carbon, a flowmeter for controlling the airflow speed, and a positive pressure oil-free pump. Each device was connected with a silicone tube. The air flow direction was from the two side arm odor sources of the Y-shaped tube to the main arm, and finally to the outside world from the main arm port. The air flow of the two arms was controlled at 300 mL / min, and an incandescent lamp was used to illuminate 40 cm in front of the olfactometer. All tests were conducted in a dark room, at room temperature (27±1℃), clean and odor-free, relatively closed environment. The laboratory was ventilated for 1 hour before each test.

[0328] Healthy female peach borer adults who have completed mating are introduced from the main arm of the "Y"-shaped tube. Each insect is observed for 5 minutes. If it enters more than 1 / 3 of the side arm of the test group and stays for more than 30 seconds, it is recorded as choosing the test group. If it enters more than 1 / 3 of the side arm of the control group and stays for more than 30 seconds, it is recorded as choosing the control group. Otherwise, it is recorded as no choice behavior. A total of 30 adults were tested in each treatment group, 10 adults were tested each time, and repeated 3 times. Each adult was tested only once and could not be reused. After each test, the positions of the two arms were swapped to eliminate the possible effects of ambient light and the position of the tube arm on the behavior of the peach borer. In order to avoid the influence of objective factors on the olfactory selection behavior of the peach borer, after the test of each treatment group was completed, the inner arm of the olfactometer was scrubbed and wiped with clean water and anhydrous alcohol, and dried in a disinfection cabinet before the next test.

[0329] 3 Data processing

[0330] The calculation formula for the repellency value, attraction value and reaction rate of mated female adults of Peach Borer to the test sample is:

[0331] T is the total number of insects in the treatment arm (Treatment), and C is the total number of insects in the control arm (Control)

[0332] Repellency value (%) = (CT) / (C+T)×100%

[0333] Attraction value (%) = (TC) / (T+C) × 100%

[0334] Reaction rate (%) = (T + C) / total number of insects tested × 100%

[0335] 4 Experimental setup Figure 2-4

[0336] 5. Experimental results on behavioral selection of peach borer for compounds

[0337] Table 2 Behavioral selection experiment of Peach Borer on compounds

[0338]

[0339] Note: The compound concentration is 1 mg / mL; T is the total number of insects in the treatment arm (Treatment), and C is the total number of insects in the control arm (Control).

[0340] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Use of a compound of formula I, a stereoisomer thereof, or a pesticide-acceptable salt thereof in the preparation of a peach borer attractant or a pesticide composition for controlling peach borer, in: X 1 CR a R b , O or S; R a and R b Independently selected from the group consisting of H, D, C1-C4 alkyl or halogenated C1-C4 alkyl; n is 0, 1, 2 or 3; Each R 1 , R 2 and R 3 Independently selected from hydrogen, D, halogen, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, =C(substituted or unsubstituted C1-C6 alkyl)2, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C3-C6 cycloalkyl, phenyl, substituted or unsubstituted C1-C6 alkyl-OCO-; wherein the substitution refers to that one or more H on the group is independently substituted by a group selected from the following group: D, halogen, C1-C4 alkyl or halogenated C1-C4 alkyl; R 5 and R 6 Independently selected from hydrogen, D, substituted or unsubstituted C1-C6 alkyl, substituted or unsubstituted C2-C6 alkenyl, substituted or unsubstituted C2-C6 alkynyl, substituted or unsubstituted C3-C6 cycloalkyl, phenyl, substituted or unsubstituted C1-C6 alkyl-OCO-; wherein the substitution refers to that one or more H on the group is independently substituted by a group selected from the following group: D, halogen, C1-C4 alkyl or halogenated C1-C4 alkyl; Dashed lines represent chemical bonds or their absence; Provided that the compound is not 2. The use according to claim 1, characterized in that The compound comprises one or more technical features selected from the following group: R 1 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-; R 2 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-; R 3 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, =C(C1-C4 alkyl)2 and C1-C4 alkyl-OCO-; R 5 Selected from hydrogen, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, sec-butyl, tert-butyl), pentyl (e.g., n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl-substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl, and C1-C4 alkyl-OCO-; R 6 Selected from hydrogen, methyl, ethyl, propyl (such as n-propyl, isopropyl), butyl (such as n-butyl, sec-butyl, tert-butyl), pentyl (such as n-pentyl, sec-pentyl, tert-pentyl), phenyl, C1-C4 alkyl substituted cyclohexyl, halogen, C2-C4 alkenyl, C2-C4 alkynyl and C1-C4 alkyl-OCO-.

3. The use according to claim 1, characterized in that X 1 is CH2, CH(C1-C4 alkyl) or O, preferably X 1 It is CH2 or CHCH3.

4. The use according to claim 1, characterized in that Each R 1 , R 2 , R 3 , R 5 and R 6 In the above, only one or two are not H; preferably, the substituents at the ortho or para position of the C atom connected to X1 are not H, preferably R 1 and R 5 Not for H.

5. A compound, a stereoisomer thereof, or a pesticide acceptable salt thereof for preparing a peach borer attractant or a pesticide composition for controlling peach borer, wherein the compound is selected from the group consisting of:

6. The use according to claim 5, characterized in that The compound is selected from the group consisting of:

7. The use according to claim 5, characterized in that The compound is 8. A method for luring peach borer, comprising applying the compound described in any one of claims 1 to 7, its stereoisomer, or its pesticide acceptable salt or a pesticide composition comprising the same to crops or a planting environment, thereby luring peach borer.

9. A trapping device for peach borer, comprising at least one open container and an attractant placed therein, wherein the attractant is a compound of formula I as described in any one of claims 1 to 7, a stereoisomer thereof, or a pesticide acceptable salt thereof, or a pesticide composition comprising the same.

10. A method for controlling peach borer, comprising placing the trapping device of claim 9 near crops, thereby controlling peach borer.

Images