Gene SbAIF1 for enhancing sorghum alkali tolerance and application thereof

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene SbAIF1 for enhancing sorghum alkali tolerance and application of the gene SbAIF1. According to the invention, the gene SbAIF1 is separated and cloned from sorghum, the CDS sequence of the SbAIF1 gene is connected with pCAMBIA2300-GFP-BWM, and the sorghum is transformed by using an agrobacterium-mediated method. Experimental results show that the SbAIF1 gene is over-expressed in sorghum, the alkali tolerance of the sorghum is enhanced after the gene is over-expressed, meanwhile, the survival rate of the sorghum under alkali stress can be increased after the gene is over-expressed, and a new thought is provided for cultivating saline-alkaline tolerant transgenic plants.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and particularly relates to a gene SbAIF1 for enhancing sorghum alkali tolerance and an application thereof. Background Art

[0002] Soil salinization is a phenomenon that occurs in arid, semi-arid and semi-humid areas, where soluble salts accumulate on the soil surface. It seriously affects plant growth and yield, and poses a major threat to global food security. Due to global climate change and unreasonable fertilization and irrigation methods, soil salinization is getting worse and worse, and the area of ​​land affected by salinization is increasing. Soil salinization has become an important factor restricting agricultural production. Studying the regulatory mechanism of plants under alkaline stress and breeding salt-alkali resistant plants are beneficial to agricultural production and yield increase, and help to manage, improve and utilize saline-alkali land.

[0003] Sorghum grows rapidly, has high yields, and can adapt to poor soil and various adverse environments. Therefore, studying its stress resistance-related genes and clarifying its molecular mechanisms are very important for the creation of new sorghum varieties and the development of agriculture. With the development of molecular biology technology, it has become a focus of current research to highly express stress resistance genes in target crops to improve the stress resistance of crops and improve the yield and quality of crops. However, researchers have relatively more research on sorghum salt tolerance, and less research on sorghum alkali resistance genes, and the progress of using molecular breeding to cultivate new sorghum varieties is slow. Saline-alkali land is mainly divided into two types: neutral salt and alkaline salt. The difficulty of "conquering" alkaline saline-alkali land (high pH soda saline-alkali land) is greater than that of "conquering" salt land with neutral pH. Therefore, seeking alkali resistance genes and cultivating salt-alkali resistant transgenic plants are of great significance to crop breeding and production applications.

[0004] Invention content seeks

[0005] In order to solve the above problems, the present invention provides a gene SbAIF1 for enhancing alkali tolerance of sorghum and its application. The present invention uses the CDS fragment of sorghum gene SORBI_3003G428800 (named as SbAIF1) as the application gene, and forwardly transfers the gene into sorghum, thereby increasing the expression level of the SbAIF1 gene, and obtaining a transgenic sorghum plant with an increased expression level of the sorghum SbAIF1 gene, which provides a new idea for cultivating salt-alkali resistant transgenic plants.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides use of at least one of the following (a1) to (a5) in enhancing plant alkaloid tolerance:

[0008] (a1), SbAIF1 protein;

[0009] (a2) proteins in which one or more amino acids are substituted, deleted or added in the amino acid sequence of the SbAIF1 protein and which have the same or similar functions as SbAIF1;

[0010] (a3), a nucleic acid molecule encoding the protein described in (a1) or (a2);

[0011] (a4) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule in (a3) ​​and which can encode a protein with the same or similar function;

[0012] (a5) a substance capable of regulating the level or activity of at least one of (a1) to (a4);

[0013] Wherein, the amino acid sequence of the SbAIF1 protein is shown as SEQ ID NO.1.

[0014] Furthermore, the plant is sorghum.

[0015] Furthermore, the sequence of the nucleic acid molecule encoding the protein shown in SEQ ID NO.1 is shown in SEQ ID NO.2; the nucleotide sequence of the SbAIF1 gene is shown in SEQ ID NO.3.

[0016] In a second aspect, the present invention provides an application of a recombinant vector in enhancing plant alkaloid tolerance, wherein the recombinant vector carries the CDS sequence of the sorghum gene SbAIF1 shown in SEQ ID NO.2; and the plant is sorghum.

[0017] Furthermore, the sorghum gene SbAIF1 positively regulates the ability of plant alkaloid tolerance, and the plant is sorghum.

[0018] In a third aspect, the present invention provides a preparation for enhancing plant alkaloid tolerance, comprising at least one of the following (b1) to (b6):

[0019] (b1), SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein;

[0020] (b2), an expression vector comprising a nucleic acid encoding the SbAIF1 protein;

[0021] (b3), a recombinant host containing (b2);

[0022] (b4), a promoter or enhancer that enhances the expression of the SbAIF1 gene;

[0023] (b5), inducers that promote SbAIF1 gene expression;

[0024] (b6) Preparations that enhance the activity of SbAIF1 protein.

[0025] In a fourth aspect, the present invention provides a method for enhancing plant alkaloid tolerance, using the above-mentioned preparation to increase the level and / or activity of endogenous SbAIF1 protein in plants, or to make plants that do not contain SbAIF1 gene or have inactivated SbAIF1 gene express SbAIF1 protein; the preparation includes SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein; the amino acid sequence of SbAIF1 protein is shown in SEQ ID NO.1; and the plant is sorghum.

[0026] In a fifth aspect, the present invention provides a breeding method for regulating plant alkali tolerance, wherein the breeding method comprises the following specific steps:

[0027] S1. Using primers to clone the CDS sequence of sorghum gene SbAIF1 to obtain the gene clone sequence;

[0028] S2, connect the gene clone sequence obtained in S1 with the pCAMBIA2300-GFP-BWM vector to obtain a recombinant vector;

[0029] S3, introducing the recombinant vector obtained in S2 into Agrobacterium by freeze-thaw method to obtain recombinant Agrobacterium;

[0030] S4, infecting plants with the recombinant Agrobacterium obtained in S3 to obtain transgenic plants;

[0031] The CDS sequence of the sorghum gene SbAIF1 in S1 is shown in SEQ ID NO.2; and the plant in S4 is sorghum.

[0032] The above method firstly amplifies the full-length CDS coding region of the sorghum SbAIF1 gene by PCR, then connects the CDS sequence of the SbAIF1 gene with pCAMBIA2300-GFP-BWM, transforms sorghum by Agrobacterium-mediated method, improves the expression of the SbAIF1 gene, and obtains sorghum transgenic plants with overexpression of the sorghum SbAIF1 gene.

[0033] Furthermore, the nucleotide sequence of the upstream primer in the primers in S1 is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.5.

[0034] SbAIF1-F: 5‵- TCAATTCGAGCTCGGTACACTAGT ATGGACCATCAGCTGTTCGA-3‵(SEQ IDNO.4);

[0035] SbAIF1-R: 5‵- GTTCTTCTCCTTTACTCATCGCCCCTGCTTTCTTCCTG-3‵(SEQ ID NO.5);

[0036] The underlined part is the homology arm, and the restriction site of pCAMBIA2300-GFP-BWM is SpeⅠ.

[0037] Furthermore, the Agrobacterium in S3 is AGL1.

[0038] Beneficial technical effects of one or more of the above technical solutions:

[0039] (1) The experiments of the present invention have shown that the present invention discovered the sorghum gene SbAIF1 in sorghum, and overexpressed the gene in sorghum. The alkaline stress tolerance of the transgenic sorghum was significantly enhanced.

[0040] (2) The present invention isolated and cloned the sorghum gene SbAIF1 for the first time, and overexpressed the SbAIF1 gene in sorghum for the first time, providing a new idea for breeding salt-alkali resistant transgenic plants, which has important production and life significance for crop breeding and production application. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0042] Figure 1 This is the result of DNA verification in the T0 generation positive seedling screening in Example 1, wherein the target band length is 729 bp;

[0043] Figure 2 This is a graph showing the gene expression levels of the sorghum gene SbAIF1 overexpressing plant in Example 1;

[0044] Figure 3 The phenotype diagram of the sorghum gene SbAIF1 overexpression strain and the wild type under alkaline stress in Example 2;

[0045] Figure 4 This is a comparison chart of sorghum survival rate under alkaline stress conditions in Example 2. DETAILED DESCRIPTION

[0046] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0047] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof. It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are intended to describe specific embodiments, rather than to limit the scope of protection of the present invention.

[0048] The present invention introduces the above expression vector into the sorghum variety Wheatland by Agrobacterium-mediated transformation. The above expression vector is introduced into plant cells by the efficient sorghum transformation system invented by this laboratory.

[0049] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0050] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0051] Description of experimental materials involved in the embodiments:

[0052] The pCAMBIA2300-GFP-BWM used in the sorghum overexpression vector was constructed by our laboratory based on the commercial vector pCAMBIA2300-UBI-GFP (purchased from Wuhan Transduction Biological Laboratory Co., Ltd., and its nucleotide sequence can be found on the website). The construction method is as follows:

[0053] 1. Insert pCAMBIA2300-UBI-GFP vector into SpeⅠ site

[0054] The pcambia2300-UBI-GFP vector was double-digested with KpnⅠ and Bsp1407I, and the linearized vector was purified and recovered and its concentration was determined;

[0055] Using pCAMBIA2300-UBI-GFP vector as template, the GFP fragment containing SpeⅠ site was amplified by primers GFP-F:TCAATTCGAGCTCGGTACACTAGTATGAGTAAAGGAGAAGAAC (SEQ ID NO.8), GFP-R:GGTCGACTCTAGAGGATCACGCGTCTATTTGTATAGTTCATC (SEQ ID NO.9), and the amplified GFP fragment was purified and recovered and the concentration was determined;

[0056] Homologous recombination was performed using the homologous recombinase of Novozyme Biotechnology Co., Ltd. to connect the linearized pCAMBIA2300-UBI-GFP vector and the GFP fragment containing the SpeⅠ site to obtain the pCAMBIA2300-UBI-GFP vector with the SpeⅠ restriction site inserted.

[0057] 2. Construction of pCAMBIA2300-GFP-BWM vector

[0058] The above vector was digested by HindIII restriction site, the linearized vector was purified and recovered, and the concentration was determined;

[0059] Using vector pG3GB411-BWM (the vector is disclosed in the article A Novel Ternary Vector System Unitedwith Morphogenic Genes Enhances CRISPR / Cas Delivery in Maize. and can be obtained from the Molecular Cloud platform) as a template, the BMW fragment was amplified by primers BWM-F: GTTCAATTTACTGATTGACCCGGGATAACTTCGTATAGCATACAT (SEQ ID NO.10), BWM-R: CGACGGCCAGTGCCAAGCTATAACTTCGTATAGCATA (SEQ ID NO.11), and the amplified BMW fragment was purified and recovered and the concentration was determined;

[0060] Homologous recombination was performed using the homologous recombinase of Novozyme Biotechnology Co., Ltd., and the linearized vector and the BMW fragment were connected to obtain the pCAMBIA2300-GFP-BWM vector.

[0061] The Escherichia coli and Agrobacterium tumefaciens AGL1 used in the examples were purchased from Qingdao LiGe Biotechnology Co., Ltd.

[0062] The main reagents used in the examples are:

[0063] Reverse transcription kit, gel recovery and purification kit, and plasmid extraction kit were purchased from Beijing Juhemei Biotechnology Co., Ltd.

[0064] Example 1

[0065] Construction of sorghum overexpression lines

[0066] The sorghum overexpression vector used pCAMBIA2300-GFP-BWM, the vector recombination method used homologous recombination, and the transformation method used Agrobacterium-mediated infection of sorghum immature embryos. In the sorghum overexpression experiment, in order to facilitate subsequent experimental screening, the sorghum seedlings grown from the infected wild-type Wheatland sorghum immature embryos are usually the T0 generation, and the seeds obtained from the T0 generation are the T1 generation. Genotype separation occurs in the T1 generation, and homozygous positive seedlings are selected in the T2 generation, and the expression levels of different genes are measured to obtain overexpression strains with different gene expression levels.

[0067] (I) Construction of recombinant vector

[0068] (1) Gene amplification and homologous recombination

[0069] The total RNA of wild-type Wheatland sorghum was extracted by TRIZOL method, and cDNA was obtained by reverse transcription kit. The obtained cDNA was used as a template to obtain the full-length CDS sequence of the gene by PCR amplification. The primer sequence used for gene amplification was:

[0070] SbAIF1-F: TCAATTCGAGCTCGGTACACTAGTATGGACCATCAGCTGTTCGA (SEQ ID NO.4);

[0071] SbAIF1-R: GTTCTCTCCTTTACTCATCGCCCCTGCTTTCTTCCTG (SEQ ID NO.5);

[0072] The homologous fragment of pCAMBIA2300-GFP-BWM was introduced by primer design at the start site (ATG) of the sorghum SbAIF1 gene and the primer at the 3' end.

[0073] The obtained amplified product was recovered by gel and the concentration was determined. The vector was digested with SpeⅠ restriction site and then recovered by gel. Homologous recombination was performed using homologous recombination enzyme of Novozyme Biotechnology Co., Ltd. to connect the target gene with the overexpression vector pCAMBIA2300-GFP-BWM. The connection system is as follows:

[0074] System components Volume (μL) Linearized vector 1 SbAIF1 gene amplified fragment 1 5×CE II Buffer 4 Exnase II 2 <![CDATA[ddH2O]]> Refill to 20

[0075] The reaction solution was placed in a PCR instrument at 37°C for 30 min, then cooled to 4°C or immediately placed on ice to obtain a recombinant vector for transformation of Escherichia coli.

[0076] (2) Preparation of competent E. coli

[0077] Escherichia coli (E. coli) DH5α was streaked on an LB medium plate using an inoculation loop and cultured at 37°C overnight;

[0078] Pick a fresh single colony and inoculate it into 5 mL LB liquid medium, and culture it at 37°C with shaking at 250 rpm overnight;

[0079] Dilute 100 times, inoculate into 50 mL LB liquid medium, and culture at 37°C, 250 rpm for 3-5 h until the bacteria grow into logarithmic phase;

[0080] Transfer the bacterial solution into a 50 mL centrifuge tube and place it on ice for 10 min;

[0081] 4°C, 4000 rpm, centrifuge for 10 min, discard the supernatant;

[0082] Resuspend the cells with 50 mL of 0.1 M CaCl2 (precooled at 24°C), centrifuge at 4000 rpm for 10 min at 4°C, and discard the supernatant;

[0083] Add 25 mL of 0.1 M CaCl2 (precooled at 24°C) to the precipitate, resuspend the precipitate, incubate at 4°C, 4000 rpm, for 10 min, and discard the supernatant;

[0084] Add 2.5 mL of 0.1 M CaCl2 (containing 15% glycerol) to each tube and resuspend the precipitate; dispense into 1.5 mL EP centrifuge tubes, 50 μL / tube; store in a -80°C refrigerator for later use.

[0085] (3) Transformation of recombinant vector

[0086] Thaw competent E. coli cells on ice;

[0087] Add the ligation product to the competent cells. Add about 10 μL of the recombinant vector to 50 μL of the competent cells and gently rotate to mix. Place on ice for 30 min.

[0088] Heat shock in a 42°C water bath for 90 seconds without shaking, and immediately return to ice to cool for 2 minutes;

[0089] Add 600 μL LB medium and culture at 37°C with shaking at 150 rpm for 60-90 min;

[0090] Centrifuge at 4000 rpm for 5 min at room temperature, aspirate part of the LB medium, and leave about 200 μL of volume;

[0091] Mix the remaining liquid and precipitate, and spread evenly on an LB medium plate containing 50 mg / mL Kan resistance; culture inverted at 37°C for 12 to 16 hours until colonies appear.

[0092] (4) Positive colony screening and sequencing

[0093] Pick a single colony into a 1.5 mL centrifuge tube containing 0.6 mL LB (Kan resistance) and culture at 37 °C with shaking at 220 rpm for about 6 h;

[0094] Use primers SbAIF1-F / R for PCR amplification. Take 1 μL of bacterial solution as template and set the annealing temperature to 50°C. The PCR product of positive clones should be around 700 bp; if the clone is a false positive (vector self-ligation), there will be no PCR product;

[0095] Pick 3 positive colonies and send them to the company for sequencing. The sequence of sequencing primer 2300-R is: ACAACGTGCACAACAGAAA. The strains with correct sequencing are selected for subsequent experiments.

[0096] (5) Plasmid extraction

[0097] Pick a single colony of E. coli containing the vector plasmid and culture it in LB liquid medium containing Kan resistance at 37°C with shaking at 200 rpm overnight;

[0098] Pour the bacterial solution into a 2 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, discard the supernatant, and collect the bacterial precipitate;

[0099] Remove the supernatant with a pipette, add 250 μL of Solution I (with RNase A) to the tube and shake thoroughly;

[0100] Add 250 μL of freshly prepared Solution II, cap the tube tightly, and gently invert 2 to 3 times to mix evenly. Do not shake violently.

[0101] Add 350 μL of Solution III, mix thoroughly, let stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 5 min;

[0102] Column balance: add 400 μL of balance solution BL to the adsorption column (the adsorption column is placed in the collection tube), centrifuge at 12000 rpm for 1 min, discard the filtrate in the collection tube, and put the adsorption column back into the collection tube;

[0103] Carefully transfer the supernatant to the centrifugal adsorption column, let it stand for 2 minutes, centrifuge at 12000 rpm for 1 minute, and discard the filtrate in the collection tube;

[0104] Add 600 μL Buffer WB2, centrifuge at 12000 rpm for 0.5 min at room temperature, discard the filtrate in the collection tube, and repeat the above steps once;

[0105] Centrifuge at 12000 rpm for 2 min and discard the waste liquid; dry the precipitate at room temperature for 2 min, dissolve the precipitate in 50 μL ddH2O and store at -20°C.

[0106] (6) Preparation of competent Agrobacterium

[0107] Agrobacterium AGL1 was streaked on LB plates containing 100 μg / mL Rif and cultured at 28°C for 36–48 h until colonies grew;

[0108] Pick a single colony and inoculate it into 5 mL of LB liquid medium containing 100 μg / mL Rif, and culture it at 28°C, 250 rpm, with shaking for 16-24 h;

[0109] Transfer 0.5 mL of bacterial solution to 50 mL of LB liquid medium containing 50 μg / mL Rif, and culture at 28°C, 250 rpm, with shaking until the logarithmic phase, OD600 = about 0.5, about 8 to 16 hours;

[0110] The bacterial solution was transferred to a 50 mL centrifuge tube, placed on ice for 30 min, and centrifuged at 5000 rpm for 10 min to precipitate the cells;

[0111] Add 10 mL of pre-cooled 0.15 M NaCl, gently suspend the cells, centrifuge at 5000 rpm for 5 min at 4°C, remove the supernatant, and repeat the above steps once;

[0112] Resuspend the cells with 1 mL of pre-cooled CaCl2 containing 15% glycerol, dispense into 1.5 mL centrifuge tubes, 50 μL / tube, snap-freeze in liquid nitrogen, and store at -80°C for later use.

[0113] (7) Agrobacterium transformation and positive colony screening

[0114] Take the competent cells AGL1 frozen at -80℃ and thaw on ice; add 2μL of the plasmid to be transformed into 50-100μL competent cells, mix gently, and place on ice for 30min;

[0115] Place the centrifuge tube in a 28°C metal bath for 5 min and in liquid nitrogen for 3 min;

[0116] Add 800 mL of LB medium, mix well, and culture at 28°C, 180 rpm for 3 h;

[0117] Centrifuge at 5000 rpm for 1 min at room temperature to pellet the cells;

[0118] Remove the excess culture medium and keep about 200 μL to spread on LB (containing 100 mg / L Rif, 50 mg / L Kan) plate; invert and culture at 28°C for 2-3 days until colonies appear;

[0119] The method for screening positive colonies was similar to the screening of positive Escherichia coli colonies, and the positive colony pCAMBIA2300-SbAIF1-GFP-BWM was obtained. The pCAMBIA2300-SbAIF1-GFP-BWM positive Agrobacterium obtained from the above experiment was stored in a -80°C ultra-low temperature refrigerator for future use.

[0120] (II) Agrobacterium-mediated transformation of sorghum

[0121] (1) Configuration of different culture media

[0122] Plant inoculation medium: 4.3 g / L MS salts, 68.5 g / L sucrose, 36 g / L glucose, 0.5 g / L 2-morpholineethanesulfonic acid (MES), 1.5 mL / L 2,4-D solution, 10 mL / L B5 vitamin mixed solution. Adjust pH to 5.2, filter sterilize, and add 1 mL / L acetosyringone stock solution before use.

[0123] Plant co-culture medium: 4.3g / L MS salts, 20g / L sucrose, 10g / L glucose, 0.7g / L L-proline, 0.5g / LMES, 2mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8g / L agar powder, 10mg / L ascorbic acid, 10g / L polyvinyl pyrrolidone (PVPP), and then sterilize at high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50℃ to 55℃, then add 10mL / L B5 vitamin mixture and 1mL / L acetosyringone solution.

[0124] Plant stationary medium: 4.3g / L MS salts, 30g / L sucrose, 1.0g / L L-proline, 0.5g / L MES, 1.5mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8g / L agar powder, 10g / L PVPP, and then sterilize by high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50℃ to 55℃. Add 100mL / L RC stock solution and 1.6mL / L thiophanate-methyl solution to the medium.

[0125] Plant callus induction medium: 4.3g / L MS salts, 30g / L sucrose, 1.0g / L L-proline, 0.5g / L MES, 1.5mL / L 2,4-D solution. Adjust the pH to 5.8, then add 8g / L agar powder, 10g / L PVPP, and then sterilize by high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50℃ to 55℃. Add 100mL / L RC stock solution, 1.2mL / L thiophanate-methyl solution, and 1mL / L Kan solution to the medium.

[0126] Plant germination medium: 4.3g / L MS salts, 30g / L sucrose, 0.5g / L MES. Adjust the pH to 5.8, then add 8g / L agar powder, 10g / L PVPP, and then sterilize by high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50℃ to 55℃. Add 10mL / L B5 vitamin mixture, 1mL / L 6-BAP solution, 1mL / L IAA solution, 1.2mL / L thiosporin, 1.6mL / L copper sulfate solution, and 1mL / L Kan solution to the medium.

[0127] Plant rooting medium: 4.3g / L MS salts, 30g / L sucrose, 0.5g / L MES, adjust the pH to 5.8, then add 8g / L agar powder, 10g / L PVPP, and then sterilize by high temperature and high pressure. After high temperature and high pressure sterilization, cool it to 50℃ to 55℃. Add 10mL / L B5 vitamin mixture, 1.2mL / L thiophanate-methyl solution, 1.6mL / L copper sulfate solution, 1mL / L IBA solution and 1mL / L Kan solution to the medium.

[0128] 1 / 2MS medium: 2.4g / L MS medium, 15g / L sucrose, 0.5g / L MES, adjust pH to 5.8. Add 8g / L agar powder to the solid medium and sterilize at high temperature and high pressure.

[0129] LB medium: 25g / L LB Broth, add 15g / L agar powder to the solid medium, and sterilize at high temperature and high pressure.

[0130] (2) Transformation of sorghum by tissue culture

[0131] Prepare Agrobacterium culture for transformation. Streak Agrobacterium strain AGL1 carrying pCAMBIA2300-SbAIF1-GFP-BWM plasmid on LB solid medium containing Kan and Rif and incubate at 28°C for 2 days to allow colonies to grow. Then select a single colony and transfer it to LB liquid medium containing Kan and Rif at 28°C, shaker at 200 rpm overnight. The next day, collect Agrobacterium cells and dilute to an optical density of OD600 nm = 0.4 in inoculation medium.

[0132] Separate the immature embryos. Collect the immature seeds on the sorghum ears 12-14 days after flowering and sterilize their surfaces. Treat the seeds with 50% (vol / vol) bleach solution (add 2-3 drops of Tween 20) for 30 minutes in a conical flask, and then rinse with sterile water 3-5 times. Carefully separate the immature embryos from the seeds in a clean bench. Select the immature embryos with a size of 1.0-1.5 mm and place them in the inoculation medium for further processing.

[0133] Transformation co-cultivation. Wash the immature embryos with fresh inoculation medium, ensuring that as little inoculation medium as possible covers the embryos. Heat shock the immature embryos in a 43°C water bath for 3 minutes, and then immediately transfer them to a 25°C metal bath for at least 2 minutes to cool them. Then, soak the washed immature embryos in the Agrobacterium suspension prepared in step (1) for 10 minutes. Transfer the treated immature embryos to the co-cultivation medium and incubate them in the dark at 25°C for 3 days.

[0134] Induction and selection of callus. After step (3), the treated immature embryos were transferred to a resting medium and placed in a dark environment at 28°C for 10 days. The embryos were then transferred to a callus induction medium and cultured for 10 days under the same conditions to further induce callus formation and select positive transformants.

[0135] Germination. Transfer the callus tissue that survived the previous step to the germination medium and keep it in an incubator at 28°C with 16 hours of light and 8 hours of darkness. Transfer the callus tissue to a new germination medium every 10 days until the seedlings are successfully regenerated.

[0136] Rooting. The regenerated seedlings were transferred to glass bottles containing rooting medium and grown for 2–3 weeks under the same light conditions as when they were germinated to allow root development. Once roots were formed, the seedlings were hardened for 3 days before being transferred to soil for further growth and pending verification of transgenic plants.

[0137] (III) Screening of homozygous sorghum overexpression lines

[0138] After the successfully transformed sorghum seeds mature and are harvested, T1 generation seeds can be obtained. The T1 generation seeds are placed in a 40°C oven to dry for 3 days, and then placed in the sun at room temperature for 10 days. The sorghum seeds are germinated after the after-ripening is completed, which can increase the seed germination rate.

[0139] Screening of positive seedlings in T1 generation

[0140] (1) Kan screening

[0141] Sterilize the mature T1 seeds by first placing them in 75% ethanol for 1 minute, then using 50% sodium hypochlorite for 30 minutes, and then washing them with ddH2O 4 to 5 times;

[0142] Prepare 1 / 2MS solid culture medium, sterilize it, and when the temperature is about 50-60℃, add Kan to make the final concentration 50mg / L, mix well and pour into the sterilized culture bottle, and blow dry in the clean bench for about 1h;

[0143] The sterilized sorghum seeds were placed under the surface of the culture medium, sealed, and placed in a 28°C incubator for 2 weeks with 16 h of light and 8 h of darkness;

[0144] After 2 weeks, the sorghum seedlings containing the transgene will grow well in Kan medium, with green leaves and normal growth; the leaves of the sorghum seedlings without the transgene will be white;

[0145] Well-growing transgenic sorghum seedlings were transferred to soft soil for growth.

[0146] (2) DNA verification

[0147] The 84 positive seedlings screened out were sampled for DNA extraction, and PCR amplification was performed using DNA as a template and primers 35S-F: ATCCTTCGCAAGACCTTC (SEQ ID NO.6) and NPTII-R: CCAACGCTATGTCCTGATA (SEQ ID NO.7) on the pCAMBIA2300-GFP-BWM vector to verify whether the positive seedlings screened out contained the transferred recombinant vector. DNA was extracted using the CTAB method, and the experimental method was as follows:

[0148] A few sorghum leaves were placed in a 2 mL centrifuge tube, loaded with 4 mm diameter steel balls, frozen in liquid nitrogen, and crushed into powder using a high-throughput tissue grinder;

[0149] Add 500 mL of CTAB extraction buffer (1.17 M NaCL, 0.0016 M EDTA-8.0, 0.835 M Ttis-7.5, 1.6% CTAB, 1% β-mercaptoethanol) preheated to 65°C and mix well;

[0150] React in a 65°C water bath for 45 min, carefully shaking the centrifuge tube every 15 min;

[0151] Remove the centrifuge tube, wait until it cools to room temperature, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), shake the tube carefully for 10 min, and let it stand for 10 min;

[0152] Centrifuge at 8000 rpm for 10 min at room temperature. Use a pipette tip with the tip cut off to transfer the supernatant to another 1.5 mL centrifuge tube. If the supernatant is still green, repeat the previous step.

[0153] Add 2 / 3 volume of isopropanol (-20°C), mix carefully by inverting several times, and incubate at 12000 rpm, 4°C, for 10 min;

[0154] Pour off the supernatant, add 400 μL 75% ethanol, wash twice, remove the remaining ethanol with a pipette tip, and dry at room temperature until the ethanol evaporates completely;

[0155] After the DNA is dried to a transparent state, add 20 μL ddH2O (PH 8.0) to dissolve the DNA;

[0156] 2 μL DNA was taken and added into Loading buffer. The DNA quality was tested by 1.0% agarose gel and the DNA concentration was tested by ultra-micro spectrophotometer. The DNA was stored in a -20°C refrigerator for later use.

[0157] The extracted DNA was used as a template, and PCR amplification was performed using primers 35S-F: ATCCTTCGCAAGACCTTC (SEQ ID NO.6) and NPTII-R: CCAACGCTATGTCCTGATA (SEQ ID NO.7) on the pCAMBIA2300-GFP-BWM vector. After agarose gel electrophoresis, the target band was obtained. The results are shown in FIG. Figure 1 As shown, the plants with the target bands are the plants containing the recombinant vector, and the plants without the recombinant vector are eliminated.

[0158] The plants containing the recombinant vector continue to grow until the seeds mature, and T0 generation seeds are collected.

[0159] Identification of homozygous strains with different expression levels

[0160] (1) Identification of homozygous strains

[0161] Screening for homozygous non-segregation

[0162] Positive seedling seeds were collected from sorghum with a T1 generation positive to false positive ratio of 3:1. The T2 generation seeds harvested from individual plants were dried for 10 days, disinfected, and germinated in a 1 / 2MS medium containing Kan. 100 seeds were selected for each positive individual plant. After germination, the positive rate on the antibiotic medium was counted (because the T1 generation seeds had already shown a 3:1 separation, only all germinated seeds in T2 were homozygous positive strains), and the T2 generation strains that were all green were used as candidate homozygous strains.

[0163] (2) Screening of homozygous strains with different expression levels

[0164] Sorghum leaves from 6 homozygous strains were selected, and 10 samples were selected from each strain. RNA was extracted from the leaves and reverse transcribed into cDNA. RT-PCR experiments were used to measure the gene expression levels of different strains, and homozygous strains with different expression levels were screened out. Two strains with higher expression levels were selected, namely OE1 and OE2.

[0165] Example 2

[0166] The overexpression strain obtained in Example 1 was germinated to a size of 2 weeks and 135 mmol / L alkaline solution (NaHCO3:Na2CO3=5:1) with a pH of 9.4-9.6 was added. After growing for 2 weeks, it was observed that the overexpression strain grew better than the wild type, and its survival rate was significantly higher than that of the wild type. Figure 3 , 4 .

[0167] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of at least one of the following (a1) to (a5) in enhancing plant alkaloid tolerance: (a1), SbAIF1 protein; (a2) proteins in which one or more amino acids are substituted, deleted or added in the amino acid sequence of the SbAIF1 protein and which have the same or similar functions as SbAIF1; (a3), a nucleic acid molecule encoding the protein described in (a1) or (a2); (a4) A nucleic acid molecule in which one or more nucleotides are substituted, deleted or added in the nucleotide sequence of the nucleic acid molecule in (a3) ​​and which can encode a protein with the same or similar function; (a5) a substance capable of regulating the level or activity of at least one of (a1) to (a4); in, The amino acid sequence of the SbAIF1 protein is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The plant is sorghum.

3. The use according to claim 1, characterized in that The sequence of the nucleic acid molecule encoding the protein shown in SEQ ID NO.1 is shown in SEQ ID NO.

2.

4. Use of a recombinant vector in enhancing plant alkaloid tolerance, characterized in that: The recombinant vector carries the CDS sequence of the sorghum gene SbAIF1 shown in SEQ ID NO.2; and the plant is sorghum.

5. The use according to claim 4, characterized in that The sorghum gene SbAIF1 positively regulates the ability of plant alkaloid tolerance, and the plant is sorghum.

6. A preparation for enhancing alkaloid tolerance, comprising at least one of the following (b1) to (b6): (b1), SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein; (b2), an expression vector comprising a nucleic acid encoding the SbAIF1 protein; (b3), a recombinant host containing (b2); (b4), a promoter or enhancer that enhances the expression of the SbAIF1 gene; (b5), inducers that promote SbAIF1 gene expression; (b6) Preparations that enhance the activity of SbAIF1 protein.

7. A method for enhancing alkaloid tolerance, characterized in that: The preparation according to claim 6 is used to increase the level and / or activity of endogenous SbAIF1 protein in plants, or to make plants that do not contain SbAIF1 gene or have inactivated SbAIF1 gene express SbAIF1 protein; the preparation comprises SbAIF1 protein or a nucleic acid molecule encoding SbAIF1 protein; the amino acid sequence of SbAIF1 protein is shown in SEQ ID NO: 1; and the plant is sorghum.

8. A breeding method for regulating plant alkali tolerance, characterized in that: The specific steps of the breeding method are as follows: S1. Using primers to clone the CDS sequence of sorghum gene SbAIF1 to obtain the gene clone sequence; S2, connect the gene clone sequence obtained in S1 with the pCAMBIA2300-GFP-BWM vector to obtain a recombinant vector; S3, introducing the recombinant vector obtained in S2 into Agrobacterium by freeze-thaw method to obtain recombinant Agrobacterium; S4, infecting plants with the recombinant Agrobacterium obtained in S3 to obtain transgenic plants; The CDS sequence of the sorghum gene SbAIF1 in S1 is shown in SEQ ID NO.2; and the plant in S4 is sorghum.

9. The breeding method according to claim 8, characterized in that The nucleotide sequence of the upstream primer in the primers in S1 is shown as SEQ ID NO.4, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

5.

10. The breeding method according to claim 8, characterized in that The Agrobacterium described in S3 is AGL1.

Images