Recombinant human-derived III-type collagen as well as preparation method and application thereof

Abstract

The invention provides a recombinant III-type collagen, nucleic acid, an expression vector, a bacterial strain and application of the recombinant III-type collagen. The recombinant collagen has the advantages of high expression quantity, low toxicity, low antigenicity, low immunity and the like, can guide cell regeneration, and is relatively good in biocompatibility. And when being applied in a human body, the antibody is low in generated immune response and has a wide application prospect. The preparation method is simple, green and environment-friendly, and is suitable for the industries of biological medicine, cosmetics, skin care products, food and the like.

Description

Technical Field

[0001] The present disclosure relates to the field of biotechnology, and in particular to a recombinant human type III collagen and a preparation method and application thereof. Background Art

[0002] Collagen, as a natural biological protein, accounts for 25% to 30% of the total protein in the human body. It is the main component of the extracellular matrix (ECM) and is essential for maintaining the physiological functions of cells, tissues and organs and repairing injuries. Collagen has a unique molecular structure, which makes it have strong biological activity, biocompatibility and biodegradability. With the in-depth research on collagen, its products are widely used in food health, cosmetics, biomedical materials and other fields.

[0003] Due to the progress of science and technology, it has been confirmed that collagen or collagen composite materials have the ability to promote wound regeneration and accelerate wound healing. However, most of the collagen currently used in the market is extracted from animal tissues by acid, alkali, and enzymatic hydrolysis, which is easy to lose its biological activity. In addition, collagen from animal tissues is also prone to cause immune and allergic reactions, which to a certain extent limits the application and development of new products. Therefore, it is urgent to use genetic recombination technology to develop efficient and safe recombinant human collagen. Compared with collagen extracted from traditional animal sources, recombinant human collagen has the advantages of single component, stable production process, no virus hidden dangers, good water solubility and low rejection reaction. It is of great significance to prepare high-quality recombinant collagen by means of genetic engineering technology.

[0004] With the development and application of recombinant DNA technology, recombinant collagen has been expressed in different systems, and expression systems including mammalian, insect, yeast and bacterial cells have been explored. Mammalian cells such as CHO and HEK293 have low protein expression and high cost. Microbial systems have become the best choice for large-scale, cost-effective production of recombinant human collagen. The large intestine and yeast expression systems are more cost-effective, but the Escherichia coli expression system also has some obvious defects, such as insufficient secretion capacity, which easily leads to the formation of insoluble inclusion bodies and difficult-to-eradicate endotoxins. The yeast expression system has many advantages, including no endotoxin, large-scale high-density fermentation capacity, simple operation and high cost-effectiveness. However, the recombinant collagen of the prior art still has the situation of insignificant efficacy and poor stability. It is difficult to select an amino-terminal sequence with an active site for expression in a Pichia pastoris secretion expression system to make it have more biologically active functions. Therefore, the development of a recombinant III collagen with high activity and high stability is of great significance in the field of bioremediation materials and cosmetics.

[0005] In summary, the existing technologies have the following problems: 1) limited by the traditional prokaryotic expression system, high endotoxin content and complex purification process; 2) poor activity; 3) poor stability. Summary of the invention

[0006] In one aspect, the present disclosure provides a recombinant type III collagen, characterized in that the recombinant type III collagen is selected from one or more of the amino acid sequences shown in SEQ ID NOs: 1-5.

[0007] In a specific embodiment, the recombinant type III collagen comprises one or more amino acid sequences of SEQ ID NO: 1, such as 1 to 14 repeats; and / or, one or more amino acid sequences of SEQ ID NO: 2, such as 1 to 14 repeats; and / or, one or more amino acid sequences of SEQ ID NO: 3, such as 1 to 14 repeats; and / or, one or more amino acid sequences of SEQ ID NO: 4, such as 1 to 14 repeats; and / or, one or more amino acid sequences of SEQ ID NO: 5, such as 1 to 14 repeats.

[0008] On the other hand, the present disclosure provides a nucleic acid, characterized in that the nucleic acid encodes the recombinant type III collagen mentioned above.

[0009] In a specific embodiment, the nucleic acid comprises one or more nucleic acid sequences selected from SEQ ID NOs: 6-10.

[0010] On the other hand, the present disclosure provides an expression vector, characterized in that the expression vector comprises the nucleic acid as described above.

[0011] In a specific embodiment, the N-terminus or C-terminus of the recombinant type III collagen as described above has a tag, and preferably, the tag is a His Tag tag.

[0012] In a specific embodiment, the expression vector is selected from any one of pPIC9K, pPICZɑA, GAPZɑA, pPICZɑB, pPICZɑC, GAPZɑB, GAPZɑC and their modified vectors.

[0013] In another aspect, the present disclosure provides a cell capable of expressing the recombinant type III collagen as described above or comprising the nucleic acid as described above.

[0014] The present disclosure also provides a strain expressing recombinant type III collagen, characterized in that the strain can express the recombinant type III collagen as described above or contains the nucleic acid as described above.

[0015] In a specific embodiment, the strain includes any one of Pichia pastoris, Saccharomyces cerevisiae and Escherichia coli.

[0016] In a specific embodiment, the Pichia pastoris is selected from one or more of SMD1168, KM71, KM71H, SMD1163, X33 and GS115.

[0017] In yet another aspect, the present disclosure provides use of the aforementioned recombinant type III collagen, nucleic acid, expression vector, cell, or strain expressing recombinant type III collagen in the preparation of a product that enhances the function of promoting type I collagen regeneration.

[0018] The present disclosure provides use of the aforementioned recombinant type III collagen, nucleic acid, expression vector, cell, or strain expressing recombinant type III collagen in the preparation of skin care products, cosmetics, health products, food and / or medicine.

[0019] Beneficial Effects The present disclosure provides a recombinant human type III collagen. The recombinant collagen provided by the present invention can be efficiently secreted and expressed in Pichia pastoris, and also has a stronger effect of promoting type I collagen regeneration, and has a wide range of applications in the field of firming and anti-wrinkle cosmetic raw materials and cosmetics. Optimize recombinant human type III collagen, improve its biological activity, and expand its application prospects in the field of medical beauty raw materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The present disclosure can be more fully understood with reference to the following drawings.

[0021] Figure 1 The vector map of SEQ ID NO: 1 (designated PJ121) is shown.

[0022] Figure 2 The vector map of SEQ ID NO: 2 (designated as PJ123) is shown.

[0023] Figure 3 The vector map of SEQ ID NO: 3 (designated PL1528) is shown.

[0024] Figure 4 The vector map of SEQ ID NO: 4 (designated PL1105) is shown.

[0025] Figure 5 The vector map of SEQ ID NO: 5 (designated PL2561) is shown.

[0026] Figure 6The SDS-PAGE electrophoresis diagram of the recombinant type III collagen expression fermentation broth prepared by the method of the present invention is shown, wherein lane M is a protein marker, and the size is referenced to Thermo Fisher (Cat. No.: 26616); lanes 1-5 are proteins PJ121, PJ123, PL1528, PL1105 and PL2561 after expression, respectively.

[0027] Figure 7 The SDS-PAGE electrophoresis diagram of the supernatant of the fermentation broth of the PL1105 strain is shown, wherein lane M: protein marker, and the other lanes are SDS-PAGE electrophoresis diagrams of the supernatant of the fermentation broth taken at different times of induction of the PL1105 strain.

[0028] Figure 8 The SDS-PAGE electrophoresis diagram of the supernatant of the fermentation broth of the PL2561 strain is shown, lane M: protein marker; lanes 1-4 are the supernatants of the fermentation broth of the PL2561 strain induced in the tank for 48 h, 72 h, 96 h and 120 h, respectively.

[0029] Fig. 9 The SDS-PAGE electrophoresis diagram of the supernatant of the fermentation broth of PJ121, PJ123 and PL1528 strains is shown, wherein lanes 1-3 are the supernatant of the fermentation broth of PJ121 strain induced in a tank for 48 h, 72 h and 96 h; lanes 4-6 are the supernatant of the fermentation broth of PJ123 strain induced in a tank for 48 h, 72 h and 96 h; lanes 7-9 are the supernatant of the fermentation broth of PL1528 strain induced in a tank for 48 h, 72 h and 96 h.

[0030] Fig.10 The results show the efficacy of the recombinant human type III collagen of the present invention in promoting the regeneration of type I collagen.

[0031] Fig.11 Figure a shows the SDS-PAGE run of the recombinant human type III collagen PJ123 provided by the present invention, which was treated at different temperatures of 4°C, 45°C, 55°C, 65°C, 75°C, 85°C and 100°C for 30 min; Figure b shows the SDS-PAGE run of the recombinant human type III collagen PL1105 provided by the present invention, which was treated at different temperatures of 4°C, 45°C, 55°C, 65°C, 75°C and 85°C for 30 min.

[0032] Fig.12Figure a shows the results of the recombinant human type III collagen PJ121, PJ123, PL1105 and PL2561 provided by the present invention being treated at 55°C for 30 min, and the protein promoting the regeneration of type I collagen is measured; Figure b shows the results of the recombinant human type III collagen PJ121, PJ123, PL1105 and PL2561 provided by the present invention being treated at 65°C for 30 min, and the protein promoting the regeneration of type I collagen is measured. The concentration of all experimental samples is 100 ng / mL.

[0033] Fig.13 Figure a shows the relative cell adhesion rate results of the recombinant human type III collagen PJ123 and PL1105 provided by the present invention; Figure b shows the relative cell migration rate results of the recombinant human type III collagen PJ123 and PL1105 provided by the present invention; Figure cg shows the results of the recombinant human type III collagen PJ123 and PL1105 provided by the present invention promoting the transcription levels of cell collagen IV (COL4), collagen XVII (COL17), Elastin (ELN), collagen III (COL3), and Fibronectin (FN); Fig.13 As shown in , P ≤ 0.05; , P ≤ 0.01; , P ≤ 0.001; , P≤0.0001, PC: TGFβ1; the concentration of all experimental samples was 100 ug / mL.

[0034] Fig.14 The circular dichroism spectra of the recombinant human type III collagen PJ123 and PL1105 of the present invention are shown.

[0035] Fig.15 The protein gel image formed according to the sequence characteristics of the recombinant human type III collagen PL2561 of the present invention is shown.

[0036] Fig.16 The triple helix structure of the recombinant human type III collagen PL1105 of the present invention photographed under a Bruker DimensionIcon atomic force microscope is shown.

[0037] Fig.17 The triple helix structure of the recombinant human type III collagen PL1105 of the present invention photographed under a ThermoscientificTalos F200C G2 transmission electron microscope is shown. DETAILED DESCRIPTION

[0038] The following description of the present disclosure is intended only to illustrate various different embodiments of the present disclosure. Therefore, the specific modifications discussed should not be interpreted as limiting the scope of the present disclosure. It is obvious to those skilled in the art that various different equivalents, changes and modifications can be made without departing from the scope of the present disclosure, and it should be understood that these equivalent embodiments will be included herein. All references cited herein, including publications, patents and patent applications, are incorporated herein by reference in their entirety.

[0039] In order to enable those skilled in the art to better understand the solutions of the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all of the embodiments.

[0040] Table 1. Culture media and solutions

[0041] Table 2. Sequence information

[0042] Table 3. Primer information

[0043] Table 4. Reagents

[0044] Example In order to enable those skilled in the art to better understand the solutions of the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of the present disclosure, rather than all of the embodiments.

[0045] Example 1: Plasmid construction (1) PJ121 plasmid construction The gene of SEQ ID NO:1 was assembled into the commercial pPICZaA vector between the ACAACTAATTATTCGAAACG and CATCATCATCATCATCATTG sequences by Gibson assembly.

[0046] (2) PJ123 plasmid construction The gene of SEQ ID NO:1 was assembled into the commercial pPICZaA vector between the ACAACTAATTATTCGAAACG and CATCATCATCATCATCATTG sequences by Gibson assembly.

[0047] (3) PL1528 plasmid construction The gene of SEQ ID NO:1 was assembled into the commercial pPICZaA vector between the ACAACTAATTATTCGAAACG and CATCATCATCATCATCATTG sequences by Gibson assembly.

[0048] (4) Construction of PL1105 plasmid The gene of SEQ ID NO:1 was assembled into the commercial pPICZaA vector between the ACAACTAATTATTCGAAACG and CATCATCATCATCATCATTG sequences by Gibson assembly.

[0049] (5) PL2561 plasmid construction The gene of SEQ ID NO:1 was assembled into the commercial pPICZaA vector between the ACAACTAATTATTCGAAACG and CATCATCATCATCATCATTG sequences by Gibson assembly.

[0050] Example 2: Expression (expressed in Pichia pastoris) and separation and purification of five recombinant human type III collagens The present invention provides 5 kinds of recombinant human type III collagen and preparation methods thereof, characterized in that part of the amino acid sequence is formed by repeated series connection of n basic units, wherein n is an integer of 1 or greater than 1. A DNA sequence encoding a 6×His Tag tag can be added to the end of each amino acid sequence to make it contain a purification tag, and can be purified by affinity chromatography, comprising the following steps: (1) The gene sequences of PJ121, PJ123, PL1528, PL1105 and PL2561 were constructed into the expression vector pPICZαA to construct a total of 5 recombinant expression vectors. The plasmid maps are shown in the figure. Figure 1-Figure 5 shown.

[0051] (2) The recombinant vectors of PJ121, PJ123, PL1528, PL1105 and PL2561 were linearized using PCR primers 5'-AOXI (TTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACT, SEQ ID NO: 11) and 3'-AOXI (CTTAGTTCATCTTGGATGAGATCACGCTTTTGTCATATTAGGTT, SEQ ID NO: 12), and the linearized products were recovered using a PCR product purification kit (Shanghai Biotechnology Co., Ltd., B518141-0100).

[0052] (3) Preparation of competent cells: The wild-type Pichia pastoris strain X33 stored at -80°C was streaked and activated, cultured in a 30°C constant temperature incubator for 3 days, a single colony was picked and cultured in YPD liquid for 10 h, and then transferred to 50 mL YPD overnight culture. When the OD 600 When the p-value reaches 1.0-1.2, collect the cells by centrifugation, discard the supernatant, add 7840 µL LDST treatment solution and 160 µl 0.5 M DTT to suspend the cells, and place at 30°C for 30 min; centrifuge at 1500 g at 4°C for 5 min, discard the supernatant, add 1.5 mL 1 M sorbitol (pre-cooled) to resuspend the cells, transfer to a 1.5 mL centrifuge tube, and wash the cells 3 times; finally, resuspend the cells with 1 mL of ice-bathed 1 M sorbitol, dispense 100 µL into each tube, and use immediately or freeze at -80°C.

[0053] (4) Obtain recombinant cells by transfection into Pichia pastoris X33: linearized plasmid (>5 µg, prepared as described in (3)); blow dry the electroporation cuvette (0.2 mm). Dry the ethanol-soaked electroporation cup under ultraviolet light, cover the lid, place it in a sealed bag and precool it in ice; add the linearized plasmid to the competent state, gently blow and aspirate it evenly with a gun, and place it on ice for 15 min; set the electroporation parameters of the electroporation instrument in advance (voltage 1.5 KV, resistance 200 Ω, capacitance 25 mF, electroporation time about 5 ms), quickly add the above system to the 0.2 cm precooled electroporation cup, and click the button for electroporation; after the electroporation is completed, quickly add 1 mL of precooled YPD culture medium to the electroporation cup, aspirate it with a 1 mL gun and transfer it to an EP tube, place it at 30℃ and culture it for 1.5-2 h, centrifuge it at 5000 rpm, spread it on a 0.8 mg / mL Zeocin-resistant YPD plate, and culture it in a constant temperature incubator at 30℃ for 2-3 days.

[0054] (5) Expression of recombinant strains: One transformant was selected from the yeast expression strain with 0.8 mg / m Zeocin obtained in the above step and inoculated into YPD liquid medium. The culture was carried out for 16 h. 50 mL of BSM2 medium containing trace elements was used at 30°C and 220 rpm at a 10% seed solution inoculation rate. Methanol was added every 24 h at a 1% weight-to-volume ratio. The induction was continued for 96 h, and the supernatant was collected by centrifugation.

[0055] Fermentation supernatant and protein analysis: 10 µL 5× Loading buffer (Biyuntian, P0015) was added to 30 µL of fermentation supernatant and mixed evenly. The mixture was treated at 100°C for 5-10 min on a metal bath to denature the protein. The mixture was centrifuged at 10,000 rpm / min for 5 min and the supernatant was taken for electrophoresis. After loading the SDS-PAGE gel, the electrophoresis buffer was poured and the gel was immediately run (constant voltage 80V for 30 min, followed by separation gel run at 120V for 45 min). After the end, the gel was stained and destained. The results are shown in the table. Figure 6 .

[0056] (6) Purification of recombinant collagen using nickel column: The fermentation broth was centrifuged to remove the bacteria and purified using nickel column. The pH of the fermentation broth supernatant was adjusted to about 7.0 under the most suitable adsorption conditions. After nickel column pretreatment, 5 mM imidazole was used to remove impurities and 500 mM imidazole was used to elute the target protein. The imidazole was removed using an ultrafiltration tube to obtain the target protein.

[0057] (7) Fermentation in a fermenter: transfer the colony to 50 mL YPD or YPG / 500 mL Erlenmeyer flask for 12 h; transfer 1 mL primary seed to 200 mL YPD / 1000 mL Erlenmeyer flask for 20 h; add 8% inoculum to a 5 L fermenter containing 2.2 L LSM2 fermentation medium. The fermentation temperature was set at 30°C, the pH was between 4.5 and 6.5, the DO was steadily decreasing, the DO rebounded after the basal sugar was consumed, and the wet weight of the bacteria was about 80-100 g / L; glycerol feeding: starting from 12 mL / L / h, 2 mL / L / h was added every hour to 18 mL / L / h. When the wet weight of the bacteria was 140-200 g / L, after this stage, the OD would rise rapidly, and the carbon source was starved for 0.5 h; the first stage of methanol feeding: the feeding rate was 1 mL / L / h, about 4 h; methanol enhancement stage: the feeding rate continued to be 1 mL / L / h per hour, and the speed was increased to 8 mL / L / h, for a total of about 4 h; then the high feeding rate of methanol was maintained, and the DO was steadily decreasing to about 10%; methanol reduction stage: the methanol feeding rate was gradually reduced to 3-4 mL / L / h; at the 24th, 48th, 72nd, 96th, 120th, and every 24th hour according to the experimental arrangement thereafter Take samples at about 1 h and the time of canning, record various parameters, and measure wet weight. Different strains have different growth conditions, and the sampling time will be different. The sampling results at different times are as follows Figure 7 , Figure 8 and Fig. 9 As shown, the loading volume of all samples was 10 µL, and the expression level of the fermentation product of the PL1105 strain after induction for 167 h was 15 g / L.

[0058] Example 3: Recombination of 5 types of recombinant human type III collagen to promote the regeneration of type I collagen secreted by human dermal fibroblasts Type I collagen is one of the main components of the extracellular matrix of dermal cells. Type I procollagen is synthesized intracellularly by dermal fibroblasts and secreted to the extracellular space. Under the action of terminal procollagen peptidase, the terminal peptide is separated and polymerized to form collagen fibers. Human dermal fibroblasts can be used as a cell model to study the effect of cosmetics on improving the content of type I collagen. By measuring the upregulation rate of type I collagen content after administration of the test substance, the blank control and the test substance, the efficacy of the test substance in promoting collagen synthesis can be evaluated. The content of type I collagen was determined by enzyme-linked immunosorbent assay (ELISA). The specific principle is that type I collagen specifically binds to the collagen antibody coated on the ELISA plate, and then binds to the anti-type I collagen antibody labeled with a substrate. After the substrate is catalyzed by the enzyme, a colored product is generated. The content of type I collagen is positively correlated with the color depth of the colored product. The optical density (OD value) was measured at a wavelength of 450 nm using an ELISA instrument to calculate the content of type I collagen.

[0059] The determination of the content of type I collagen secreted by human dermal fibroblasts provided by the present invention can be used as one of the evidences to support the claims of firming and anti-wrinkle effects of cosmetic raw materials and finished products. The operation includes the following steps: (1) Cell digestion and inoculation Human dermal fibroblasts were digested with trypsin / EDTA at a specific digestion concentration of 0.25%, 1 mL for T25 culture flasks, and 3 mL for T75 culture flasks. Observe under an inverted microscope until most cells become round and suspended, add about 2 to 3 times the volume of trypsin-containing DMEM medium to terminate digestion, collect into a centrifuge tube, and centrifuge at 800 rpm for 6 min. After centrifugation, discard the supernatant, add a certain volume of cell culture medium to the centrifuge tube, mix the cells with an elbow pipette, and count them with a cell counter or hemocytometer. Dilute the cells with cell culture medium to the inoculation density (the degree of fusion reaches 45% to 60% 24 hours after inoculation), and inoculate them into a 96-well plate with 200 µL of liquid per well. After inoculation, place in CO 2 Incubate in an incubator for about 24 h.

[0060] (2) Medication The experiment set up a blank control group (BC group), a positive control group and a sample experimental group. The experimental group was configured with a purified protein concentration of 100 ng / mL. The test wells were added with a culture medium containing the test substance, the positive control wells were added with a culture medium containing a positive control (100 ng / mL TGFβ1, reference Je YJ, Choi DK, Sohn KC, et al. Inhibitory role ofId1 on TGF-β-induced collagen expression in human dermal fibroblasts. BiochemBiophys Res Commun. 2014;444(1):81-85. doi:10.1016 / j.bbrc.2014.01.010), and the blank / solvent control wells were added with normal cell culture medium, 200 µL per well. After the administration, the 96-well plate was placed in a CO 2 Incubate in an incubator for about 24 h.

[0061] The cell culture medium DMEM should contain the following components (final concentration in DMEM): 10% FBS / NBCS; 1-4 mmol / L L-glutamine; 100 IU / mL penicillin; 100 μg / mL streptomycin.

[0062] (3) Collection of cell supernatant After the incubation, 200 μL of cell culture supernatant was collected from each well into a 1.5 mL centrifuge tube and stored in a -80 ℃ ultra-low temperature refrigerator.

[0063] (4) ELISA test The ELISA test should be carried out according to the instruction manual of the human type I collagen enzyme-linked immunosorbent assay kit (Huamei Mouse Nuclearfactor-kappa B, NF-κB ELISA Kit, catalog number: CSB-E12108m). The microplate is coated with purified antibodies to make a solid phase carrier. The standard, biotinylated anti-NF-κB antibody, and HRP-labeled avidin are added to the microwells coated with the anti-NF-κB antibody in sequence. After thorough washing, the substrate TMB is used for color development. TMB is converted into blue under the catalysis of peroxidase and into the final yellow under the action of acid. The depth of color is positively correlated with the NF-κB in the sample. The absorbance (OD value) is measured at a wavelength of 450nm using an enzyme reader to calculate the sample concentration. The results are as follows: Fig.10As shown, the vertical axis is COL1Concentration (ng / mL), that is, the concentration of Collagen I (ng / mL), including the BC group, TGFβ1 group, and PJ121, PJ123, PL1528, PL1105, and PL2561 experimental groups. Compared with the BC group, the TGFβ1 group can significantly increase the level of Collagen I (P<0.01). The positive control test is effective, and the experimental groups (PJ121, PJ123, PL1528, PL1105, and PL2561) can promote the significant increase of Collagen I content in human dermal fibroblasts (P<0.01), and the effect is better than that of the positive group, indicating that collagen has anti-wrinkle and firming effects.

[0064] like Fig.10 As shown, the present invention analyzed the experimental results, BC was the blank control, PC was the positive control TGFβ1, and the calculation analysis was performed through cell experimental tests. The test histones PJ121, PJ123, PL1528, PL1105, and PL2561 were compared with the positive control TGFβ1. The ability to promote the synthesis of type I collagen far exceeded that of the positive control group TGFβ1.

[0065] Example 4: Detection of the triple helical conformation of recombinant human type III collagen by circular dichroism (CD) The prepared in Example 2 was dissolved in 20 mM PB buffer (pH 7.4) (Solution A (0.2 M sodium dihydrogen phosphate aqueous solution): NaH 2 PO 4 ・H 2 O 27.6g, dissolved in distilled water, diluted to 1000 ml. Solution B (0.2 M sodium dihydrogen phosphate aqueous solution): Na 2 HPO 4 ・7H 2 53.6g of O was dissolved in distilled water, and the volume was adjusted to 1000 ml. 19 mL of solution A and 81 mL of solution B were taken respectively, and the volume was adjusted to 1000 mL. The recombinant human type III collagen in was diluted to 0.01 mg / ml and the volume was about 5 mL. The sample to be tested was added to a 10 mm×10 mm sample cell, and the scanning wavelength range was set to 190 nm-260 nm, the scanning speed was 100 nm / min, and the average of three scans was calculated. The results are shown in Fig.14 As shown, the recombinant human type III collagen PJ123 and PL1105 of the present invention have a maximum characteristic positive peak at 220 nm, and a negative peak appears at less than 210 nm. According to the known triple helix structure, there is a weak positive absorption peak at 210 nm-230 nm, and it is judged that the collagen sample has a triple helix structure.

[0066] Example 5: Evaluation of the cell adhesion promoting activity of recombinant human type III collagen Cell culture: HDF (fibroblasts) were cultured in DMEM complete medium (DMEM + 10% FBS + 1% P / S) at 37°C and 5% CO 2 Cultured in an incubator. Sample processing: The recombinant human type III collagen PJ123 and PL1105 obtained in Example 2 were diluted to 0.1 mg / ml in PBS (pH 7.4), and sterilized by filtering with a 0.2 μm sterile filter membrane. Coating: The diluted solution was added to an untreated cell culture plate, and an equal amount of PBS was added to the blank group. Three parallel samples were set up in each group and placed at 4 degrees overnight. Then the solution in the wells was aspirated and washed twice with PBS. Experimental treatment: The cells were inoculated into the coated wells, and after inoculation, the cell culture plates were placed in an incubator and cultured for 1 hour. Cell viability detection: The supernatant was discarded, and each well was carefully washed twice with PBS. Complete culture medium containing 10% cell viability detection reagent Alamar blue was added to each well. After continuing to incubate in the incubator for 4 hours, the absorbance value at 560 / 590 was detected using an enzyme-labeled instrument with a 560 / 590 nm (excitation / emission) filter. Data analysis: The relative blank control cell adhesion rate was calculated based on the absorbance value detected by the enzyme-labeled instrument. The results are as follows Fig.13 As shown in a, the results show that at a concentration of 100 μg / mL, the recombinant human type III collagen PJ123 and PL1105 of the present application have a high adhesion rate to HDF cells.

[0067] Example 6: Evaluation of the cell migration promoting activity of recombinant human type III collagen Cell culture: HDF (fibroblasts) were cultured in DMEM complete medium (DMEM + 10% FBS + 1% P / S) at 37°C and 5% CO 2 Culture in an incubator. Sample processing: The recombinant human type III collagen PJ123 and PL1105 samples obtained in Example 2 were diluted in PBS to prepare a working solution, and sterilized by filtering with a 0.2 μm sterile filter membrane. Coating: Add the corresponding working solution to the cell culture plate, at least 3 replicates for each sample, cover the surface with the solution, place at 4 degrees overnight, and then aspirate the remaining solution. Wash twice with PBS. Experimental treatment: Cells are inoculated into the coated cell culture plate, cultured until the cells cover the culture plate, and then scratched. After the scratch, wash the cells 3 times with PBS. Replace the cell culture medium without serum. Photography: Take pictures under a 4x microscope 0 h after scratching, wash once with PBS 16 h after scratching, and take pictures under a 4x microscope. Data analysis: Use imagej software to analyze and process the pictures, collect data, and calculate the migration rate. The migration rate = (initial scratch area-the area of ​​the blank area after cell migration / initial scratch area) 100%, the result is Fig.13 As shown in b.

[0068] Example 7: Evaluation of the repair and firming activity of recombinant human type III collagen Human skin fibroblasts were selected as the research object, and the changes in the gene contents of collagen III, collagen IV, collagen XVII, Elastin, and Fibronectin were used to evaluate whether recombinant human type III collagen has the effect of repairing and firming.

[0069] Culture medium: DMEM + 10% FBS + 1% pen / strep. Cell culture: HDF cells were cultured in DMEM complete culture medium at 37 degrees and 5% CO 2 Culture in an incubator. Inoculation: When the cell plating rate in the T75 culture flask is 80%-100%, the cells can be collected for experiments. Discard the old solution, add 5 ml PBS to wash twice, then add 2 ml 0.25% trypsin, digest at 37°C for 4 minutes, and stop digestion by observing that all cells have fallen off under the microscope. Add 4 ml DMEM complete medium to terminate. Inoculate cells into 96-well plates at a density of 8000 cells / well (volume per well 200 μL) and incubate in an incubator (37°C, 5% CO 2 ) and incubate overnight (usually 16-24 h).

[0070] Sample treatment: The sample solution (the sample is well soluble in water) is sterilized by filtering with a 0.2 μm filter membrane. If it is a powder sample, it is first dissolved in PBS and then filtered for sterilization. According to the predetermined detection concentration, each sample is diluted with DMEM complete medium to the required concentration to prepare the working solution (the content of DMEM complete medium in the working solution must be greater than 90%; the concentration in DMEM, that is, the final working concentration acting on the cells is generally 50 or 100 μg / ml, for example, add 180 μL of complete medium and add 20 μL of 1000 μg / mL sample to obtain the test data of the working concentration of 100 μg / mL). Sample addition (discard the original culture medium): When the cell plating rate is 60%-80% (confluence), group sample addition is performed, and the sample group, blank control group, and positive control group (TGF-b1 100 μg / ml) are set. There are 3 replicates in each group, 200 mL of sample is added, and the culture is continued for 24 hours. Detection: After 24 hours, the cells are collected. RNA was extracted using the kit (MIKX: MKG-865), cDNA was synthesized using the cDNA synthesis kit (MIKX: MKG840), and RT qPCR was performed using the fluorescent quantitative PCR kit (MIKX: MKG802) to detect the expression levels of collagen III, collagen IV, collagen XVII, Elastin, and Fibronectin genes in the cells. The relevant primers in Table 3 were used, COL3-1-F / R primers were used to detect collagen III, COL4-1-F / R primers were used to detect collagen IV, COL17-1-F / R primers were used to detect collagen XVII, Elastin was used to detect Elastin using Elastin-1-F / R primers, and Fibronectin was used to detect Fibronectin using Fibronectin-1-F / R primers. The calculated data were expressed as mean ± standard deviation, and the data were subjected to one-way analysis of variance. The P value was used to judge the statistical difference, and P ≤ 0.05 indicated statistical significance. After treating cells with different recombinant human type III collagens PJ123 and PL1105, the changes in mRNA expression of collagen III, collagen V, collagen XVII, Elastin, and Fibronectin in the cells were detected. The results are as follows Fig.13 c- Fig.13As shown in g, the ordinate is the mRNA expression of collagen III, collagen IV, collagen XVII, Elastin, and Fibronectin. The data analysis experimental differences are statistically significant. Compared with the BC group, the PC group is effective, and the protein PJ123 and PL1105 at a concentration of 100 μg / mL significantly improve the expression of collagen III, collagen IV, collagen XVII, Elastin, and Fibronectin genes in cells, indicating that the collagen has the effect of repairing and tightening.

[0071] Example 8: Thermal stability test of recombinant human type III collagen The recombinant human type III collagen PJ123 and PL1105 prepared in Example 2 and dissolved in 20 mM PB buffer (pH 7.4) with a final protein concentration of 5 mg / mL were placed in a metal bath at different temperatures for 30 min, and the treatment temperatures were 4°C, 45°C, 55°C, 65°C, 75°C, 85°C, and 100°C, respectively. The samples were taken and run on SDS-PAGE protein gel. The results are as follows Fig.11 As shown, the protein band is stable and not degraded, and the protein has good thermal stability.

[0072] Example 9: Test on the heat resistance of recombinant human type III collagen The recombinant human type III collagen PJ121, PJ123, PL1105 and PL2561 proteins prepared in Example 2 and dissolved in 20 mM PB buffer (pH 7.4) had a final concentration of 1 mg / mL and were placed in metal baths at different temperatures for 30 min, the treatment temperatures were 55°C and 65°C, respectively. The protein's efficacy in promoting type I collagen regeneration was determined according to the method of Example 3. The results are as follows: Fig.12 As shown, the protein still has high activity after being treated at 55℃ and 65℃, indicating that the protein has good heat stability.

[0073] Example 10: Gel formation and triple helix structure of recombinant human type III collagen Protein gel technology process: The purified collagen PJ121, PJ123, PL1105 and PL2561 were prepared into a 10 mg / mL concentration in a PBS buffer solution at pH 7.5 and allowed to stand at 4°C for 24 h to form a protein gel. Fig.15 As can be seen in the figure, collagen PL2561 sample forms a typical protein gel.

[0074] AFM data graph process: Electron microscope photo preparation process: The freeze-dried recombinant protein powders PJ121, PJ123, PL1105 and PL2561 were redissolved in 10 mM phosphate buffer to obtain a 1 mg / mL sample solution, and incubated at 4°C for 24 h. To prepare the AFM sample, 20 μL of the sample solution was dropped on the surface of a clean mica sheet, left at room temperature for 2 h, rinsed with sufficient pure water and naturally air-dried; AFM images were taken by a Bruker Dimension Icon atomic force microscope in ScanAsysy mode using a Scanasyst-air probe. Fig.16 As can be seen, the collagen PL1105 sample has a significant triple helical structure.

[0075] TEM data flow: Electron microscopy photo preparation process: The freeze-dried recombinant protein powders PJ121, PJ123, PL1105 and PL2561 were redissolved in 10 mM phosphate buffer to obtain a 1 mg / mL sample solution and incubated at 4°C for 24 h. To prepare TEM samples, 10 μL of sample solution was dropped on a clean copper grid, left to stand for 5 min, and the sample was carefully removed with a clean filter paper, then negatively stained with 2% uranyl acetate for 5 min, excess dye was removed with filter paper, and finally rinsed three times with pure water and air-dried naturally. TEM images were taken by a Thermoscientific Talos F200C G2 transmission electron microscope at an accelerating voltage of 200 kV. Fig.17 As can be seen, collagen PL1105 sample has a typical triple helix structure.

[0076] Incorporated by Reference Each patent and scientific article mentioned herein is incorporated by reference in its entirety for all purposes.

[0077] Equivalence The present disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be regarded as illustrative in all cases, rather than limiting the invention described herein. Therefore, the scope of the present disclosure is indicated by the appended claims rather than by the above description, and all changes within the equivalent meaning and scope of the claims are intended to be covered therein.

Claims

1. A recombinant type III collagen, characterized in that: The recombinant type III collagen comprises one or more amino acid sequences selected from SEQ ID NOs: 1-5.

2. The recombinant type III collagen as described in claim 1, comprising one or more amino acid sequences of SEQ ID NO: 1, such as 1 to 14 repetitions; and / or, one or more amino acid sequences of SEQ ID NO: 2, such as 1 to 14 repetitions; and / or, one or more amino acid sequences of SEQ ID NO: 3, such as 1 to 14 repetitions; and / or, one or more amino acid sequences of SEQ ID NO: 4, such as 1 to 14 repetitions; and / or, one or more amino acid sequences of SEQ ID NO: 5, such as 1 to 14 repetitions.

3. A nucleic acid, characterized in that The nucleic acid encodes the recombinant type III collagen as described in claim 1 or 2.

4. The nucleic acid according to claim 3, wherein the nucleic acid comprises one or more nucleic acid sequences selected from SEQ ID NOs: 6-10.

5. An expression vector, characterized in that: The expression vector comprises the nucleic acid according to claim 3 or 4.

6. The expression vector according to claim 5, characterized in that The N-terminus or C-terminus of the recombinant type III collagen according to claim 1 or 2 has a tag.

7. The expression vector according to claim 6, wherein the marker tag is a His Tag tag.

8. The expression vector according to any one of claims 5 to 7, characterized in that The expression vector is selected from any one of pPIC9K, pPICZɑA, GAPZɑA, pPICZɑB, pPICZɑC, GAPZɑB, GAPZɑC and their transformed vectors. 9 . A cell capable of expressing the recombinant type III collagen according to claim 1 or 2 or comprising the nucleic acid according to claim 3 or 4.

10. A strain expressing recombinant type III collagen, characterized in that: The strain is capable of expressing the recombinant type III collagen as described in claim 1 or 2 or contains the nucleic acid as described in claim 3 or 4.

11. The strain expressing recombinant type III collagen according to claim 10, characterized in that: The strain includes any one of Pichia pastoris, Saccharomyces cerevisiae and Escherichia coli.

12. The strain expressing recombinant type III collagen according to claim 11, characterized in that: The Pichia pastoris is selected from one or more of SMD1168, KM71, KM71H, SMD1163, X33 and GS115.

13. Use of the recombinant type III collagen as described in claim 1 or 2, the nucleic acid as described in claim 3 or 4, the expression vector as described in any one of claims 5 to 8, the cell as described in claim 9, or the strain expressing recombinant type III collagen as described in any one of claims 10 to 12 in the preparation of a product that improves the function of promoting type I collagen regeneration.

14. Use of the recombinant type III collagen according to claim 1 or 2, the nucleic acid according to claim 3 or 4, the expression vector according to any one of claims 5 to 8, the cell according to claim 9, or the strain expressing recombinant type III collagen according to any one of claims 10 to 12 in the preparation of skin care products, cosmetics, health products, foods and / or medicines.

Images