Application of lactyltransferase inhibitors in pancreatic cancer and its immunotherapy

The composition of lacticyl transferase inhibitor and anti-programmed death receptor-1 antibody is solved, and the effective treatment and survival time of pancreatic cancer is achieved by reducing H3K18la levels and activating CD8-positive T cells.

CN119679939BActive Publication Date: 2025-09-02南昌大学第一附属医院
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510200544.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-24
Publication Date
2025-09-02
Estimated Expiration
2045-02-24

AI Technical Summary

Technical Problem

The therapeutic effect of pancreatic cancer in the prior art is limited, especially in early, mid- and advanced patients. The treatment caused by chemotherapy resistance and immunosuppression microenvironment is difficult, and the effects of traditional surgery, chemotherapy and radiotherapy are limited, and the side effects are serious.

Method used

The composition of lactoyl transferase inhibitor and anti-programmed death receptor-1 antibody is used to inhibit the activity of histone lactoyl transferase, reduce the level of H3K18la in pancreatic cancer cells, reduce tumor neutrophil infiltration, increase CD8-positive T cell infiltration, and reverse the inhibitory immune microenvironment of pancreatic cancer.

Benefits of technology

Enhance the identification and removal of cancer cells by the immune system, effectively inhibit the growth of pancreatic cancer tumors, prolong the survival time of patients, improve survival rate and quality of life, and reduce the side effects of treatment. It is suitable for patients with early, middle and advanced pancreatic cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119679939B_ABST
    Figure CN119679939B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of cancer treatment, and provides the use of lactyltransferase inhibitors in pancreatic cancer and its immunotherapy. The present invention uses a histone lactyltransferase inhibitor in combination with an anti-programmed death receptor-1 antibody as a composition for pancreatic cancer and its immunotherapy, which can enhance the immune system's recognition and clearance of cancer cells, effectively inhibit the growth of pancreatic cancer tumors, and prolong the survival time of pancreatic cancer patients. Histone lactyltransferase inhibitors reduce the infiltration level of tumor-associated neutrophils, increase the infiltration level of CD8-positive T cells, reverse the composition of the inhibitory immune microenvironment of pancreatic cancer, and produce a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies. It is suitable for the early, middle and late treatment of pancreatic cancer, improves the survival rate and treatment effect of pancreatic cancer patients, and significantly reduces the side effects of treatment, thereby improving the quality of life of pancreatic cancer patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of cancer treatment, and in particular relates to the application of a lactyl transferase inhibitor in pancreatic cancer and its immunotherapy. Background Art

[0002] Pancreatic cancer is a malignant digestive tract tumor with a poor prognosis. It often presents with no obvious symptoms in its early stages, and by the time it is diagnosed, it is often already in the advanced stages, missing the opportunity for surgical resection. This results in poor treatment outcomes and rapid disease progression. Furthermore, existing treatment options for pancreatic cancer are limited, and the disease's high recurrence rate and chemotherapy resistance contribute to its high mortality rate.

[0003] Currently, the main treatments for pancreatic cancer include surgical resection, chemotherapy, and radiotherapy. Surgical resection can achieve certain therapeutic effects in patients with early-stage pancreatic cancer, but the overall effectiveness of surgical treatment is limited because most patients are unable to undergo surgery at the time of diagnosis. Chemotherapy and radiotherapy can prolong patient survival in some cases, but they are often accompanied by serious side effects and have limited efficacy in advanced patients. In addition, pancreatic cancer has an extremely strong immunosuppressive microenvironment, with a small number of tumor-infiltrating lymphocytes and low immune cell activity. Therefore, single traditional immunotherapy also has limited efficacy in treating pancreatic cancer. Summary of the Invention

[0004] In view of the deficiencies of the prior art, the present invention provides the use of a lactyltransferase inhibitor in pancreatic cancer and its immunotherapy, which aims to solve the problems mentioned in the background art.

[0005] In a first aspect, the present invention provides a composition of lactyltransferase inhibitors, which consists of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody. The histone lactyltransferase inhibitor is a small molecule compound or an RNA interference molecule that inhibits PCAF activity.

[0006] Furthermore, the small molecule compound is a bromodomain inhibitor.

[0007] Furthermore, the sequence of the RNA interference molecule is shown in SEQ ID NO.1-4.

[0008] In another aspect, the present invention provides use of a composition of lactyltransferase inhibitors in the preparation of drugs for pancreatic cancer and immunotherapy thereof.

[0009] Furthermore, the drug is used for the treatment of early, middle or late stage pancreatic cancer.

[0010] Furthermore, the drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

[0011] Furthermore, the drug includes one or more pharmaceutical carriers or pharmaceutical excipients of the composition.

[0012] Furthermore, the drug is administered by injection.

[0013] The present invention has the following technical effects:

[0014] (1) By combining a histone lactyltransferase inhibitor with an anti-programmed death receptor-1 antibody as a composition for pancreatic cancer and its immunotherapy, the immune system's recognition and clearance of cancer cells can be enhanced, the growth of pancreatic cancer tumors can be effectively inhibited, and the survival time of pancreatic cancer patients can be prolonged. Histone lactyltransferase inhibitors specifically reduce the level of H3K18la (lysine lactylation modification at position 18 of histone H3) in pancreatic cancer cells, reduce the infiltration level of tumor-associated neutrophils, increase the infiltration level of CD8-positive T cells, and reverse the composition of the inhibitory immune microenvironment of pancreatic cancer, thereby producing a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies. The composition of the lactyltransferase inhibitor is suitable for the treatment of early, mid-term, and late-stage pancreatic cancer, and is particularly suitable for patients who are resistant to existing therapies. It can also improve the survival rate and treatment effect of pancreatic cancer patients, while significantly reducing the side effects of treatment and improving the quality of life of pancreatic cancer patients.

[0015] (2) The lactoacyltransferase inhibitor is a small molecule compound or RNA interference molecule that inhibits the activity of PCAF (p300 / CBP-associated factor, a histone acetyltransferase) and has the function of inhibiting the activity of histone lactoacyltransferase. In particular, Bromosporine can significantly reduce the level of H3K18la in pancreatic cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] A more complete understanding of exemplary embodiments of the present invention may be obtained by referring to the following drawings:

[0017] Figure 1 In Example 1 of the present invention, the effects of blank solvent and various histone acetyltransferase inhibitors on the level of H3K18la (lysine 18 lactylation modification of histone H3) in the pancreatic cancer cell line BxPC3 were detected by Western blotting, and Histone H3 was used as the internal reference protein.

[0018] Figure 2 The binding of PCAF (p300 / CBP-associated factor, a histone acetyltransferase) to acetyl-CoA and lactyl-CoA was simulated by molecular docking using Autodock software (automatic molecular docking software) in Example 1 of the present invention, wherein Figure 2a in the equation represents the binding of PCAF to acetyl-CoA. Figure 2 b in the figure represents the binding of PCAF to lactyl-CoA.

[0019] Figure 3 In Example 1 of the present invention, the modification level of H3K181a and the expression of the internal reference protein Histone H3 in four pancreatic cancer cells treated with different concentrations of Bromosporine were detected by Western blotting.

[0020] Figure 4 In Example 1 of the present invention, the levels of H3K18la, Histone H3, PCAF and β-actin (β-actin) in two pancreatic cancer cells, control and shPCAF knockdown, were detected by Western blotting.

[0021] Figure 5 The ratio of neutrophils in subcutaneous transplanted tumors of euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0022] Figure 6 The ratio of CD8 positive T cells in subcutaneous transplanted tumors of euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0023] Figure 7 This is a curve showing the change in tumor volume of subcutaneous transplanted tumors in Example 2 of the present invention, under the conditions of blank solvent and Bromosporine treatment.

[0024] Figure 8 The figures show the morphology and size of subcutaneous transplanted tumors in euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0025] Figure 9 This is a statistical graph of the subcutaneous transplanted tumor mass in euthanized mice treated with blank solvent and Bromosporine in Example 2 of the present invention.

[0026] Figure 10 This is a curve showing the changes in the volume of subcutaneous transplanted tumors in mice in the control group, single-drug treatment group 1, single-drug treatment group 2, and combined treatment group in Example 3 of the present invention.

[0027] Figure 11 The figures are the morphology and size of subcutaneous transplanted tumors in euthanized mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group in Example 3 of the present invention.

[0028] Figure 12This is a statistical graph of the subcutaneous transplanted tumor mass of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0029] Figure 13 This is the weight change curve of pancreatic cancer-bearing mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0030] Figure 14 These are photos of the kidneys of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0031] Figure 15 This is a statistical chart of kidney weights of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention.

[0032] Figure 16 In Example 3 of the present invention, the expression levels and distribution of Ly6G and CD8 proteins in the subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2 and combination therapy group were detected by immunohistochemistry.

[0033] Figure 17 This is a statistical graph of the proportion of neutrophils and CD8-positive T cells in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group in Example 3 of the present invention, wherein Figure 17 a in the figure is the neutrophil ratio statistical chart, Figure 17 b is a statistical chart of the proportion of CD8 positive T cells.

[0034] Figure 18 These are representative photographs of mice bearing orthotopic pancreatic cancer transplanted tumors in the control group, single-drug treatment group 1, single-drug treatment group 2, and combination treatment group detected by fluorescence in situ imaging in Example 4 of the present invention.

[0035] Figure 19 This is a statistical graph of the total fluorescence flux of pancreatic cancer orthotopic xenograft mice detected by fluorescence in situ imaging in Example 4 of the present invention, using the control group, single-drug treatment group 1, single-drug treatment group 2, and combination treatment group.

[0036] Figure 20 These are the survival curves of mice with orthotopic transplanted pancreatic cancer in Example 4 of the present invention, including the control group, monotherapy group 1, monotherapy group 2, and combination therapy group. DETAILED DESCRIPTION

[0037] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs; the terms used herein are only for the purpose of describing specific embodiments rather than limiting the present invention.

[0039] In some embodiments, the present invention provides a composition of lactyltransferase inhibitors, which is composed of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody. The histone lactyltransferase inhibitor is one or more molecules that inhibit the activity of histone lactyltransferase. The molecules that inhibit the activity of histone lactyltransferase are small molecule compounds or RNA interference molecules that inhibit the activity of PCAF (p300 / CBP-associated factor, a histone acetyltransferase).

[0040] Specifically, the small molecule compound is a bromodomain inhibitor.

[0041] Specifically, the sequences of the RNA interference molecules are shown in SEQ ID NO. 1-4.

[0042] In some embodiments, the present invention provides use of a composition of lactyltransferase inhibitors in the preparation of a medicament for pancreatic cancer and immunotherapy thereof.

[0043] Specifically, the drug is used to treat pancreatic cancer in the early, middle or late stages.

[0044] Specifically, the drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

[0045] Specifically, the drug includes one or more pharmaceutically acceptable carriers or pharmaceutically acceptable excipients of the composition.

[0046] In particular, the drug is administered by injection.

[0047] It is understood that the combination of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody for pancreatic cancer and its immunotherapy can enhance the immune system's recognition and clearance of cancer cells, effectively inhibit pancreatic cancer tumor growth, and prolong the survival of pancreatic cancer patients. Histone lactyltransferase inhibitors specifically reduce the level of H3K18la (histone H3 lysine 18 lactylation modification) in pancreatic cancer cells. By reducing the infiltration of tumor neutrophils and increasing the infiltration of CD8-positive T cells, they reverse the composition of the suppressive immune microenvironment in pancreatic cancer, thereby producing a synergistic anti-tumor effect with the anti-programmed death receptor-1 antibody.

[0048] The lactyltransferase inhibitor composition is suitable for the early, middle and late stage treatment of pancreatic cancer, and is particularly suitable for patients who are resistant to existing therapies. It can also improve the survival rate and treatment effect of pancreatic cancer patients, while significantly reducing the side effects of treatment and improving the quality of life of pancreatic cancer patients.

[0049] The lactyltransferase inhibitor is a small molecule compound or RNA interference molecule that inhibits PCAF activity and has the function of inhibiting the activity of histone lactyltransferase. In particular, the bromodomain inhibitor can strongly reduce the level of H3K18la in pancreatic cancer cells.

[0050] Experimental Materials:

[0051] (1) Human pancreatic cancer cells BxPC3, PANC1, and MIA PaCa-2 and mouse pancreatic cancer cells KPC and PANC02 were obtained from ATCC (American Type Culture Collection).

[0052] (2) The experimental mice were 6-8 weeks old male C57BL / 6J mice.

[0053] (3) The shRNA sequences for knocking down PCAF (p300 / CBP-associated factor, a histone acetyltransferase) are:

[0054] Human 1#: GCAGACTTACAGCGAGTCTTT (SEQ ID NO. 1);

[0055] Human 2#: GCAGATACCAAACAAGTTTAT (SEQ ID NO. 2);

[0056] Mouse origin 1#: CTCTTGAGAAACGCACGCTTA (SEQ ID NO. 3);

[0057] Mouse source 2#: AGTGGTATCTAGACTATTAAT (SEQ ID NO. 4).

[0058] Example 1:

[0059] like Figure 1 As shown, the effects of blank solvent and various histone acetyltransferase inhibitors on the level of H3K18la (lysine 18 lactylation modification of histone H3) in the pancreatic cancer cell line BxPC3 were detected by Western blotting. Histone H3 was used as the internal reference protein. It can be seen that the level of H3K18la decreased most significantly after treatment with Bromosporine, a bromodomain inhibitor that inhibits PCAF activity.

[0060] As shown in Table 1, Table 1 shows the names of 8 acetyltransferase inhibitors and their targeted histone acetyltransferases:

[0061] Table 1 Names of acetyltransferase inhibitors and their targeted histone acetyltransferases

[0062]

[0063] like Figure 2 As shown, molecular docking simulation using Autodock software (automatic molecular docking software) found that the affinity between PCAF protein and acetyl-CoA and lactyl-CoA was comparable, and the binding sites were also very close. It can be seen that PCAF may be a lactoyl transferase for H3K18la.

[0064] like Figure 3 As shown, the modification levels of H3K18la in human pancreatic cancer cells BxPC3 and PANC1 and mouse pancreatic cancer cells KPC and PANC02 were detected by Western blotting after treatment with 0, 5, and 20 μM Bromosporine. It can be seen that as the concentration of Bromosporine increases, the level of H3K18la in each pancreatic cancer cell decreases.

[0065] like Figure 4 As shown, PCAF was knocked down by shRNA in human pancreatic cancer cells BxPC3 and PANC1, and the levels of H3K18la, Histone H3, PCAF and β-actin (β-actin) in the control and shPCAF knockdown pancreatic cancer cells were detected by Western blotting. It can be seen that the level of H3K18la in human pancreatic cancer cells BxPC3 and PANC1 was decreased by PCAF knockdown.

[0066] The level of H3K18la in pancreatic cancer cells directly reflects the degree of histone lactylation: high levels of H3K18la indicate a high degree of histone lactylation, while low levels indicate a low degree. In pancreatic cancer, histone lactylation is associated with the activation of oncogenes. Lactic acid, as an end product of glycolysis, accumulates in the tumor microenvironment, promoting epigenetic regulation of tumor cells. This suggests that inhibiting histone lactylation may prevent pancreatic cancer progression. In summary, inhibiting PCAF activity can reduce H3K18la levels in pancreatic cancer cell lines and could be used in the treatment of pancreatic cancer.

[0067] Example 2:

[0068] (1) The mouse subcutaneous tumor formation experiment was approved by the Experimental Animal Welfare and Ethics Committee of the First Affiliated Hospital of Nanchang University, with approval number CDYFY-IACUC-202407QR128. Mouse pancreatic cancer cells KPC and Matrigel (a basement membrane matrix extracted from mouse Engelbreth-Holm-Swarm (EHS) tumor cells) were mixed in a ratio of 2:1 to prepare a suspension; then 100 μL of the suspension (3×10 6 cells) were injected subcutaneously into the right abdomen of 6-8 week old male C57BL / 6J mice to induce pancreatic cancer in normal mice;

[0069] (2) When the subcutaneous transplanted tumor volume reached 100-200 mm³, pancreatic cancer mice received daily injections of Bromosporine for 10 consecutive days, and the subcutaneous transplanted tumor volume of the treated mice was measured every day; pancreatic cancer mice that completed the treatment were euthanized, and the subcutaneous transplanted tumors of the euthanized mice were removed. Finally, the subcutaneous transplanted tumors were weighed and photographed.

[0070] (3) Subcutaneous transplanted tumor tissue was minced and incubated in RPMI 1640 medium containing mouse tissue digestion enzymes at 37°C for 1 hour, and then filtered through a 70 μM cell mesh to prepare a single-cell suspension. To stain intracellular markers, the cell suspension was pre-incubated with a cell activation mixture at 37°C for 4 hours, and then incubated with fluorescently labeled antibodies in intracellular staining permeabilization wash buffer (Elabscience) at 4°C for 1 hour. Flow cytometric analysis was performed on a DxFLEX flow cytometer, and the data were analyzed using FlowJo software (flow cytometry data analysis software).

[0071] The fluorescently labeled antibodies used include: anti-CD45 antibody, FITC anti-CD3 antibody, anti-CD4 antibody, anti-CD8a antibody, anti-CD11b antibody, anti-Ly-6G antibody, anti-TIGIT antibody, anti-CD279 (PD-1) antibody, and anti-Granzyme B recombinant antibody.

[0072] Flow cytometry analysis results Figure 5 and Figure 6 As shown, Figure 5 The results show the infiltration level of neutrophils in subcutaneous transplanted tumors. Figure 6 The results show the infiltration level of CD8 positive T cells in subcutaneous transplanted tumors. It can be seen that after Bromosporine treatment, the infiltration level of tumor-associated neutrophils in subcutaneous transplanted tumors was significantly reduced, and the infiltration level of CD8 positive T cells was significantly increased; the treatment of subcutaneous transplanted tumors is shown in Figure 2. Figure 7-Figure 9 As shown, Figure 7 The figure shows the change curve of subcutaneous transplanted tumor volume. Figure 8 Shown are the morphology and size of subcutaneous transplanted tumors in euthanized mice. Figure 9 Shown are statistical graphs of subcutaneous tumor masses in euthanized mice.

[0073] It can be seen that Bromosporine inhibited the growth of subcutaneous transplanted tumors in mice.

[0074] Example 3:

[0075] (1) The pancreatic cancer-bearing mice of Example 2 were randomly divided into the following 4 groups:

[0076] Control group: treated with blank solvent (dimethyl sulfoxide) and isotype control antibody (IgG2a);

[0077] Monotherapy group 1: treated with Bromosporine (30 mg / kg) and isotype control antibody (IgG2a);

[0078] Monotherapy group 2: treated with blank solvent (dimethyl sulfoxide) and anti-PD-1 monoclonal antibody (200 μg / mouse);

[0079] Combined treatment group: treated with Bromosporine (30 mg / kg) and anti-PD-1 monoclonal antibody (200 μg / mouse).

[0080] (2) Thirteen days after subcutaneous injection, the control group, monotherapy group 1, monotherapy group 2, and combination therapy group received injection treatment, with blank solvent / Bromosporine injected on days 1, 4, 8, and 11 of treatment, and IgG2a / anti-programmed death receptor-1 monoclonal antibody injected on days 2, 3, 5, 9, 10, and 12 of treatment. From the start of treatment, the size of the subcutaneous transplanted tumor was measured using a vernier caliper, and its volume was calculated according to the formula: Volume = (shortest diameter of the tumor × longest diameter of the tumor) / 2. The differences in tumor growth curves between the groups were compared. The pancreatic cancer mice that completed the treatment were euthanized, and the subcutaneous transplanted tumors of the euthanized mice were removed. Finally, the subcutaneous transplanted tumors were weighed and photographed.

[0081] The treatment results of each group were as follows Figure 10-15 As shown, Figure 10 Shown are the curves showing the changes in the subcutaneous transplanted tumor volumes of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 11 Shown are the morphology and size of subcutaneous transplanted tumors in euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 12 Shown are the statistical graphs of subcutaneous transplanted tumor masses of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 13 Shown are the body weight change curves of pancreatic cancer-bearing mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 14 Shown are photographs of the kidneys of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 15 Shown are statistical graphs of kidney weights of euthanized mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0082] It can be seen that compared with monotherapy group 1 and monotherapy group 2, the combination treatment group significantly inhibited the growth of subcutaneous transplanted tumors, and the combination treatment group had no significant effect on the weight and kidneys of mice.

[0083] The results of immunohistochemical detection were Figure 16 and Figure 17 As shown, Figure 16 Shown are the expression levels and distribution of Ly6G and CD8 proteins in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group; Figure 17 Shown are statistical graphs of the proportions of neutrophils and CD8-positive T cells in subcutaneous transplanted tumors of mice in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0084] It can be seen that compared with monotherapy group 1 and monotherapy group 2, the combination treatment group can better activate CD8-positive T cells and inhibit neutrophils.

[0085] Example 4:

[0086] (1) A pancreatic cancer orthotopic transplant tumor model was constructed using fluorescently labeled mouse pancreatic cancer cell KPC cells, and fluorescent in situ imaging was performed. First, the fluorescently labeled mouse pancreatic cancer cell KPC cells were cultured to the logarithmic growth phase and collected to prepare a cell suspension containing fluorescently labeled mouse pancreatic cancer cell KPC cells. Then, the pancreas of immunodeficient 6-8 week old male C57BL / 6J mice was anesthetized, and the pancreas of immunodeficient 6-8 week old male C57BL / 6J mice was exposed. 50 μL of the cell suspension containing fluorescently labeled mouse pancreatic cancer cell KPC cells (2×10 6 The researchers injected 100 mg / kg of D-luciferin potassium salt into the pancreas of 6-8-week-old immunodeficient male C57BL / 6J mice. After injection, the injection site was gently pressed and the incision sutured to ensure recovery and the mice with orthotopic pancreatic cancer xenografts had no postoperative complications. One week after surgery, 150 mg / kg of D-luciferin potassium salt was injected intraperitoneally into the pancreatic cancer xenograft mice to activate the fluorescent signal of fluorescently labeled mouse pancreatic cancer cells (KPCs). After 10-15 minutes, the mice were imaged using an in vivo fluorescence imaging system to record the intensity and distribution of the fluorescent signal. The growth of the orthotopic xenografts in the mice was assessed, and the volume of the orthotopic xenografts was analyzed using the imaging system.

[0087] (2) Mice bearing orthotopic pancreatic cancer were randomly divided into the following four groups:

[0088] Control group: treated with blank solvent (dimethyl sulfoxide) and isotype control antibody (IgG2a);

[0089] Monotherapy group 1: treated with Bromosporine (30 mg / kg) and isotype control antibody (IgG2a);

[0090] Monotherapy group 2: treated with blank solvent (dimethyl sulfoxide) and anti-PD-1 monoclonal antibody (200 μg / mouse);

[0091] Combined treatment group: treated with Bromosporine (30 mg / kg) and anti-PD-1 monoclonal antibody (200 μg / mouse).

[0092] All treatments were administered by intraperitoneal injection, with blank solvent / Bromosporine injected on days 1, 4, 8, and 11 after treatment, and IgG2a / anti-programmed death receptor-1 monoclonal antibody injected on days 2, 3, 5, 9, 10, and 12 after treatment. Figures 18-20 As shown, Figure 18 Shown are representative photographs of mice bearing orthotopic pancreatic cancer xenografts in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group on day 7 of treatment; Figure 19 Shown are statistical graphs of total fluorescence flux in mice with orthotopic transplanted pancreatic cancer in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group on the seventh day of treatment; Figure 20 Shown are the survival curves of mice bearing orthotopic pancreatic cancer transplanted tumors in the control group, monotherapy group 1, monotherapy group 2, and combination therapy group.

[0093] It can be seen that the combination of Bromosporine and anti-programmed death receptor-1 monoclonal antibody significantly inhibited the growth of orthotopic transplanted tumors and increased the survival probability of mice.

[0094] In summary, histone lactyltransferase inhibitors specifically reduce H3K18la levels in pancreatic cancer cells. By reducing tumor neutrophil infiltration and increasing CD8+ T cell infiltration, they reverse the composition of the suppressive immune microenvironment in pancreatic cancer, thereby producing a synergistic anti-tumor effect with anti-programmed death receptor-1 antibodies. Histone lactyltransferase inhibitors combined with anti-programmed death receptor-1 antibodies for pancreatic cancer and its immunotherapy can significantly inhibit the malignant progression of pancreatic cancer, with significant efficacy and minimal toxic side effects. Furthermore, histone lactyltransferase activity can be inhibited by inhibiting PCAF activity. Methods for inhibiting PCAF activity include knocking down PCAF with shRNA sequences and using PCAF inhibitors. The shRNA sequences are shown in SEQ ID NOs. 1-4. The PCAF inhibitor can be bromosporine.

[0095] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Use of a composition of lactyltransferase inhibitors in the preparation of a medicament for pancreatic cancer and its immunotherapy, characterized in that: The composition consists of a histone lactyltransferase inhibitor and an anti-programmed death receptor-1 antibody. The histone lactyltransferase inhibitor specifically reduces the level of H3K18la in pancreatic cancer cells. The histone lactyltransferase inhibitor is bromosporin.

2. Use of the lactyltransferase inhibitor composition according to claim 1 in the preparation of a drug for pancreatic cancer and its immunotherapy, characterized in that: The medicine is used for treating pancreatic cancer in the early, middle or late stages.

3. Use of the lactyltransferase inhibitor composition according to claim 2 in the preparation of a drug for pancreatic cancer and its immunotherapy, characterized in that: The drug treats pancreatic cancer by reducing tumor neutrophil infiltration, increasing CD8-positive T cell infiltration, and reversing the suppressive immune microenvironment of pancreatic cancer.

4. The use according to claim 3, characterized in that: The medicine includes one or more pharmaceutically acceptable carriers or pharmaceutically acceptable excipients of the composition.

5. The use according to claim 4, characterized in that: The drug is administered by injection.

Citation Information

Patent Citations

  • Applications of composition of PD-1 antibody and metformin in preparation of anticancer drugs

    CN108310377A