Antibodies, antibody pairs, and kits targeting human MCP-1 protein and their uses

By developing a high-affinity monoclonal antibody against human MCP-1 protein and constructing a double-antibody sandwich enzyme-linked immunosorbent assay system, the problem of poor antibody affinity in the existing technology is solved, and high-sensitivity detection of human MCP-1 protein is achieved, which is suitable for the detection of various biological samples.

CN119684454BActive Publication Date: 2025-09-12WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411923410.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-25
Publication Date
2025-09-12
Estimated Expiration
2044-12-25

AI Technical Summary

Technical Problem

The existing commercially available anti-human MCP-1 antibodies have poor affinity, resulting in low sensitivity of enzyme-linked immunosorbent assay (ELISA) detection, making it difficult to accurately detect extremely low concentrations of MCP-1 protein.

Method used

Two high-affinity monoclonal antibodies against human MCP-1 protein were developed for the construction of a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system. The first antibody was used as the capture antibody, the second antibody was used as the detection antibody, and biotin was used to label the system to achieve high-sensitivity detection of human MCP-1 protein.

Benefits of technology

It achieves high-affinity and high-sensitivity detection of human MCP-1 protein, with a detection limit as low as 10.85 pg/mL, and can cover the antigen concentration range of 0-2000 pg/mL. It is suitable for the detection of various biological samples and has good early diagnosis and monitoring value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119684454B_ABST
    Figure CN119684454B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of antibody preparation, and in particular to antibodies, antibody pairs and kits for human MCP-1 protein and their uses. The antibody is a first antibody or a second antibody, and the amino acid sequences of the light chain CDR1-3 of the first antibody are respectively as shown in SEQ ID NO.3-5, and the amino acid sequences of the heavy chain CDR1-3 are respectively as shown in SEQ ID NO.8-10; the amino acid sequences of the light chain CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of the heavy chain CDR1-3 are respectively as shown in SEQ ID NO.18-20. The antibody provided by the present invention has high affinity and sensitivity to human MCP-1 protein. When a double-antibody sandwich enzyme-linked immunosorbent assay system is developed using the antibody to detect human MCP-1 protein, the antibody has the advantages of high sensitivity, good accuracy and credibility, and has good application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and in particular to an antibody, an antibody pair and a kit targeting human MCP-1 protein and uses thereof. Background Art

[0002] Monocyte chemoattractant protein-1 (MCP-1), also known as chemokine ligand 2 (CCL2), is a member of the CC subfamily of chemokines. Its precursor molecule consists of a 23-amino acid signal peptide and a 76-amino acid mature peptide. The signal peptide is cleaved during maturation, resulting in the active mature protein. MCP-1's structural hallmark is the conserved CC motif, consisting of four conserved cysteines at positions 33, 34, 57, and 73, interconnected by two intrachain disulfide bonds. This structure is crucial for its function. The primary biological function of MCP-1 is to attract and activate immune cells, leading to their migration to sites of inflammation, thereby initiating and promoting inflammatory responses. For example, at sites of infection, MCP-1 released by inflammatory cells creates a concentration gradient, along which monocytes can migrate to the infection site, participating in the inflammatory response and pathogen clearance. Furthermore, MCP-1 activates intracellular signal transduction pathways, leading to the release of oxygen free radicals and cytotoxic enzymes, and inducing the expression of adhesion molecules and various inflammatory mediators such as IL-1, IL-6, and TNF-α. It promotes the release of histamine from basophils and mast cells, regulates phagocytic function, and promotes apoptosis. MCP-1 can also chemotacticize and activate monocytes and macrophages to secrete IL-12, thereby inducing the differentiation of naive CD4+ T cells into type 1 helper T cells (Th1), thereby enhancing cellular immunity. Furthermore, MCP-1 is involved in neutrophil differentiation and the activation of the nuclear transcription factor NF-κB, a key signaling molecule involved in cell activation and amyloid upregulation. Therefore, MCP-1 plays a key role in the development and progression of various diseases.

[0003] MCP-1 levels are elevated during inflammation and injury in a variety of diseases and can serve as a diagnostic marker. For example, in the early diagnosis of certain kidney diseases, measuring urine MCP-1 levels may help detect inflammation and kidney damage. MCP-1 signaling has tumor-promoting effects in various cancers; elevated CCL2 levels in patients with breast, colorectal, and prostate cancers are often associated with disease progression. Autoimmune diseases are often accompanied by infiltration of target tissues by lymphomyeloid cells, leading to inflammation and tissue damage. MCP-1 and its receptor CCR2 play a key role in this process. In neurological diseases, MCP-1 and its receptor CCR2 play a crucial role in stroke, Alzheimer's disease, multiple sclerosis, and other neurological disorders. In addition to the aforementioned diseases, MCP-1 is also involved in the pathogenesis of numerous other conditions, including bone remodeling, hepatitis, hypertension, and diabetes. Therefore, MCP-1 concentration can serve as a clinical indicator to indicate the activity and prognosis of diseases such as inflammation, infection, malignancy, and autoimmune diseases.

[0004] Currently, enzyme-linked immunosorbent assay (ELISA) is the most commonly used technique for MCP-1 quantification, applicable to cell culture supernatants, serum, urine, or tissue extracts. To improve the sensitivity of ELISA detection, it is necessary to develop high-performance monoclonal antibodies against human MCP-1. However, currently available anti-human MCP-1 antibodies are all mouse-derived, which suffer from poor affinity and other issues, resulting in low detection sensitivity. The reliability of the detection results for extremely low protein concentrations, such as ng / mL to pg / mL, needs to be improved. Summary of the Invention

[0005] To address the aforementioned problems in the prior art, the present invention provides two ideal immunodiagnostic antibodies against human MCP-1 protein, antibody pairs thereof, as well as kits containing the aforementioned antibodies or antibody pairs and their uses. The antibodies provided by the present invention have high affinity and sensitivity for human MCP-1 protein. The double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system developed using the antibodies has the advantages of high sensitivity, accuracy, and reliability when used to detect human MCP-1 protein. To achieve the aforementioned objectives, the present invention is specifically implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides an antibody against human MCP-1 protein, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity determining regions CDR1-3 on the light chain variable region of the first antibody are shown as SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementarity determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs. 8-10, respectively; the amino acid sequences of the complementarity determining regions CDR1-3 on the light chain variable region of the second antibody are shown as SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the complementarity determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs. 18-20, respectively.

[0007] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0008] Furthermore, the amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0009] Furthermore, the first antibody or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

[0010] The second aspect of the present invention provides a nucleic acid molecule encoding the first antibody or the second antibody as described above.

[0011] Furthermore, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

[0012] Furthermore, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

[0013] The third aspect of the present invention provides an antibody pair against human MCP-1 protein, consisting of the first antibody and the second antibody as described above.

[0014] The fourth aspect of the present invention provides a kit for detecting human MCP-1 protein, wherein the kit comprises the above-mentioned antibody against human MCP-1 protein or the above-mentioned antibody pair against human MCP-1 protein.

[0015] Furthermore, the kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, which includes a first antibody and a second antibody, wherein the first antibody serves as a capture antibody, the second antibody serves as a detection antibody, and the second antibody is coupled with a detection label.

[0016] The advantages and positive effects of the present invention are as follows: the present invention provides two ideal immunodetection antibodies for human MCP-1 protein, which have the advantages of high affinity and sensitivity, with affinity constants at the level of 0.1-0.01 nM, and the two antibodies bind to different antigenic epitopes of the human MCP-1 protein. When a double-antibody sandwich enzyme-linked immunosorbent assay system is developed using the two antibodies to detect human MCP-1 protein, the system can cover an antigen concentration range of 0-2000 pg / mL, with a detection limit as low as 10.85 pg / mL, and has the advantages of high sensitivity, good accuracy and reliability, etc., and has good application value in the early diagnosis, long-term monitoring and prognosis evaluation of diseases related to abnormal MCP-1 protein expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0018] Figure 1 A map of the vector used to construct the rabbit monoclonal antibody expression vector in Example 1 of the present invention, including, from left to right, the pRB322 vector carrying the light chain constant region and the heavy chain constant region;

[0019] Figure 2This is an affinity curve of the monoclonal antibody 4C2 binding to human MCP-1 protein in Example 1 of the present invention;

[0020] Figure 3 This is an affinity curve of the monoclonal antibody 1A5 binding to human MCP-1 protein in Example 1 of the present invention;

[0021] Figure 4 This is a graph showing the antigen epitope recognition of human MCP-1 protein by monoclonal antibodies 4C2 and 1A5 according to Example 1 of the present invention;

[0022] Figure 5 This is the standard curve of the human MCP-1 protein double antibody sandwich enzyme-linked immunosorbent assay system established based on monoclonal antibodies 4C2 and 1A5 in Example 2 of the present invention. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0024] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0025] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0026] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0027] The terms "include", "comprising", "containing", "having" and the like are non-limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0028] The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0029] The terms "first," "second," and the like are used to distinguish similar objects and are not necessarily used to describe a particular order or sequence, and it should be understood that such usage can be interchangeable under appropriate circumstances.

[0030] The terms "rabbit monoclonal antibody," "rabbit antibody," and "rabbit monoclonal antibody" have the same meaning and, unless otherwise specified, refer to rabbit antibodies that specifically bind to human monocyte chemoattractant protein-1 (MCP-1). The modifier "rabbit" indicates that the complementarity-determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences. The terms "monocyte chemoattractant protein-1," "MCP-1," "CCL2," "MCP-1 / CCL2," and other similar terms have the same meaning and can be used interchangeably.

[0031] An antibody is an immunoglobulin molecule that is capable of specifically binding to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and encompasses various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and genetic or chemical modifications thereof, as long as they exhibit the desired antigen-binding activity. Antibody fragments can be one or more portions or fragments of a full-length antibody that retain the antibody's ability to specifically bind to the target antigen.

[0032] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types: kappa (κ) and lambda (λ); heavy chains can be classified into five types: μ, δ, γ, α, and ε, which define antibodies as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of heavy and heavy chains vary greatly, while the remaining amino acid sequences are relatively constant. The regions of the light and heavy chains with the most variable amino acid sequences near the N-terminus are called the variable region (V), while the regions with relatively stable amino acid sequences near the C-terminus are called the constant region (C). The heavy chain variable region (VH) and light chain variable region (VL) are generally the most variable parts of antibodies and contain the antigen recognition site. The VH and VL regions can be further subdivided into hypervariable regions (HVRs) and framework regions (FRs). The HVRs, also known as complementarity-determining regions (CDRs), are circular structures. The heavy and light chain CDRs are closely aligned and interact with each other through the FRs, forming a surface that complements the three-dimensional structure of the target antigen or epitope. This determines the antibody's specificity and is the site of antigen recognition and binding. The FRs are the more conserved portions of the VH and VL sequences. They generally follow a β-pleated sheet configuration and are connected by three CDRs forming a connecting loop. Each VH and VL sequence typically consists of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0033] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, a cumulative of the Kabat and Chothia definitions, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define CDRs.

[0034] The light chain constant region (CL) and heavy chain constant region (CH) are not directly involved in antibody-antigen binding, but they exhibit different effector functions, such as antibody-dependent cytotoxicity. The CL length is essentially the same for different Ig types (κ or λ), but the CH length varies across Ig classes. For example, IgG, IgA, and IgD comprise CH1, CH2, and CH3, while IgM and IgE comprise CH1, CH2, CH3, and CH4. The amino acid sequences of the heavy and light chain constant regions of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0035] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "intact antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0036] Antibody fragments are one or more parts or fragments of a full-length antibody that essentially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR regions as the full-length antibody, and more preferably the same variable regions, thereby retaining complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, particularly to the same epitope. Typical examples include: Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antibody fragments can be obtained using conventional techniques in the art.

[0037] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of the heavy chain (variable and first constant regions). By proteolytic cleavage of the full-length antibody, fragments such as Fab, F(ab')2, and Fab' can be obtained. For example, IgG can be degraded into two Fab fragments and an Fc fragment by papain; and into an F(ab')2 fragment and a pFc' fragment by pepsin. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab contains the antigen-binding region and a portion of the constant region, it not only possesses the same antibody-antigen affinity and excellent tissue penetration as scFv, but also has a more stable structure.

[0038] (ii) F(ab)2: A bivalent fragment consisting of two Fabs linked by a disulfide bridge at the hinge region.

[0039] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of the intact antibody.

[0040] (iv) (Fv)2: Consists of two covalently linked Fv fragments.

[0041] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) connected by a flexible linker (typically consisting of 10-25 amino acids). It retains the antigen-binding specificity of the original antibody. The linker in this invention is not particularly limited, as long as it does not hinder the expression of the antibody variable regions connected to it. Compared to full-length antibodies, scFv has a smaller molecular weight, resulting in higher penetration and lower immune side effects.

[0042] (vi) The sc(Fv)2 fragment is composed of two heavy chain variable regions and two light chain variable regions connected by a linker or the like.

[0043] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may comprise a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may comprise amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody comprising a non-human antibody, such as a rabbit antibody, with a CDR region and a human FR region. In some cases, the variable region of a non-human antibody is combined with a constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with a FR region and a constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, which is derived from the FR sequence of a single or multiple other human antibody variable regions. In the present invention, the CDR regions in the chimeric or humanized antibodies are derived from rabbit-derived CDR regions.

[0044] The terms "monoclonal antibody" or "single antibody" and other similar terms are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies comprising the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitope on the antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0045] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer-lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0046] In order to make the above-mentioned objects and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0047] An embodiment of the present invention provides an antibody against human MCP-1 protein, which is a first antibody or a second antibody, comprising a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region each comprise three complementarity determining regions (CDRs), respectively designated as CDR1, CDR2, and CDR3; wherein: the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

[0048] This method uses B cell labeling and sorting techniques to directly enrich and isolate B cells capable of recognizing human monocyte chemoattractant protein-1 (MCP-1) from the spleen of immunized rabbits. These cells are then cultured as single cells to directly obtain monoclonal antibodies, significantly improving the efficiency of monoclonal antibody screening and eliminating the tedious steps of multiple subcloning in hybridomas. Subsequently, recombinant technology is used to express the antibody genes secreted by the B cells, allowing for large-scale production of the target antibody strain, offering the advantages of a simple process and good batch stability.

[0049] The two antibodies provided by the present invention can accurately recognize and bind to monoclonal antibodies of human MCP-1 protein, have the advantages of high affinity and sensitivity, and the affinity constant is at the level of 0.1-0.01nM. They can effectively recognize low-concentration antigens and are ideal immunoassay tools. Moreover, these two antibodies bind to different epitopes of human MCP-1 protein. A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system is developed using the two antibodies. The first antibody is used as the capture antibody and the second antibody labeled with biotin is used as the detection antibody to quantitatively detect recombinant human MCP-1 protein. The system can cover an antigen concentration range of 0-2000pg / mL, with a detection limit as low as 10.85pg / mL, and can accurately detect pg-level antigen content, which is beneficial for early diagnosis of diseases when antigen levels are low. Moreover, its wide linear detection range can adapt to changes in antigen levels in different disease stages and different individuals, and is suitable for detection needs in multiple scenarios. The method established in the present invention can be used for the efficient detection of MCP-1 protein in biological samples such as human serum, urine, cells, and tissues. It has the advantages of high sensitivity, good accuracy, and reliability, and has good application value in the early diagnosis, long-term monitoring, and prognostic evaluation of diseases related to abnormal MCP-1 protein expression.

[0050] Optionally, the light chain variable region and the heavy chain variable region each include four framework regions (FRs), and the four FRs and three CDRs are arranged in a staggered order to form a variable region. The amino acid sequence of the light chain variable region (VL) of the first antibody is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO. 7. The amino acid sequence of the light chain variable region (VL) of the second antibody is shown in SEQ ID NO. 12, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO. 17.

[0051] Optionally, the rabbit monoclonal antibody of the present invention further comprises a light chain constant region and a heavy chain constant region, wherein CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of an antibody is usually obtained by querying the IMGT online database.

[0052] Specifically, the amino acid sequence of the light chain (FL) of the first antibody is shown in SEQ ID NO. 1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 6. The amino acid sequence of the light chain (FL) of the second antibody is shown in SEQ ID NO. 11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 16. The light chain constant regions of both the first and second antibodies are κ chains, and the heavy chain constant regions are both IgG type.

[0053] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially maintains the same biological function or activity as the full-length form of the antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv and sc(Fv)2. These antigen-binding regions can be obtained by conventional techniques in the art.

[0054] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the aforementioned nucleic acid molecule, or a host cell comprising the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0055] Nucleic acid molecules can be in the form of DNA (e.g., cDNA, genomic DNA, or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be either a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be derived from the antibody amino acid sequence by conventional means, such as codon coding rules.

[0056] The full-length sequence of a nucleic acid molecule or a fragment thereof can usually be obtained by PCR amplification, recombination or artificial synthesis.

[0057] Illustratively, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

[0058] Illustratively, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

[0059] The original vector for constructing the recombinant vector is a variety of vectors conventional in the art, as long as it can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., for transferring the nucleic acid molecule into the host and multiplying it in large quantities in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technology in the art.

[0060] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy chain and light chain are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under appropriate conditions to form the antibody. In other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence linked to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a different promoter, or the nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a single promoter so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0061] Conventional techniques are used to transfect or transform the recombinant vector into host cells. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2. Alternatively, transfection can be accomplished by microinjection, electroporation, or liposome packaging. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or particle bombardment to achieve gene introduction.

[0062] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (e.g., DH5α, JM109, BL21, W3110), Bacillus (e.g., Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (e.g., Salmonella typhimurium, Serratia marcescens), and Pseudomonas. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining a host cell transfected or transformed with the recombinant vector described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain purified antibodies.

[0063] In the present invention, transfection or transformation of the recombinant vector into host cells is performed using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2 or MgCl2. If desired, methods such as microinjection, electroporation, or liposome packaging can also be used. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, etc.

[0064] Preferably, the recombinant vector is the expression vector pBR322, and the host cell is a human kidney epithelial (293F) cell.

[0065] Another embodiment of the present invention provides an antibody pair against human MCP-1 protein, consisting of the first antibody and the second antibody as described above.

[0066] The first antibody and second antibody provided by the present invention recognize and bind to different epitopes of human MCP-1, and can be used to pair antibodies to develop a double-antibody sandwich ELISA system or kit. When detecting human MCP-1, they have the advantages of high sensitivity, low detection limit, wide linear range, and applicability in multiple scenarios.

[0067] Yet another embodiment of the present invention provides the use of the above-mentioned antibody or antibody pair against human MCP-1 protein in the preparation of a kit for detecting human MCP-1 protein.

[0068] The advantages of using the antibody or antibody pair against human MCP-1 protein in preparing a kit for detecting human MCP-1 protein are the same as the advantages of the antibody against human MCP-1 protein over the prior art as described above, and will not be repeated here.

[0069] Based on the same inventive concept as above, an embodiment of the present invention further provides a kit for detecting human MCP-1 protein, wherein the kit comprises the first antibody and / or the second antibody as described above.

[0070] It should be emphasized that the first antibody and the second antibody can be used separately, together, or in pairs. When detecting, if used separately or together, the first antibody and / or the second antibody are used as a primary antibody or capture antibody, the sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be coupled (covalently or non-covalently) to a detection label, and the qualitative or quantitative detection of MCP-1 protein is achieved by analyzing the change in the identifiable signal generated by the detection label. In other embodiments, the first antibody of the anti-human MCP-1 protein is not labeled, and the detection label is coupled to a second antibody (as a detection antibody) or other molecule that can bind to the capture antibody. For example, if the anti-human MCP-1 protein antibody is a rabbit IgG antibody, the second antibody can be an anti-rabbit IgG antibody, thereby producing a change in the identifiable signal by coupling the second antibody of the detection label. When used in pairs, one of the first and second antibodies is used as a primary antibody or capture antibody, and the other is used as a second antibody or detection antibody.

[0071] The detection method uses common immunological methods, such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), flow cytometry (FC), etc. The detection targets include recombinantly expressed human MCP-1 protein as well as human MCP-1 protein naturally secreted or expressed by cells or tissues. The test samples include, but are not limited to, serum, plasma, urine, cells or cell culture fluid, tissue or tissue homogenate, etc.

[0072] Preferably, the detection kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody) and the second antibody serves as a detection antibody (or secondary antibody) and is coupled with a detection label.

[0073] The detection labels for generating a recognizable signal change include, but are not limited to, biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0074] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0075] Example 1 Screening and Preparation of Rabbit Antibodies 4C2 and 1A5 Recognizing Human MCP-1 Protein

[0076] This example is based on B cell labeling and sorting technology. B cells that can recognize the target antigen are directly enriched and isolated from the spleen of rabbits immunized with human MCP-1 protein. The isolated B cells are then cultured in the form of single cells to obtain monoclonal antibodies 4C2 and 1A5, eliminating the tedious steps of preparing mouse anti-hybridomas. Finally, monoclonal antibodies 4C2 and 1A5 are mass-produced by genetic engineering recombinant expression technology. The antibody sequencing work was completed by Jin Kairui Biotechnology Co., Ltd., and its amino acid (AA) sequence and gene (DNA) sequence are shown in Tables 1-2, respectively. For ease of description, light chain CDR1-3 are represented by LCDR1, LCDR2 and LCDR3, respectively, and heavy chain CDR1-3 are represented by HCDR1, HCDR2 and HCDR3, respectively.

[0077] Table 1 Sequence information of rabbit monoclonal antibody 4C2 in this example

[0078]

[0079]

[0080] Table 2 Sequence information of rabbit monoclonal antibody 1A5 in this example

[0081]

[0082] The preparation method of rabbit monoclonal antibodies 4C2 and 1A5 specifically includes the following steps:

[0083] 1. Animal Immunization: Human MCP-1 protein (from ABclonal, Catalog No. RP01653) was used as the immunogen. Two New Zealand white rabbits were immunized at 200 μg / rabbit. Before the first immunization, the immunogen was mixed with an equal amount of complete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple points on the rabbit's abdomen and back. Three weeks apart, 100 μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple points on the rabbit's abdomen and back for two booster immunizations. After three immunizations, rabbit serum samples were collected and diluted to determine the titer against human MCP-1 using an ELISA method. Rabbits with high serum titers were given a booster immunization with 200 μg of the immunogen injected subcutaneously at multiple points. Three days later, the animals were sacrificed and their spleens were removed.

[0084] 2. Isolate B cells from the spleen and perform B cell sorting: Use conventional methods to isolate B cells from the spleen, and sort out antigen-specific B cells. For related methods, please refer to the patents "Method for Efficiently Isolating Single Antigen-Specific B Cells from Spleen Cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)" and "A B Cell In Vitro Culture System and Application (Publication No.: CN111518765A, Publication Date: 2020-08-11)".

[0085] 3. Cloning of monoclonal antibody gene: The cultured rabbit B cell supernatant was used to identify positive clones by antigen-coated ELISA. The cells of positive clones were collected and lysed and then analyzed by Quick-RNA TM RNA was extracted using a MicroPrep kit (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, naturally paired antibody light chain variable regions (VL) and heavy chain variable regions (VH) were amplified from positive clones by PCR. The PCR reaction system consisted of 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2× Gloria HiFi (from ABclonal, catalog number RK20717), and 6.5 μL H2O. The amplification procedure included a 98°C initial denaturation for 30 seconds, followed by 40 cycles of 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 30 seconds, followed by a final hold at 72°C for 5 minutes. The resulting reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent forward and reverse primers, respectively:

[0086] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0087] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0088] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0089] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0090] The amplified products were sequenced to obtain the variable region sequence of the antibody and its encoding gene sequence; the heavy chain constant region (CH) was obtained by searching for rabbit IgG gamma C reign, and the light chain constant region (CL) was obtained by searching for rabbit IgG kappa C reign in the IMGT online database (www.imgt.org).

[0091] 4. Production and purification of rabbit monoclonal antibodies: In order to produce antibodies on a large scale, the obtained CL and CH genes were inserted into the mammalian expression vector pBR322. The resulting vector map is shown in Figure 1 , where the pBR322 origin and f1 origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PAterminator is a tailing signal, the light chain constant is the nucleic acid sequence of CL (left), and the heavy chain constant is the nucleic acid sequence of CH (right). The amplified VL and VH genes were then ligated via homologous recombination with the expression vector pBR322 carrying the CL and CH genes, linearized with the XbaI and NheI restriction endonucleases, respectively, to obtain complete light chain (FL) and heavy chain (FH) gene expression vectors. Sequencing verified the successful construction of the vectors.

[0092] Typically, to achieve secretory expression of an antibody, a signal peptide sequence needs to be added to the front end of its VL and VH genes. Signal peptides can be commonly used antibody expression signal peptides in the art. For example, the patents "Anti-human interferon α2 rabbit monoclonal antibody and its application (Publication No.: CN116063487A, Publication Date: 2023-05-05)" and "High-affinity human IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: 2023-03-21)" have a signal peptide "MDTRAPTQLLGLLLLWLPGATF" or "MDTRAPTQLLGLLLLWLPGARC" upstream of the VL, and a signal peptide "METGLRWLLLVAVLKGVQC" upstream of the VH. Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the antibody sequences in Tables 1-2 of this Example do not include signal peptide sequences.

[0093] The encoding gene of the above-mentioned signal peptide "MDTRAPTQLLGLLLLWLPGATF" can be atggacacgagggcccccact cagctgctgggtttgcttctcttgtggttgccaggcgcaacgttt; the encoding gene of the signal peptide "MDTRAPTQLLGLLLLWLPGARC" can be atggacacgagggcccccactcagctgctgggacttctgttactgtggctcccaggtgcaagatgt; the encoding gene of the signal peptide "METGLRWLLLVAVLKGVQC" can be atggagactgggctgcgctggcttctcctggttgctgtgctcaag ggagtgcagtgc or atggagactgggctgcgctggcttctcctggttgcagtgctgaagggcgtccagtgc.

[0094] The successfully constructed expression vectors containing FL and FH genes were co-transfected into 293F cells, and the cells were cultured for 72-96 hours after transfection. The culture supernatant was collected and the recombinant rabbit monoclonal antibody recognizing human MCP-1 protein was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100).

[0095] 5. Antibody performance testing: After obtaining multiple recombinantly expressed antibodies, the antibodies are subjected to affinity identification and antigen recognition epitope identification to obtain the target antibody strain of the present invention.

[0096] 1) Identification of Antibody Affinity: Antigen-antibody binding curves were measured using the Gator Biomolecular Interaction Analyzer from Probe Life to identify antibody affinity. Antibodies were first immobilized on HFC (Anti-HIgG FC) probes (purchased from Gator Bio, Cat. No. 160003) at a concentration of 1 μg / mL. The probes were then placed in 56.733 nM and 49.4 nM recombinant human monocyte chemoattractant protein-1 solutions, respectively, to allow antigen binding. Affinity curves for antibodies 4C2 and 1A5 were obtained, as shown in Figure 2 . Figure 2-3 , where the ordinate represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, the abscissa represents the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K off The constant that characterizes the dissociation rate between antibody and antigen, the binding coefficient K on A constant that characterizes how quickly an antibody binds to its target, the affinity constant K D K off / K on The ratio of , which characterizes the dissociation equilibrium constant between antibody and antigen.

[0097] Table 3 Affinity-related parameter determination results of monoclonal antibodies 4C2 and 1A5

[0098] Monoclonal antibodies <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 4C2 <![CDATA[2.55×10 -5 ]]> <![CDATA[3.47×10 5 ]]> <![CDATA[7.35×10 -11 ]]> 1A5 <![CDATA[8.73×10 -5 ]]> <![CDATA[2.41×10 5 ]]> <![CDATA[3.62×10 -10 ]]>

[0099] The dissociation equilibrium constants of antibody 4C2 and antibody 1A5 against human MCP-1 protein were 0.0735 nM and 0.362 nM, respectively, indicating that they had high affinity for the antigen protein.

[0100] 2) Identification of antigen recognition epitopes: The obtained antibodies were paired using the Gator biomolecular interaction analyzer from Probe Life to test their recognized antigen epitopes. First, the antigen protein was immobilized on the HFC probe at a concentration of 1 μg / mL. The probes with the immobilized antigen protein were then placed in a 3 μg / mL antibody 4C2 solution to allow antibody 4C2 (as the first antibody) to bind to the target protein to saturation. The probes were then placed in a 3 μg / mL antibody 1A5 solution to allow antibody 1A5 (as the second antibody) to bind to the target protein. By analyzing the binding characteristics of different antibodies on the antigen, the recognition epitopes of the antibodies were analyzed. The results are shown in Figure 4 , where the ordinate represents the change in thickness of the complex after the probe binds to the antibody and protein, and the abscissa represents the binding time.

[0101] from Figure 4 As can be seen in the figure, the probe immobilized with human MCP-1 can obviously bind to 1A5 after binding to 4C2. It can be seen that the two antibodies bind to different epitopes on human MCP-1. Therefore, the two antibodies can be used as paired antibodies for double antibody sandwich enzyme-linked immunosorbent assay.

[0102] Example 2 Establishment of a double-antibody sandwich ELISA system based on antibodies 4C2 and 1A5 and its analytical sensitivity

[0103] Biotin labeling of antibody 1A5: Mix antibody 1A5 and biotin (purchased from Biosai Biotechnology, product number B5064) at a mass ratio of 10:1. React at 2-8°C for 16-20 hours to obtain biotin-labeled antibody 1A5 (1A5-biotin).

[0104] Antibody 4C2 was used as the capture antibody and antibody 1A5-biotin was used as the detection antibody to establish a double antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system. The steps were as follows: 1) Coating with capture antibody 4C2: Antibody 4C2 was diluted to 1 μg / mL with 1×PBS and added to a 96-well microplate at 100 μL / well. The plate was covered with a cover film and incubated at 4°C for 16-20 h. 2) Washing: After the incubation was completed, the liquid in the wells was discarded, and the plate was washed once with 1×PBST. 300 μL of sample was added, and the plate was allowed to stand for 40 s before the liquid in the wells was discarded. 3) Blocking: Blocking solution (1×PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20, and 0.1% proclin 300, pH 7.0) was added to the wells at 200 μL / well. 7.2) Add the microplate to the microwell plate, cover with a cover film, and block at 37°C for 2 hours. After blocking, discard the blocking solution and place in a 37°C oven to dry for 0.5-2 hours. 4) Add antigen protein: Human MCP-1 protein (from ABclona, ​​Catalog No. RP01653) was diluted with diluent (1× PBS containing 2% BSA, 0.05% Tween 20, and 0.1% proclin 300, pH 7.4). 7.2) Dilute to the following concentrations: 2000, 1000, 500, 250, 125, 62.5, 31.25, 0 pg / mL, then add 100 μL / well to the microplate in sequence, cover with a cover film, and incubate at 37°C for 2 hours; 5) Wash the plate: Same as step 2); 6) Add detection antibody 1A5: Dilute the biotin-labeled antibody 1A5 (1A5-biotin) to 0.005 μg / mL, then add 100 μL / well to the microplate in sequence, cover with a cover film, and incubate at 37°C for 1 hour; 7) Wash the plate: Same as step 2); 8) Add SA-HRP: Add 100× SA-HRP (horseradish peroxide Enzyme-labeled streptavidin (purchased from Wuhan Sanying Biotechnology Co., Ltd., catalog number SA00001-0) was diluted with the concentrate and added to the microplate at 100 μL / well, covered with a cover film, and incubated at 37°C for 0.5 h; 9) Washing: Same as step 2); 10) Adding TMB colorimetric solution: 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution (purchased from Tetramethylborax, catalog number 4ATMB1000) was added to the microplate at 100 μL / well, covered with a cover film, and incubated at 37°C for 15 min; 11) Reading: Remove the microplate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and read immediately using a microplate reader.

[0105] The concentration of human MCP-1 protein was used as the horizontal axis, and the correction value of the absorbance value Y1 (Y1 = OD 450nm -OD 630nm ) is the vertical axis, see Figure 5The results showed that using antibody 4C2 as the capture antibody and antibody 1A5 as the detection antibody for the detection of human MCP-1 demonstrated good linearity, high accuracy, and good reliability. The sensitivity of the detection system was calculated by substituting the average absorbance value of 16 dilution blank wells and twice the standard deviation into the standard curve (see Table 4). The detection limit was 10.85 pg / mL, demonstrating high sensitivity.

[0106] Table 4 Sensitivity of the double-antibody sandwich ELISA method based on antibodies 4C2 and 1A5

[0107]

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An antibody against human MCP-1 protein, characterized in that Selected from the first antibody or the second antibody, wherein: The amino acid sequences of the complementary determining regions CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 8-10, respectively; The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 18-20, respectively.

2. The antibody against human MCP-1 protein according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The antibody against human MCP-1 protein according to claim 2, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The antibody against human MCP-1 protein according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the first antibody or the second antibody as described in any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO. 24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is shown in SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

8. An antibody pair against human MCP-1 protein, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A kit for detecting human MCP-1 protein, characterized in that: The kit comprises the antibody against human MCP-1 protein according to any one of claims 1 to 4 or the antibody pair against human MCP-1 protein according to claim 8.

10. The kit for detecting human MCP-1 protein according to claim 9, characterized in that: The kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, which includes a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection label.

Citation Information

Patent Citations

  • Method for efficiently separating single antigen-specific B lymphocyte from spleen cells

    CN110016462A

  • B lymphocyte in vitro culture system and applications thereof

    CN111518765A

  • High-affinity Human IL-5 rabbit monoclonal antibody and application thereof

    CN115819578A

  • Anti-human interferon alpha 2 rabbit monoclonal antibody and application thereof

    CN116063487A

  • Human serum CCL2 enzyme-linked immunosorbent assay kit as well as preparation and use methods thereof

    CN104198727A