Egg yolk antibody for specifically recognizing cat allergens FEL D1 and FEL D4 and application of egg yolk antibody

Abstract

The invention belongs to the technical field of biology, and particularly relates to an egg yolk antibody for specifically recognizing cat allergens FEL D1 and FEL D4 and application of the egg yolk antibody. The invention provides an egg yolk antibody composition, and the egg yolk antibody composition comprises an egg yolk antibody capable of specifically recognizing and neutralizing a cat allergen FEL D1 and an egg yolk antibody capable of specifically recognizing and neutralizing a cat allergen FEL D4. The egg yolk antibody composition can more effectively reduce the occurrence of anaphylactic reaction, can be applied by adopting a liquid preparation, directly acts on allergens in the environment or on the surface of a cat body, and is more convenient to store and use.

Description

[0001] This application claims the priority of the Chinese patent application filed with the State Intellectual Property Office of China on October 30, 2023, with application number 202311435718.9 and invention name “Yolk antibodies specifically recognizing cat allergens FEL D1 and FEL D4 and their uses”, the entire contents of which are incorporated into this application by reference. Technical Field

[0002] The invention belongs to the field of biotechnology, and particularly relates to an egg yolk antibody capable of specifically recognizing cat allergens FEL D1 and FEL D4, and a composition, a preparation method and use thereof. Background Art

[0003] Contact with proteins from other species may cause an immune response in humans, which may induce rhinitis or even life-threatening asthmatic inflammatory diseases. Allergens from domestic cats in the environment are one of the most common and powerful causes of allergies worldwide. About 90% of cat allergy sufferers will have an immune response to the main cat allergen FEL D1 (domestic cat (Felinedomesticus) allergen 1). FEL D1 is produced in the sebaceous glands, saliva, tear glands and anal glands of cats. It is present in saliva, tears, skin and fur. It flows from cats to the environment through dander. At present, there are the following solutions to cat allergies: (1) remove all objects in the home that may contain allergens or be contaminated, such as pillows, blankets, carpets, etc., to avoid contact with allergens; (2) keep the environment clean and use air humidifiers and filters to relieve symptoms; (3) avoid contact with cats that produce allergens. However, the above methods are not only limited in effect, but also difficult for families with cats to achieve, which easily leads to abandonment. Another approach to addressing cat allergies that does not involve separating cats from their owners is to reduce FEL D1 in the feline species itself. One approach that can be taken is to actively immunize cats with the goal of inducing anti-FEL D1 antibodies in the animal, but feline FEL D1 vaccines are expensive, unstable, and regular injections are not good for animal welfare. In addition to FEL D1, FEL D4 is also a very important allergen from cats. FEL D4 is a lipid transport protein that is secreted by the salivary glands and is mainly found in saliva, can also be found in fur, and can also be scattered in large quantities in the environment. FEL D4 can cause IgE-mediated allergic reactions in 63% of people with cat allergies. There are currently no products on the market that specifically reduce allergic reactions to FEL D4.

[0004] The egg yolk antibody and the composition thereof provided by the present invention simultaneously target FEL D1 and FEL D4, neutralize allergens together, can more effectively reduce the occurrence of allergic reactions, and can be applied in the form of liquid preparations to directly act on allergens in the environment or on the surface of the cat's body, making storage and use more convenient. Summary of the invention

[0005] The present invention relates to an egg yolk antibody capable of specifically recognizing cat allergens FEL D1 and FEL D4, and a composition, a preparation method and use thereof.

[0006] In one aspect, the present invention provides an egg yolk antibody composition, wherein the egg yolk antibody composition comprises an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D1 and an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D4.

[0007] In another aspect, the present invention provides a method for preparing the aforementioned egg yolk antibody composition, comprising:

[0008] S1: preparing antigen proteins including FEL D1 and FEL D4;

[0009] S2: immunizing laying hens with the antigen protein containing FEL D1 and the antigen protein containing FEL D4 separately or together to obtain immune eggs from the immune chickens;

[0010] S3: purifying the immune chicken eggs to obtain egg yolk antibodies.

[0011] In another aspect, the present invention provides an immunogenic composition comprising an isolated cat allergen FEL D1 or an immunogenic fragment thereof and an isolated cat allergen FEL D4 or an immunogenic fragment thereof.

[0012] On the other hand, the present invention provides a liquid preparation, wherein the liquid preparation comprises the above-mentioned egg yolk antibody composition.

[0013] In another aspect, the present invention provides a food-grade powder, wherein the powder comprises the egg yolk antibody composition according to any one of claims 1 to 5.

[0014] In another aspect, the present invention provides use of the egg yolk antibody composition, liquid preparation or food-grade powder in preparing a product for preventing and / or alleviating human allergic symptoms to cats.

[0015] In another aspect, the present invention provides a nucleotide encoding the egg yolk antibody in the egg yolk antibody composition or the cat allergen or an immunogenic fragment thereof in the immunogenic composition.

[0016] On the other hand, the present invention provides an expression system, which is constructed by introducing expression vectors containing the FEL D1 gene fragments shown in the nucleotide sequences of SEQ ID NOs: 1, 3, 5, and 7 and / or the FEL D4 gene fragments shown in the nucleotide sequence of SEQ ID NO: 9 into host cells respectively.

[0017] The egg yolk antibody and its composition provided by the present invention are directed against FEL D1 and FEL D4 at the same time. The small molecular structure of FEL D1 and FEL D4 allows it to adhere to fabrics, carpets and upholstered furniture, making it difficult to be removed from the home, and can be spread from cat-raising households to places where cats do not live by adsorbing on clothes and other items. The present invention purifies the high-titer egg yolk antibodies against FEL D1 and FEL D4, and neutralizes allergens together, which can more effectively reduce the occurrence of allergic reactions, and can be applied in the form of liquid preparations or food-grade powders. The liquid preparations can be diluted or not diluted and can be directly sprayed on the surface of the cat's body to neutralize allergens, and after being licked by the cat, neutralize allergens in the mouth; or sprayed in the environment and on the surface of clothing to reduce the amount of allergens in the environment, or further used to prepare pet caressing gloves, wet wipes, mouthwash, pet washing products, etc., and food-grade powders can be added to pet food, such as complete cat food, pet staple food companion, cat snacks or pet nutritional supplements, etc., thereby reducing the possibility of allergic reactions, and storage and application are more convenient. The egg yolk antibody liquid preparation provided by the present invention can be stored at room temperature for 12 months. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the specification and, together with the description, serve to explain the principles of the specification.

[0019] Figure 1 The results of colony PCR of the FEL D1-V1 gene fragment and the FEL D4 gene fragment are shown.

[0020] Figure 2 The WB verification results of the cell supernatants are shown, where (a) is the supernatant produced by CHO-FEL D1 cells, and (b) is the supernatant produced by CHO-FEL D4 cells.

[0021] Figure 3 Shown is the effect of FEL D1 egg yolk antibody neutralizing cat hair samples.

[0022] Figure 4 Shown is the effect of FEL D1 egg yolk antibody neutralizing cat saliva samples.

[0023] Figure 5 Shown is the effect of FEL D4 egg yolk antibody neutralizing cat saliva samples.

[0024] Figure 6 The active Fel d 1 content in saliva and the decrease ratio are shown.

[0025] Figure 7 The active FeI d 1 content in hair and the reduction ratio are shown.

[0026] Figure 8 The active Fel d4 content in saliva and its decrease ratio are shown. DETAILED DESCRIPTION

[0027] I. Definitions

[0028] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present disclosure, the definitions and explanations of the relevant terms are provided below.

[0029] As used herein and unless otherwise specified, the term "about" or "approximately" means within plus or minus 10% of a given value or range. Where an integer is required, the term means within plus or minus 10% of a given value or range, rounded up or down to the nearest integer.

[0030] As used herein, the term "allergen" refers to an antigen or antigenic portion of a molecule that can induce an allergic reaction when in contact with an individual. Generally, whether an individual is allergic to an allergen can be determined by clinical trials, by estimating the subject's medical history, or by any other suitable method known in the art. As long as a small portion of individuals show an immune response when exposed to the molecule, the antigen can be called an allergen. There are many isolated allergens known in the art. For example, the cat allergen FEL D1 and the cat allergen FEL D4 involved in the present disclosure.

[0031] As used herein, the term "allergy" is synonymous with "allergic response" or "allergic reaction". Each of these terms refers to an immune response state against an allergen (or "exogenous antigen") that occurs in an animal that would not otherwise be harmful to the animal. "Symptoms" of an allergic response refer to any measure of an immune response, such as at the molecular level (including measures of activity or expression of proteins or transcripts or genes), the cellular level, the organ level, the system level, or the organism level. Such symptoms may include one or more such levels. "Reducing symptoms" includes reducing such symptoms before they occur so that there are no symptoms of an allergic response, thereby preventing an allergic response. Symptoms may include general phenomena such as inflammation, respiratory disease, swelling or discomfort, rhinitis, edema, and allergic skin diseases commonly associated with allergies, including but not limited to atopic dermatitis (e.g., eczema), urticaria (e.g., hives) and angioedema, as well as allergic contact dermatitis. More specific phenomena of "symptoms" of an allergic response include, for example, any measurable or observable changes at the cellular level, including but not limited to local or systemic changes in cell populations, eosinophilia, recruitment and / or activation of immune cells (including, for example, mast cells and / or basophils), changes in antigen presenting cells (including but not limited to dendritic cells carrying FcεRI), intracellular or molecular changes, including measurement or observation of one or more steps in the immune cascade, release of intracellular compounds (e.g., mediators) that mediate an allergic response, and changes in one or more cytokines (e.g., IL-3, IL-5, IL-9, IL-4 or IL-13) or their related compounds or antagonists.

[0032] As used herein, the term "protectant" refers to a pharmaceutical excipient that is used to protect unstable active ingredients (e.g., proteins, specifically, egg yolk antibodies in the present disclosure) from unstable conditions during the freeze-drying process and subsequent storage and reconstitution. Protective agents include, but are not limited to, the group consisting of sugars, polyols (such as sugar alcohols) and amino acids. Preferred protective agents can be selected from the group consisting of sugars such as sucrose, trehalose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, neuraminic acid; amino sugars such as glucosamine, galactosamine, N-methylglucosamine ("methylglucamine"); polyols such as mannitol and sorbitol; and amino acids such as arginine and glycine; or mixtures thereof.

[0033] As used herein, the term "liquid preparation" refers to a preparation in liquid form and includes preparations that are originally liquid as well as purified egg yolk antibodies, i.e., so-called reconstituted solutions. The liquid preparations of the present invention are stable during storage, and their stability does not rely on purification (or other state-changing methods).

[0034] As used herein, the term "spray" refers to a preparation in which a raw material drug (such as the composition or corresponding liquid preparation provided by the present invention) and a pharmaceutically acceptable excipient are filled in a special device, and when used, the contents are released in the form of mist or the like by means of a manual pump, high-pressure gas, ultrasonic vibration or any other suitable method. The term "pharmaceutically acceptable excipient" refers to an auxiliary material used in drug production, which imparts the necessary physical and chemical properties to the drug, is compatible with the active ingredients of the drug, and does not produce adverse reactions to the individual to whom it is applied. Common pharmaceutically acceptable excipients include (but are not limited to) diluents (or fillers), binders, disintegrants, lubricants, wetting agents, moisturizers, thickeners, glidants, antibacterial agents (or preservatives), antioxidants, pH adjusters (or acidity adjusters), osmotic pressure regulators, flavoring agents, olfactory agents, flavors (or aromatics), solvents, solubilizers, cosolvents, surfactants, etc.

[0035] As used herein, the term "food grade" refers to agents or substances that can be added to food or raw materials intended for animal consumption. These agents or substances can be added directly to food or raw materials, or used in food contact applications. Therefore, their use is safe for animal consumption and safe in food contact applications.

[0036] As used herein, "expression" refers to the process of producing a polypeptide by transcription and translation of a polynucleotide. The expression level of a polypeptide can be evaluated using any method known in the art, including, for example, methods for determining the amount of polypeptide produced from a host cell. Such methods may include, but are not limited to, quantifying polypeptides in cell lysates by ELISA, Coomassie blue staining after gel electrophoresis, Lowry protein assay, and Bradford protein assay.

[0037] As used herein, "host cell" is a cell that is used to receive, maintain, replicate and amplify a vector. Host cells can also be used to express polypeptides encoded by the vector. When the host cell divides, the nucleic acid contained in the vector replicates, thereby amplifying the nucleic acid. The host cell can be a eukaryotic cell or a prokaryotic cell. Suitable host cells include, but are not limited to, CHO cells, various COS cells, HeLa cells, HEK cells such as HEK 293 cells.

[0038] As used herein, "vector" is a replicable nucleic acid from which one or more heterologous proteins can be expressed when the vector is transformed into an appropriate host cell. Vectors include those into which nucleic acids encoding polypeptides or fragments thereof can be introduced, usually by restriction digestion and ligation. Vectors also include those containing nucleic acids encoding polypeptides. Vectors are used to introduce nucleic acids encoding polypeptides into host cells, for amplification of nucleic acids or for expression / display of polypeptides encoded by nucleic acids. Vectors are usually kept free, but can be designed to integrate genes or parts thereof into chromosomes of the genome. Artificial chromosome vectors are also contemplated, such as yeast artificial vectors and mammalian artificial chromosomes. The selection and use of such vehicles are well known to those skilled in the art.

[0039] As used herein, the terms "drug", "pharmacologically active agent", etc. are used interchangeably herein and generally refer to any substance that changes the physiology of an animal. Any chemical substance that can affect the physiological functions of an organ and the metabolic activities of a cell falls within the scope of a drug.

[0040] As used herein, "treating" an individual suffering from a disease or condition means that the symptoms of the individual are partially or completely relieved, or remain unchanged after treatment. Therefore, treatment includes prevention, treatment and / or cure. Prevention refers to preventing potential diseases and / or preventing symptoms from worsening or disease development. Treatment also includes any pharmaceutical use of any antibody or antigen-binding fragment thereof provided and any composition provided herein.

[0041] As used herein, the term "therapeutically effective amount" refers to the amount of the subject compound that will elicit the biological or medical response of a tissue, system or subject that is being sought by a researcher, veterinarian, medical doctor or other clinician. The term "therapeutically effective amount" includes an amount of the compound that, when administered, is sufficient to prevent the development of one or more of the signs or symptoms of the disorder or disease being treated, or to alleviate to some extent one or more of the signs or symptoms of the disorder or disease being treated. The therapeutically effective amount will vary depending on the compound, the disease and its severity, and the age, weight, etc., of the subject to be treated.

[0042] II. Detailed description of specific implementation scheme

[0043] In one aspect, the present disclosure provides an egg yolk antibody composition, wherein the egg yolk antibody composition comprises an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D1 and an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D4.

[0044] In some embodiments, the FEL D1 comprises at least one of the following amino acid sequences:

[0045] SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8.

[0046] In some embodiments, the FEL D4 comprises the amino acid sequence shown in SEQ ID NO:10.

[0047] In some embodiments, the egg yolk antibody composition produces a neutralization titer of at least 1:640,000 against FEL D1 and at least 1:1,280,000 against FEL D4; and / or produces a neutralization titer of at least 1:320,000 against FEL D1 and at least 1:80,000 against FEL D4 in cat hair.

[0048] On the other hand, the method for preparing the above-mentioned yolk antibody composition includes: S1: preparing an antigen protein containing FEL D1 and an antigen protein containing FEL D4; S2: immunizing laying hens with the antigen protein containing FEL D1 and the antigen protein containing FEL D4 separately or together to obtain immune eggs of immune chickens; S3: purifying the immune eggs to obtain yolk antibodies.

[0049] In some embodiments, the above S2 further comprises: a. mixing the antigen protein comprising FEL D1 and the antigen protein comprising FEL D4 with a primary immune adjuvant to obtain a mixture; b. injecting the mixture into laying hens for immunization.

[0050] In some preferred embodiments, the primary immunization adjuvant is Freund's complete adjuvant.

[0051] In some preferred embodiments, the above-mentioned FEL D1 antigen protein and / or FEL D4 antigen protein is mixed with Freund's complete adjuvant at a volume ratio of 1:1, and the concentration after mixing is 2 mg / mL.

[0052] In some embodiments, the preparation method further comprises: c. performing booster immunization every two weeks, wherein during the booster immunization, the antigen protein of FEL D1 or the antigen protein of FEL D4 is mixed with a booster immunization adjuvant at a volume ratio of 1:1.

[0053] In some preferred embodiments, the booster immunization in c above is performed twice.

[0054] In some preferred embodiments, the above-mentioned booster adjuvant is Freund's incomplete adjuvant.

[0055] In some embodiments, the antigen protein of FEL D1 and the antigen protein of FEL D4 are prepared by molecular cloning or genetic engineering recombinant expression methods.

[0056] In some preferred embodiments, the preparation method comprises inserting into the vector a FEL D1 gene fragment selected from the group consisting of the nucleotide sequences shown in SEQ ID NOs: 1, 3, 5, and 7 and a FEL D4 gene fragment shown in SEQ ID NO: 9.

[0057] In some preferred embodiments, the FELD1 gene fragment as shown in the nucleotide sequence SEQ ID NO: 1 is inserted into the vector.

[0058] In some preferred embodiments, the above preparation uses amplification primers selected from the nucleotide sequences shown in SEQ ID NOs: 11-20.

[0059] In another aspect, the present invention provides an immunogenic composition comprising an isolated cat allergen FEL D1 or an immunogenic fragment thereof and an isolated cat allergen FEL D4 or an immunogenic fragment thereof.

[0060] In some embodiments, the immunogenic composition is used to prepare the above-mentioned egg yolk antibody composition.

[0061] In some preferred embodiments, the isolated cat allergen FEL D1 or an immunogenic fragment thereof is as shown in the amino acid sequence of SEQ ID NO: 2, 4, 6, 8.

[0062] In some preferred embodiments, the isolated cat allergen FEL D4 or an immunogenic fragment thereof is as shown in the amino acid sequence SEQ ID NO:10.

[0063] In another aspect, the present invention provides a liquid preparation comprising the above-mentioned egg yolk antibody composition.

[0064] In some preferred embodiments, the liquid preparation is prepared as a spray, a mouthwash or a rinse.

[0065] In some preferred embodiments, the liquid preparation further comprises a protective agent.

[0066] In some preferred embodiments, the protective agent is selected from one or more of sorbitol and Tween 80.

[0067] In another aspect, the present invention provides a food-grade powder, wherein the food-grade powder comprises the egg yolk antibody composition according to any one of the above aspects.

[0068] In some preferred embodiments, the food-grade powder is used to prepare pet food and pet nutritional supplements, wherein the pet food includes complete cat food, companion pet food, cat snacks and other products.

[0069] In another aspect, the present invention provides use of the egg yolk antibody composition, liquid preparation or food-grade powder in preparing a product for preventing and / or alleviating human allergic symptoms to cats.

[0070] In some preferred embodiments, the above products include sprays, mouthwashes, pet caressing gloves and wipes, pet toiletries, pet food or pet nutritional supplements. Among them, pet food includes complete cat food, pet staple food companion, cat snacks and other products.

[0071] In some preferred embodiments, the use comprises administering an effective amount of the egg yolk antibody composition or liquid preparation to a cat in vitro, or administering the egg yolk antibody composition or food-grade powder in an effective amount as a part of pet food.

[0072] In some preferred embodiments, the above effective amount produces a neutralization titer of at least 1:640,000 against FEL D1 and at least 1:1,280,000 against FEL D4 in cat saliva; and / or a neutralization titer of at least 1:320,000 against FEL D1 and at least 1:80,000 against FEL D4 in cat hair.

[0073] In another aspect, the present invention provides a nucleic acid encoding the egg yolk antibody in the egg yolk antibody composition or the cat allergen or an immunogenic fragment thereof in the immunogenic composition.

[0074] In some preferred embodiments, the cat allergen or immunogenic fragment thereof in the above immunogenic composition is as shown in the nucleotide sequence SEQ ID NO: 1, 3, 5, 7, 9.

[0075] On the other hand, the present invention provides an expression system, which is constructed by introducing expression vectors containing the FEL D1 gene fragments shown in the nucleotide sequences of SEQ ID NOs: 1, 3, 5, and 7 and / or the FEL D4 gene fragments shown in the nucleotide sequence of SEQ ID NO: 9 into host cells respectively.

[0076] In some preferred embodiments, the host cell is a CHO cell.

[0077] In another aspect, the present invention provides a method for preventing and / or allergic symptoms of humans to cats, the method comprising:

[0078] The method comprises administering an effective amount of the above-mentioned egg yolk antibody composition or liquid preparation to the cat in vitro, or administering the egg yolk antibody composition or food-grade powder in an effective amount as a part of pet food.

[0079] In some preferred embodiments, the above effective amount produces a neutralization titer of at least 1:640,000 against FEL D1 and at least 1:1,280,000 against FEL D4 in cat saliva; and / or a neutralization titer of at least 1:320,000 against FEL D1 and at least 1:80,000 against FEL D4 in cat hair.

[0080] For purposes of clarity and concise description, features are described herein as part of the same or separate embodiments, however, it will be understood that the scope of the present disclosure may include embodiments having a combination of all or some of the described features.

[0081] Example 1: Construction and expression of FEL D1 and FEL D4 molecules

[0082] (1) Four FEL D1 gene fragments, such as FEL D1-V1 to FEL D1-V4 and FEL D4 gene fragments, were synthesized separately and ligated into a cloning vector.

[0083] FEL D1-V1 nucleotide sequence (SEQ ID NO: 1):

[0084] ATGAAGGGCGCCTGTGTGCTGGTGCTGCTGTGGGCCGCTCTGCTGCTGATCTCCGGCGGCAACTGCGTGAAGATGGCCGAGACCTGCCCCATCTTCTATGACGTGTTCTTCGCCGTGGCCAACGGCAACGAGCTGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCTACCGAGCCCGAGAGGACCGCCATGAAGAAGATCCAGGATTGTTATGTGGAGAATGGCCTGATCAGCCGGGTGCTGGACGGCCTGGTCATGACCACCATCAGCTCCAGCAAGGATTGCATGGGCGAGGCCGTGCAGAACACCGTGGAGGACCTGAAGCTGAACACCCTGGGCCGGGAGATCTGCCCTGCTGTGAAGCGGGATGTGGACCTGTTCCTGACCGGCACCCCCGATGAGTATGTGGAGCAGGTGGCCCAGTATAAGGCCCTGCCTGTGGTGCTGGAGAACGCTCGGATCTTGAAGAATTGCGTGGATGCCAAGATGACCGAGGAGGATAAGGAGAACGCCCTGTCCGTGCTGGACAAGATCTATACCAGCCCCCTGTGTCACCACCACCACCATCACTGA。

[0085] FEL D1-V1 amino acid sequence (SEQ ID NO:2):

[0086] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGREICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH。

[0087] FEL D1-V2 nucleotide sequence (SEQ ID NO:3):

[0088] ATGAAGGGCGCCTGTGTGCTGGTGCTGCTGTGGGCCGCTCTGCTGCTGATCAGCGGCGGCAATTGTGTGAAGATGGCTGAGACCTGTCCTATCTTTTATGATGTGTTTTTCGCCGTGGCCAACGGCAATGAGCTGCTGCTGGATCTGTCCCTGACCAAGGTGAATGCCACCGAGCCTGAGCGGACCGCCATGAAGAAGATCCAGGATTGCTATGTGGAGAACGGCCTGATCAGCAGGGTGCTGGATGGCCTGGTCATGACCACCATCAGCTCCTCCAAGGACTGCATGGGCGAGGCCGTGCAGAATACCGTGGAGGATCTGAAGCTGAACACCCTGGGCAGGGGCGGCGGCGGATCTGGAGGAGGAGGATCTGGCGGCGGCGGCTCTGAGATCTGTCCCGCTGTGAAGCGGGACGTGGACCTGTTCCTGACCGGCACCCCCGATGAGTATGTGGAGCAGGTGGCTCAGTATAAGGCCCTGCCCGTGGTGCTGGAGAATGCCCGGATCTTGAAGAACTGCGTGGATGCTAAGATGACCGAGGAGGATAAGGAGAACGCTCTGTCCGTGCTGGACAAGATCTACACCAGCCCTCTGTGTCACCACCACCACCATCACTGA。

[0089] FEL D1-V2 amino acid sequence (SEQ ID NO:4):

[0090] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRGGGGSGGGGSGGGGSEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH。

[0091] FEL D1-V3 nucleotide sequence (SEQ ID NO:5):

[0092] ATGAAGGGCGCCTGCGTGCTGGTGCTGCTGTGGGCTGCCCTGCTGCTGATCTCCGGCGGCAATTGCGTGAAGATGGCTGAGACCTGTCCTATCTTCTATGACGTGTTTTTCGCTGTGGCTAACGGCAACGAGCTGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCCACCGAGCCTGAGAGGACCGCTATGAAGAAGATCCAGGATTGTTACGTGGAGAACGGCCTGATCAGCCGGGTGCTGGATGGCCTGGTCATGACCACCATCAGCAGCAGCAAGGACTGTATGGGCGAGGCCGTGCAGAACACCGTGGAGGACCTGAAGCTGAACACCCTGGGCAGGGCTACCAATTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCTGGCCCTGAGATCTGCCCTGCTGTGAAGAGGGATGTGGATCTGTTTCTGACCGGCACCCCTGACGAGTATGTGGAGCAGGTGGCTCAGTATAAGGCTCTGCCCGTGGTGCTGGAGAACGCCAGGATCTTGAAGAATTGCGTGGACGCTAAGATGACCGAGGAGGACAAGGAGAACGCTCTGAGCGTGCTGGACAAGATCTACACCAGCCCTCTGTGTCACCACCACCACCATCACTGA。

[0093] FEL D1-V3 amino acid sequence (SEQ ID NO:6):

[0094] MKGACVLVLLWAALLLISGGNCVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRATNFSLLKQAGDVEENPGPEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCHHHHHH。

[0095] FEL D1-V4 nucleotide sequence (SEQ ID NO:7):

[0096] ATGAAGGGCGCTTGTGTGCTGGTGCTGCTGTGGGCCGCCCTGCTGCTGATCAGCGGCGGAAACTGCGAGATCTGTCCTGCCGTGAAGAGGGATGTGGATCTGTTTCTGACCGGCACCCCCGATGAGTACGTGGAGCAGGTGGCTCAGTACAAGGCTCTGCCTGTGGTGCTGGAGAACGCTCGGATCTTGAAGAATTGTGTGGATGCCAAGATGACCGAGGAGGACAAGGAGAACGCCCTGAGCGTGCTGGACAAGATCTATACCAGCCCTCTGTGTGGCGGCGGCGGCTCTGGAGGAGGAGGATCTGGCGGCGGCGGAAGCGTGAAGATGGCCGAGACCTGTCCTATCTTCTACGACGTGTTTTTCGCCGTGGCCAACGGCAATGAGCTGCTGCTGGACCTGAGCCTGACCAAGGTGAATGCCACCGAGCCTGAGAGGACCGCCATGAAGAAGATCCAGGATTGCTACGTGGAGAATGGCCTGATCAGCCGGGTGCTGGATGGCCTGGTCATGACCACCATCTCCAGCTCCAAGGACTGTATGGGCGAGGCTGTGCAGAATACCGTGGAGGATCTGAAGCTGAATACCCTGGGCCGGCACCACCACCACCATCACTGA。

[0097] FEL D1-V4 amino acid sequence (SEQ ID NO:8):

[0098] MKGACVLVLLWAALLLISGGNCEICPAVKRDVDLFLTGTPDEYVEQVAQYKALPVVLENARILKNCVDAKMTEEDKENALSVLDKIYTSPLCGGGGSGGGGSGGGGSVKMAETCPIFYDVFFAVANGNELLLDLSLTKVNATEPERTAMKKIQDCYVENGLISRVLDGLVMTTISSSKDCMGEAVQNTVEDLKLNTLGRHHHHHH。

[0099] FEL D4 nucleotide sequence (SEQ ID NO:9):

[0100] GGATCCGCCACCATGAAGTTGCTGCTCTTGTGTCTCGGCCTTATTCTGGTGTGTGCCCACGAAGAGGAGAACGTGGTACGAAGTAACATAGATATCTCCAAAATCTCTGGCGAGTGGTACTCCATTCTCCTGGCATCTGACGTAAAGGAAAAAATTGAAGAGAATGGATCAATGCGGGTGTTTGTGGAGCATATTAAGGCTCTCGATAATTCTAGCCTGAGCTTCGTGTTTCACACTAAGGAGAACGGAAAGTGCACCGAGATCTTCTTGGTAGCTGATAAGACCAAGGACGGCGTGTACACCGTCGTGTACGATGGTTACAACGTCTTCAGCATCGTGGAAACAGTCTACGATGAGTACATTCTGCTGCACTTGCTGAATTTCGACAAAACACGGCCTTTTCAGCTGGTGGAGTTTTACGCTAGAGAGCCAGACGTCTCCCAGAAACTGAAGGAAAAGTTTGTCAAATACTGCCAGGAACATGGGATCGTGAATATCTTGGACCTGACTGAAGTTGATCGTTGTCTCCAGGCTCGGGGTTCCGAAGTGGCTCAGGATAGTAGCGTGGAGCACCACCATCACCACCATTAGGTCGAC。

[0101] Amino acid sequence of FEL D4 (SEQ ID NO: 10):

[0102] MKLLLLCLGLILVCAHEEENVVRSNIDISKISGEWYSILLASDVKEKIEENGSMRVFVEHIKALDNSSLSFVFHTKENGKCTEIFLVADKTKDGVYTVVYDGYNVFSIVETVYDEYILLHLLNFDKTRPFQLVEFYAREPDVSQKLKEKFVKYCQEHGIVNILDLTEVDRCLQARGSEVAQDSSVEHHHHHH。

[0103] (2) Design and synthesize the primer pairs as shown in Table 1 below.

[0104] Table 1: Primer pair sequences

[0105] Primers sequence SEQ ID NO: FEL D1-V1-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCTTGT 11 FEL D1-V1-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGCC 12 FEL D1-V2-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCCT 13 FEL D1-V2-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGACACA 14 FEL D1-V3-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCCT 15 FEL D1-V3-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGACACA 16 FEL D1-V4-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGGGCGCTTGT 17 FEL D1-V4-R TGATTATGATCAATGAATTCTCAGTGATGGTGGTGGTGGTGCC 18 FEL D4-F CCGTCCTTGACACGAAGCTTGCCACCATGAAGTTGCTGCTCTTGTG 19 FEL D4-R TGATTATGATCAATGAATTCCTAATGGTGGTGATGGTGGTGCTCCAC 20

[0106] (3) The CHO cell expression plasmid was obtained by double digestion with Hind III / EcoR I, and the insert fragment was obtained by PCR and gel recovery from the synthetic cloning vector using primer pairs FEL D1-V1-F / R and FEL D4-F / R;

[0107] The PCR reaction system (50 μL) was: buffer 5 μL; dNTP 5 μL, MgSO4 3 μL, KOD 1 μL, H2O 32 μL, template 2 μL, upstream and downstream primers (10 μM) 1 μL each; PCR reaction conditions: 95°C pre-denaturation for 30 s, 95°C denaturation for 30 s, 64°C annealing for 30 s, 68°C extension for 1 min, 34 cycles.

[0108] (4) The digested plasmid and the inserted fragment were recombined and ligated using a seamless cloning kit (ABclonal, RM20523) and transformed into DH5α competent cells, spread on LB plates containing ampicillin resistance, and cultured at 37°C overnight.

[0109] (5) On the next day, single colonies were picked and identified by PCR. The FEL D1-V1 gene fragment and the FEL D4 gene fragment were subjected to colony PCR using primer pairs FEL D1-V1-F / R and FEL D4-F / R, respectively. The PCR system was as described in step (3). Positive strains were screened and sequenced for verification. Figure 1 ).

[0110] (6) The strains with correct sequencing were named DH5α-FEL D1 and DH5α-FEL D4.

[0111] (7) The verified strain was inoculated into LB liquid culture medium containing ampicillin resistance and cultured overnight at 37°C and 200 rpm. The next day, the plasmid was extracted using a plasmid extraction kit. The extracted plasmids were named plasmid FEL D1 and plasmid FEL D4.

[0112] (8) Plasmid FEL D1 and plasmid FEL D4 were stably transfected into CHO cells. After the viability rebounded after transfection, pressure screening was performed using CD04 + 50 μM Msx 30. During the culture process, the medium was changed every 3 days. After the cell viability decreased and rebounded to more than 80%, the seeds were preserved and production tests were performed.

[0113] (9) During the production test, the cells were replenished every two days to maintain normal cell growth. The production test was terminated when the cell viability dropped below 50%, and the cell supernatant was taken for WB verification ( Figure 2 ).

[0114] (10) After verification, the successfully transformed cells were named CHO-FEL D1 and CHO-FEL D4.

[0115] Example 2: Purification of FEL D1 and FEL D4 proteins

[0116] Obtain cat allergen FEL D1 / FEL D4 cell supernatant, and adjust the final NaCl concentration of cat allergen FEL D1 / FEL D4 cell supernatant to 0.5 M, pH 7.5. Further, the filler for purification was Polar MC60-Ni Excel, and the column was balanced. 5CV Buffer 1 (20mM PB, 500mM NaCl, pH 7.5) was used to balance the column until the conductivity and pH were balanced, and the sample was loaded at a linear flow rate of 150cm / h. The column was eluted with Buffer 1 at a linear flow rate of 150cm / h for a total of 20CV, and the column was balanced until the conductivity and pH were balanced; the column was eluted with 0-100% linear gradient Buffer 2 (20mM PB, 500mM NaCl, 500mM imidazole, pH7.5) at a linear flow rate of 150cm / h for a total of 20CV; the column was eluted with 100% linear gradient Buffer 2 at a linear flow rate of 150cm / h for a total of 5CV; the elution peak solution was collected, which was the purified cat allergen FEL D1 / FELD4 antigen, and the FEL D1 molecules used in subsequent examples were all FEL D1-V1 expression was obtained.

[0117] Example 3: Immunization of laying hens with FEL D1 and FEL D4

[0118] The purified FEL D1 and FEL D4 proteins were diluted to a concentration of 2 mg / mL; the FEL D1 and FEL D4 proteins were respectively compounded with Freund's complete adjuvant at a volume ratio of 1:1, and stirred and emulsified with a high-speed stirrer to finally prepare oil-in-water Freund's complete adjuvant antigens, with a concentration of 1 mg / mL. The FEL D1 and FEL D4 proteins were respectively compounded with Freund's incomplete adjuvant at a volume ratio of 1:1, and stirred and emulsified with a high-speed stirrer to finally prepare oil-in-water Freund's incomplete adjuvant antigens, with a concentration of 1 mg / mL.

[0119] Select hens and chicks that have not laid eggs and start raising them. Start immunizing them 35-55 days before laying eggs, half of which are used for FEL D1 immunization and the other half for FEL D4 immunization. Freund's complete adjuvant antigen is used for the first immunization, and the immunization dose is 1.0 mL per chicken. The immunization is performed by subcutaneous multiple injection and intramuscular injection. The first booster immunization is performed 14 days after the first immunization, and Freund's incomplete adjuvant antigen is used for the booster immunization, and the immunization dose is 1.0 mL per chicken. After an interval of 14 days, the second booster immunization is performed, and Freund's incomplete adjuvant antigen is used, and the immunization dose is 1.0 mL per chicken. A total of three immunizations are performed. After the hens lay eggs, the eggs are collected in time and the yolks are separated for freeze-drying or purification.

[0120] Example 4: Yolk antibody titer detection

[0121] Reagents: FEL D1 antigen (2.378 mg / mL), FEL D4 antigen (2.013 mg / mL), Goat anti-Chicken IgY (H+L) secondary antibody, HRP (Cat. No. 10A16054; Specification: 1 mg, thermofisher), blocking solution (PBS+3% BSA), PBST (0.1% Tween 20) washing solution, PBS buffer (pH 7.4), sample diluent (PBS+0.5% BSA), TMB colorimetric solution, 1MH2SO4 stop solution. Among them, 10×PBS: weigh 160 g of sodium chloride, add 58 g of disodium hydrogen phosphate dodecahydrate, 4 g of potassium dihydrogen phosphate, add 1.8 L of ultrapure water to dissolve, adjust pH to 7.3±0.1, dilute to 2 L with purified water, store at room temperature, valid for 3 months. Blocking solution: 3% BSA PBS buffer. PBST (0.1% Tween 20) washing solution: Measure 1000mL of 1×PBS solution, add 1mL Tween 20, mix well and prepare it. Prepare it before use. Sample diluent: 0.5% BSA in PBS buffer. Stop solution (1MH2SO4): Measure 850mL of purified water and add it to a glass. Slowly add 50mL of 98% concentrated sulfuric acid along the wall, stirring while adding to dissipate heat, and store at room temperature. Carbonate buffer (pH 9.6): Weigh 1.59g of sodium carbonate and 2.93g of sodium bicarbonate, add to about 800mL of ultrapure water, and stir to fully dissolve. Adjust the pH to 9.6±0.1, and make up to 1L with ultrapure water. It can be scaled up according to the required amount and fill in the reagent label on the bottle. Store at 2-8℃, valid for 3 months. TMB colorimetric solution: Use Thermo 1-StepTM Ultra TMB-ELISA.

[0122] Specific experimental steps:

[0123] (1) Coating: CHO-expressed FEL D1 and FEL D4 antigens were diluted to 1 μg / mL using carbonate buffer (pH 9.6), 100 μL / well was loaded, and the coating was carried out at 4°C overnight.

[0124] (2) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0125] (3) Blocking: 200 μL / well of blocking solution (PBS+3% BSA) was added to a 96-well plate and incubated at 25° C. and 100 rpm for 1.5 h.

[0126] (4) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0127] (5) Adding samples: First dilute the purified egg yolk antibody test sample and negative sample 10,000 times, then dilute them 2 times in a gradient to the remaining 7 points, load 100 μL / well, and incubate at 25°C, 100 rpm for 1.5 h. (Note: Use 0.5% BSA instead of sample as a blank control).

[0128] (6) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0129] (7) Adding secondary antibody: Dilute Goat anti-Chicken IgY (H+L) secondary antibody HRP (Cat. No.: A16054; Specification: 1 mg, Thermofisher) 4000-fold with sample diluent (PBS+0.5% BSA) and load 100 μL into each well. Incubate at 25°C, 100 rpm for 1.5 h.

[0130] (8) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0131] (9) TMB color development: Add 100 μL TMB color development solution to each well for color development and incubate at room temperature for 17 min.

[0132] (10) Stop solution: Add 100 μL of 1 M H2SO4 solution to each well to stop the reaction.

[0133] Calculation: Yolk antibody titer (p / n) = OD value of the sample to be tested / OD value of the negative sample at the corresponding dilution. The maximum dilution when p / n is greater than 2.1 is taken as the yolk antibody titer.

[0134] The titers of some yolk antibodies are shown in Table 2.

[0135] Table 2: Titers of some yolk antibodies

[0136] serial number 1 2 3 4 5 6 FELD1-IGY 1:640000 1:320000 1:640000 1:640000 1:1280000 1:640000 FELD4-IGY 1:1280000 1:640000 1:640000 1:1280000 1:640000 1:640000

[0137] Example 5: Purification of yolk antibodies

[0138] (1) Solution preparation

[0139] The reagents used for purification are shown in Table 3.

[0140] Table 3: Reagents used for purification

[0141] Serial number Reagent name Specification form 1 hydrochloric acid Analytical grade Liquid 2 Ammonium sulfate Analytical grade solid 3 Sodium hydroxide Analytical grade solid

[0142] (2) Preparation of saturated ammonium sulfate solution: Dissolve 767 g of saturated ammonium sulfate in 1 L of distilled water.

[0143] (3) Two-step ammonium sulfate precipitation

[0144] The egg yolk was collected and diluted with distilled water at a ratio of 1:9 at 4°C, homogenized for 1 minute, the pH of the yolk dilution was adjusted to 5.0 with 1 M HCL (overnight), centrifuged (11000 rpm, 4°C, 20 min), the supernatant was collected, and clarified by passing through a 0.22 μm membrane.

[0145] The clarified solution was added with saturated ammonium sulfate at a final concentration of 40% for salting out, and allowed to stand overnight at 4°C to allow the protein to fully precipitate, then centrifuged at 11,000 rpm for 20 min, and the supernatant was discarded. 10 mL of PBS was added to dissolve (Note: saturated ammonium sulfate should be adjusted with ammonium hydroxide to a pH of 7.0 before use).

[0146] Saturated ammonium sulfate with a final concentration of 40% was added to the solution for salting out, and the mixture was stirred at 4°C and then allowed to stand for 2 h to allow protein precipitation. The mixture was then centrifuged at 11,000 rpm for 20 min and the precipitate was resuspended in 10 mL of PBS.

[0147] The solution was transferred to a dialysis bag and dialyzed in PBS buffer overnight. The next day, the solution in the dialysis bag was taken out to obtain the egg yolk antibody purified solution.

[0148] Example 6: Preparation of liquid formulations

[0149] (1) Preparation formula

[0150] The liquid preparation formula is shown in Table 4.

[0151] Table 4: Liquid formulation formula

[0152]

[0153]

[0154] (2) Preparation of IgY liquid preparation

[0155] Collecting the egg yolk antibody purification solution;

[0156] Add sorbitol at a final concentration of 40 mg / mL and Tween 80 at 0.2 mg / mL to the purified solution and mix thoroughly;

[0157] The above-mentioned preparation stock solution was filtered and sterilized using a 0.22 μm filter to obtain the final liquid preparation stock solution.

[0158] (3) Liquid preparation stock solution potency determination

[0159] The titer determination results are shown in Table 5.

[0160] Table 5: Liquid preparation stock solution potency

[0161] serial number Potency FELD1-IGY liquid preparation 1:640000 FELD4-IGY liquid preparation 1:1280000

[0162] Example 7: Experiment on the neutralization effect of FEL D1 and FEL D4 egg yolk antibody liquid preparations

[0163] 1. Indirect sandwich ELISA to detect the neutralizing activity of egg yolk antibodies against FEL D1 in hair and saliva

[0164] Reagents: 6F9 anti FEL D1 (indoor, MA-6F9), biotin-3E4 anti FEL D1 (indoor, MA-3E4, biotinylated), Streptavidin (HRP) (Abcam, ab7403), blocking solution (PBS + 3% BSA), PBST (0.1% Tween 20) washing solution, PBS buffer (pH 7.4), sample diluent (PBS + 0.5% BSA), TMB color developing solution, 1M H2SO4 stopping solution.

[0165] Among them, 10×PBS: weigh 160g of sodium chloride, add 58g of disodium hydrogen phosphate dodecahydrate, 4g of potassium dihydrogen phosphate, add 1.8L of ultrapure water to dissolve, adjust the pH to 7.3±0.1, dilute to 2L with purified water, store at room temperature, and the validity period is 3 months. Blocking solution: 3% BSA in PBS buffer. PBST (0.1% Tween 20) washing solution: measure 1000mL of 1×PBS solution, add 1mL Tween 20, mix well, and prepare it before use. Sample diluent: 0.5% BSA in PBS buffer. Stop solution (1M H2SO4): measure 850mL of purified water and add it to a glass. Slowly add 50mL of 98% concentrated sulfuric acid along the wall, stirring while adding to dissipate heat, and store at room temperature. Carbonate buffer (pH 9.6): Weigh 1.59g sodium carbonate and 2.93g sodium bicarbonate, add to about 800mL ultrapure water, and stir to fully dissolve. Adjust pH to 9.6±0.1, dilute to 1L with ultrapure water, and prepare in proportion according to the required amount, and fill in the reagent label on the bottle. Store at 2-8℃, valid for 3 months. TMB colorimetric solution: Use Thermo 1-StepTMUltra TMB-ELISA.

[0166] Specific experimental steps:

[0167] (1) Coating: Dilute 6F9 anti FEL D1 1000-fold with carbonate buffer (pH 9.6) and add 100 μL per well for coating at 4°C overnight.

[0168] (2) Sample preparation: The purified egg yolk antibody liquid preparation FELD1-IGY was diluted 2-fold to prepare egg yolk antibodies with titers of 1:640000, 1:320000, 1:160000, 1:80000 and 1:40000, respectively; the treated hair samples were diluted 2-fold to prepare FEL D1 hair samples with final concentrations of 1.15 μg / mL, 0.575 μg / mL, 0.288 μg / mL, 0.144 μg / mL, 0.072 μg / mL and 0.036 μg / mL, respectively; the treated saliva samples were diluted 2-fold to prepare FELD1 saliva samples with final concentrations of 4.5 μg / mL, 2.25 μg / mL, 1.125 μg / mL, 0.56 μg / mL, 0.28 μg / mL and 0.14 μg / mL, respectively;

[0169] The treated hair or saliva samples were mixed with equal volumes of egg yolk antibody liquid preparations of different titers and BSA control (60 μL+60 μL), and incubated at 4°C overnight.

[0170] (3) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0171] (4) Blocking: 200 μL / well of blocking solution (PBS+3% BSA) was added to a 96-well plate and incubated at 25° C. and 100 rpm for 1.5 h.

[0172] (5) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0173] (6) Adding samples: Load 100 μL / well of the sample incubated overnight and incubate at 25°C, 100 rpm for 1.5 h.

[0174] (7) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0175] (8) Adding Biotin 3E4 anti FEL D1: Dilute Biotin 3E4 anti FEL D1 10,000 times with sample diluent (PBS + 0.5% BSA), load 100 μL into each well, and incubate at 25° C., 100 rpm for 1.5 h.

[0176] (9) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0177] (10) Adding Streptavidin (HRP): Dilute Streptavidin (HRP) 10,000 times with sample diluent (PBS + 0.5% BSA), then load 100 μL into each well and incubate at 25° C., 100 rpm for 1.5 h.

[0178] (11) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0179] (12) TMB color development: Add 100 μL of TMB color development solution to each well for color development and incubate at room temperature for 10 min.

[0180] (13) Stop solution: Add 100 μL of 1 M H2SO4 solution to each well to stop the reaction.

[0181] FEL D1 content range: hair (0.215-1.735μg / mL) and saliva (0.83-6.86μg / mL). Figure 3 As shown, the titer is higher than 1:320000, and the egg yolk antibody has a good neutralizing effect on FEL D1 in hair; Figure 4 As shown, the titer is higher than 1:640000, and the egg yolk antibody has a good neutralizing effect on FEL D1 in saliva.

[0182] 2. The kit detects the neutralizing activity of egg yolk antibodies against FEL D4 in hair and saliva

[0183] (1) Sample preparation: The purified egg yolk antibody liquid preparation FELD4-IGY was diluted 2-fold to prepare egg yolk antibodies with titers of 1:1280000, 1:640000, 1:320000, 1:160000 and 1:80000, respectively; the treated saliva samples were diluted 3-fold to prepare FEL D4 saliva samples with final concentrations of 8.33 μg / mL, 2.78 g / mL, 0.93 μg / mL, 0.31 μg / mL, 0.1 μg / mL, 0.03 μg / mL and 0.01 μg / mL, respectively; the treated saliva samples were mixed with equal volumes of egg yolk antibody liquid preparations of different titers and BSA control (60 μL+60 μL), and incubated at 4°C overnight.

[0184] (2) Washing: Wash the plate with WASH BUFFER, 150 μL / well, once.

[0185] (3) Add samples: Load 100 μL / well of the sample incubated overnight and incubate at room temperature for 1 h.

[0186] (4) Washing: Wash the plate with WASH BUFFER, 150 μL / well, three times.

[0187] (5) Add anti-FEL D4: Mix antibodies at a ratio of 1:1000 according to the instructions.

[0188] (6) Washing: Wash the plate with WASH BUFFER, 150 μL / well, three times.

[0189] (7) Add TMB: 100 μL per well, incubate until STD is 0.08-1.2 at 450 nm.

[0190] (8) Washing: Wash the plate with WASH BUFFER, 150 μL / well, three times.

[0191] (9) Color development: Add 100 μL TMB to each well and allow color development for 5 min.

[0192] (10) Stop solution: Add 100 μL of 1 M H2SO4 solution to each well to stop the reaction.

[0193] FEL D4 content range: hair (0.001-0.0105μg / mL) and saliva (1.32-19.71μg / mL). Figure 5As shown, the titer is higher than 1:1280000, and the egg yolk antibody has a certain neutralizing effect on FEL D4 in saliva; the FEL D4 content in the hair sample is very low and cannot be quantitatively detected. Referring to the test results of the saliva samples, the titer is higher than 1:80000, and the egg yolk antibody has a good neutralizing effect on FEL D4 in the hair.

[0194] In summary, the release titer of the egg yolk antibody composition disclosed in the present invention is shown in Table 6 below.

[0195] Table 6: Release titer of yolk antibody composition

[0196]

[0197] The egg yolk antibody and its composition provided by the present invention are directed against FEL D1 and FEL D4 at the same time, wherein the gene expression sequences of four FEL D1s are independently designed and optimized, and the optimal sequence is screened for antigen expression. The present invention purifies the high-titer egg yolk antibodies against FEL D1 and FELD4 and adds a protective agent to make a liquid preparation, which neutralizes allergens together, can more effectively reduce the occurrence of allergic reactions, and is more convenient to store and use. The liquid preparation can be used to prepare sprays, mouthwashes, pet caressing gloves and wipes and other products for application. In addition, the high-titer egg yolk antibodies against FEL D1 and FEL D4 can also be freeze-dried to prepare food-grade powder, which can be used to prepare complete cat food, pet staple food companion, cat snacks, pet nutritional supplements and other products for application. The immunogenic composition provided by the present invention and the corresponding egg yolk antibodies and compositions have better neutralization titer and stability in application.

[0198] Example 8: Yolk antibody titer stability

[0199] Reagents: FEL D1 antigen (2.378 mg / mL), FEL D4 antigen (2.013 mg / mL), Goat anti-Chicken IgY (H+L) secondary antibody, HRP (Cat. No. A16054; Specification: 1 mg, thermofisher), blocking solution (PBS+3% BSA), PBST (0.1% Tween 20) washing solution, PBS buffer (pH 7.4), sample diluent (PBS+0.5% BSA), TMB colorimetric solution, 1MH2SO4 stop solution. Among them, 10×PBS: weigh 160 g of sodium chloride, add 58 g of disodium hydrogen phosphate dodecahydrate, 4 g of potassium dihydrogen phosphate, add 1.8 L of ultrapure water to dissolve, adjust pH to 7.3±0.1, dilute to 2 L with purified water, store at room temperature, valid for 3 months. Blocking solution: 3% BSA PBS buffer. PBST (0.1% Tween20) washing solution: Measure 1000mL of 1×PBS solution, add 1mL Tween20, mix well, and prepare it before use. Sample diluent: 0.5% BSA in PBS buffer. Stop solution (1M H2SO4): Measure 850mL of purified water and add it to a glass. Slowly add 50mL of 98% concentrated sulfuric acid along the wall, stirring while adding to dissipate heat, and store at room temperature. Carbonate buffer (pH9.6): Weigh 1.59g of sodium carbonate and 2.93g of sodium bicarbonate, add to about 800mL of ultrapure water, and stir to fully dissolve. Adjust the pH to 9.6±0.1, and make up to 1L with ultrapure water. It can be scaled up according to the required amount and fill in the reagent label on the bottle. Store at 2-8℃, valid for 3 months. TMB colorimetric solution: Use Thermo 1-StepTMUltra TMB-ELISA.

[0200] Specific experimental steps:

[0201] (1) Coating: CHO-expressed FEL D1 and FEL D4 antigens were diluted to 1 μg / mL using carbonate buffer (pH 9.6), 100 μL / well was loaded, and the coating was carried out at 4°C overnight.

[0202] (2) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0203] (3) Blocking: 200 μL / well of blocking solution (PBS+3% BSA) was added to a 96-well plate and incubated at 25° C. and 100 rpm for 1.5 h.

[0204] (4) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0205] (5) Adding samples: The egg yolk antibody test samples and negative samples sampled at different time points were first diluted 10,000 times, and then diluted 2 times to obtain the remaining 7 points, loaded at 100 μL / well, and incubated at 25°C, 100 rpm for 1.5 h (Note: 0.5% BSA was used instead of sample loading as a blank control).

[0206] (6) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0207] (7) Adding secondary antibody: Dilute Goat anti-Chicken IgY (H+L) secondary antibody HRP (Cat. No.: A16054; Specification: 1 mg, Thermofisher) 4000-fold with sample diluent (PBS+0.5% BSA) and load 100 μL into each well. Incubate at 25°C, 100 rpm for 1.5 h.

[0208] (8) Washing: Wash the plate with 0.1% PBST, 300 μL / well, 3-5 times.

[0209] (9) TMB color development: Add 100 μL TMB color development solution to each well for color development and incubate at room temperature for 17 min.

[0210] (10) Stop solution: Add 100 μL of 1 M H2SO4 solution to each well to stop the reaction.

[0211] Calculation: Yolk antibody titer (p / n) = OD value of the sample to be tested / OD value of the negative sample at the corresponding dilution. The maximum dilution when p / n is greater than 2.1 is taken as the yolk antibody titer.

[0212] The results of the stability test of egg yolk antibodies at different temperatures are shown in Tables 7 and 8, wherein FEL D1 antibody and FEL D4 antibody showed good titers at both room temperature and other temperatures and were not affected by the storage time.

[0213] Table 7: Stability of FEL D1 antibody and FEL D4 antibody at 4°C and 25°C

[0214]

[0215] Table 8: Stability of FEL D1 antibody and FEL D4 antibody at 40°C and 50°C

[0216]

[0217] Example 9: Verification of the allergen reduction effect after cats were fed with freeze-dried powder containing specific egg yolk antibodies against Fel d1 and Fel d4

[0218] The egg yolk freeze-dried powder obtained in Example 3 (containing anti-Fel d1 and Fel d4 specific egg yolk antibodies) was added to ordinary cat food at a mass ratio of 1% and fed to 9 experimental cats. The egg yolk freeze-dried powder was fed for 1 week before the control period and 6 weeks in the experimental period. The saliva and hair clinical samples of the 9 cats for a total of 7 weeks during the control period and the experimental period were tested for Fel d1 and Fel d4 content, and the results were statistically analyzed. The Fel d1 or Feld4 content in the saliva and hair clinical samples of the 9 cats at a single time point was summarized and the average value was taken (the Fel d4 content in the hair was too low and there was a large error, so it was not tested). The results of 7 weeks are summarized in Table 9 below, and the trend of change is shown below Figure 6-Figure 8 :

[0219] Table 9: Results of the detection of Fel d1 and Fel d4 antigen content in the saliva and hair of experimental cats (ug / ml)

[0220]

Claims

1. A yolk antibody composition, characterized in that: The egg yolk antibody composition comprises an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D1 and an egg yolk antibody that specifically recognizes and neutralizes cat allergen FEL D4; Preferably, the FEL D1 comprises at least one of the following amino acid sequences: SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8; Preferably, the FEL D4 comprises the amino acid sequence shown in SEQ ID NO:

10.

2. The method for preparing the egg yolk antibody composition according to claim 1, characterized in that: include: S1: preparing antigen proteins including FEL D1 and FEL D4; S2: immunizing laying hens with the antigen protein containing FEL D1 and the antigen protein containing FEL D4 separately or together to obtain immune eggs from the immune chickens; S3: purifying the immune chicken eggs to obtain egg yolk antibodies.

3. The preparation method according to claim 2, characterized in that: S2 further includes: a. The antigen protein comprising FEL D1 and FEL D4 is mixed with an immune adjuvant to obtain a mixture; b. injecting the mixture into laying hens for immunization; Preferably, the primary immunization adjuvant is Freund's complete adjuvant; Preferably, the antigen protein of FEL D1 and / or the antigen protein of FEL D4 is mixed with Freund's complete adjuvant at a volume ratio of 1:1, and the concentration after mixing is 2 mg / mL.

4. The preparation method according to claim 3, characterized in that: The preparation method further comprises: c. After that, booster immunization is performed every two weeks. During the booster immunization, the antigen protein of FEL D1 or the antigen protein of FEL D4 is mixed with the booster immunization adjuvant in a volume ratio of 1:1; Preferably, the booster immunization in c is performed twice; Preferably, the booster adjuvant is Freund's incomplete adjuvant.

5. The preparation method according to claim 2, characterized in that: The antigen protein of FEL D1 and the antigen protein of FEL D4 are prepared by molecular cloning or genetic engineering recombinant expression method; Preferably, a FEL D1 gene fragment selected from the nucleotide sequences shown in SEQ ID NO: 1, 3, 5, 7 and a FEL D4 gene fragment shown in SEQ ID NO: 9 are inserted into the vector respectively; More preferably, the FEL D1 gene fragment as shown in the nucleotide sequence SEQ ID NO: 1 is inserted into the vector; Preferably, the preparation uses amplification primers selected from the group consisting of nucleotide sequences shown in SEQ ID NOs: 11-20.

6. An immunogenic composition, characterized in that Comprising an isolated cat allergen FEL D1 or an immunogenic fragment thereof and an isolated cat allergen FEL D4 or an immunogenic fragment thereof; Preferably, the isolated cat allergen FEL D1 or an immunogenic fragment thereof is as shown in the amino acid sequence SEQ ID NO: 2, 4, 6, 8; Preferably, the isolated cat allergen FEL D4 or an immunogenic fragment thereof is as shown in the amino acid sequence SEQ ID NO: 10; Preferably, the immunogenic composition is used to prepare the egg yolk antibody composition according to claim 1.

7. A liquid preparation, characterized in that The liquid preparation comprises the egg yolk antibody composition according to claim 1 or the egg yolk antibody composition obtained by the preparation method according to any one of claims 2 to 5; Preferably, the liquid preparation is in the form of a spray, glove wipes liquid or mouthwash; Preferably, the liquid preparation further comprises a protective agent; More preferably, the protective agent is selected from one or more of sorbitol and Tween 80.

8. A food grade powder, characterized in that The food-grade powder comprises the egg yolk antibody composition according to claim 1 or the egg yolk antibody composition obtained by the preparation method according to any one of claims 2 to 5; Preferably, the food-grade powder is used to prepare cat food, cat food companion or pet treats.

9. Use of the egg yolk antibody composition according to claim 1, the egg yolk antibody composition obtained by the preparation method according to any one of claims 2 to 5, the liquid preparation according to claim 7 or the food-grade powder according to claim 8 in the preparation of a product for preventing and / or allergic symptoms of humans to cats; Preferably, the product comprises a spray, a pet petting glove wipe, a mouthwash, a pet washing product, a cat food, a cat food companion, a pet snack or a pet nutritional supplement.

10. The use according to claim 9, characterized in that The method comprises administering an effective amount of the egg yolk antibody composition or the liquid preparation to a cat in vitro, or administering the egg yolk antibody composition or the food-grade powder in an effective amount as a part of pet food.

11. The use according to claim 9 or 10, characterized in that: The effective amount produces a neutralization titer of at least 1:640,000 against FEL D1 and at least 1:1,280,000 against FEL D4 in cat saliva; and / or a neutralization titer of at least 1:320,000 against FEL D1 and at least 1:80,000 against FEL D4 in cat hair.

12. A nucleic acid encoding the egg yolk antibody in the egg yolk antibody composition of claim 1 or the cat allergen or an immunogenic fragment thereof in the immunogenic composition of claim 6; Preferably, the cat allergen or immunogenic fragment thereof in the immunogenic composition is as shown in the nucleotide sequence SEQ ID NO: 1, 3, 5, 7, 9.

13. An expression system, characterized in that The expression system is constructed by introducing expression vectors containing the FEL D1 gene fragments shown in the nucleotide sequences of SEQ ID NOs: 1, 3, 5, and 7 and / or the FEL D4 gene fragments shown in the nucleotide sequence of SEQ ID NO: 9 into host cells respectively; Preferably, the host cell is a CHO cell.

Images