Antibodies, antibody pairs, kits and applications of anti-human CEACAM5 proteins

By developing highly specific and high-affinity anti-human CEACAM5 protein antibodies, the problem of low detection sensitivity in existing technologies has been solved, and efficient, specific and accurate detection of CEACAM5 protein at the ng level has been achieved, which is suitable for clinical diagnosis and scientific research.

CN119684463BActive Publication Date: 2025-09-12WUHAN AIBO TAIKE BIOTECH CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202411923415.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-25
Publication Date
2025-09-12
Estimated Expiration
2044-12-25

AI Technical Summary

Technical Problem

Existing anti-human CEACAM5 antibodies have poor affinity and low specificity in immunological analysis and detection, resulting in low detection sensitivity, especially in the double antibody sandwich enzyme-linked immunosorbent assay (ELISA).

Method used

Two highly specific and high-affinity anti-human CEACAM5 protein antibodies are provided for the development of a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system. The detection method developed using this system can efficiently, specifically, accurately, and sensitively detect CEACAM5 protein at the ng level.

Benefits of technology

It has achieved efficient, specific, accurate and sensitive detection of CEACAM5 protein at the ng level in blood, urine or other body fluids and cells/tissues, and is suitable for the clinical diagnosis, long-term monitoring and prognosis evaluation of diseases with abnormal CEACAM5 expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119684463B_ABST
    Figure CN119684463B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical field of antibody preparation, and in particular relates to antibodies, antibody pairs, and kits for use against human CEACAM5 protein. The antibody is a first antibody or a second antibody, wherein the amino acid sequences of the light chain CDR1-3 of the first antibody are shown as SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the heavy chain CDR1-3 are shown as SEQ ID NOs. 8-10, respectively; and the amino acid sequences of the light chain CDR1-3 of the second antibody are shown as SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the heavy chain CDR1-3 are shown as SEQ ID NOs. 18-20, respectively. The antibodies of the present invention have the advantages of high specificity, affinity, and good thermal stability. The double-antibody sandwich enzyme-linked immunosorbent assay system developed using the antibodies can efficiently, specifically, accurately, sensitively, and reliably detect ng-level CEACAM5 protein, and has good application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and in particular to an antibody, an antibody pair, a kit and applications thereof against human CEACAM5 protein. Background Art

[0002] Carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5), also known as carcinoembryonic protein (CEA), meconium antigen 100, and CD antigen CD66e, belongs to the immunoglobulin superfamily and the CEA family. CEACAM5 is a cell surface glycoprotein that binds to the membrane via glycosylphosphatidylinositol (GPI). It has seven extracellular immunoglobulin-like domains, including a variable IgV-like domain and six IgC-like domains (A1-B1-A2-B2-A3-B3). The IgV-like domain is the primary region that interacts with other CEA family members.

[0003] The expression of the CEACAM5 protein is tightly regulated. Under normal physiological conditions, CEACAM5 is highly expressed in epithelial cells of the intestine, respiratory tract, and urogenital tract, and is also present in the stomach, tongue, esophagus, cervix, sweat glands, and prostate. CEACAM5 primarily functions as a cell adhesion molecule, mediating homo- and hetero-adhesion. It also participates in biological processes such as cell signaling and immunomodulation. In terms of signal transduction, CEACAM5 can act as a signal receptor, regulating intracellular signaling pathways and influencing cell growth, proliferation, and differentiation. In terms of immunomodulation, it can influence the activation and function of immune cells and participate in the regulation of immune responses. CEACAM5 expression levels vary in response to inflammation or tumors. For example, CEACAM5 is highly expressed on the surface of epithelial tumor cells, including those in colorectal cancer, gastric cancer, pancreatic cancer, gallbladder cancer, lung adenocarcinoma, small cell lung cancer, breast cancer, bladder cancer, and ovarian cancer, and is associated with tumor invasiveness and metastasis. Therefore, CEACAM5 is considered a broad-spectrum tumor marker that can be used to assist in the diagnosis of various tumors and help predict tumor progression, deterioration, and subclinical metastasis, providing an important basis for clinical decision-making. Furthermore, CEACAM5 is also associated with infectious diseases and is involved in the regulation of viral and bacterial infections.

[0004] Immunological assays have been widely used in the diagnosis and treatment of cancers characterized by abnormal CEACAM5 expression. Only trace amounts of carcinoembryonic antigen (CEA) are present in the serum of normal adults, typically below 5.9 ng / mL. CEACAM5 levels can also be elevated in patients with benign tumors, inflammatory conditions, and degenerative diseases, but at levels far lower than those seen in malignant tumors, typically below 20 ng / mL. Clinically, a normal CEA level is generally considered between 3.5 and 5.0 ng / mL. A level below 3.5-5.0 ng / mL is considered normal, while levels outside this range are considered abnormal. However, currently available commercially available anti-human CEACAM5 antibodies for immunological assays are all mouse-derived, exhibiting poor affinity and / or low specificity. This results in low sensitivity and, consequently, unreliable results at extremely low protein concentrations, such as ng / mL. Furthermore, even with antibodies exhibiting excellent antigen affinity, significant challenges remain in the practical application of antigen detection. For example, overlap between the antigen-binding sites of the primary and secondary antibodies in a double-antibody sandwich ELISA assay can reduce specificity and sensitivity. Therefore, it is of great significance to develop new high-performance anti-CEACAM5 antibodies suitable for immunological analysis and detection, especially for double antibody sandwich enzyme-linked immunosorbent assay. Summary of the Invention

[0005] To address the aforementioned issues in the prior art, the present invention provides two antibodies against human CEACAM5 protein, an antibody pair comprising the two antibodies, and a kit containing the antibodies or antibody pair, and their uses. The antibodies of the present invention exhibit high specificity, affinity, and good thermal stability. A double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) system developed using the antibodies can efficiently, specifically, accurately, sensitively, and reliably detect CEACAM5 protein at the ng level.

[0006] To achieve the above objectives, the present invention is specifically implemented through the following technical solutions:

[0007] In a first aspect, the present invention provides an anti-human CEACAM5 protein antibody, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity determining regions (CDRs) 1-3 of the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementarity determining regions (CDRs) 1-3 of the heavy chain variable region of the first antibody are shown in SEQ ID NOs. 8-10, respectively; and the amino acid sequences of the complementarity determining regions (CDRs) 1-3 of the light chain variable region of the second antibody are shown in SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the complementarity determining regions (CDRs) 1-3 of the heavy chain variable region of the second antibody are shown in SEQ ID NOs. 18-20, respectively.

[0008] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0009] Furthermore, the amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0010] Furthermore, the first antibody or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

[0011] The second aspect of the present invention provides a nucleic acid molecule encoding the first antibody or the second antibody as described above.

[0012] Furthermore, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

[0013] Furthermore, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

[0014] The third aspect of the present invention provides an anti-human CEACAM5 protein antibody pair, consisting of the first antibody and the second antibody as described above.

[0015] In a fourth aspect, the present invention provides a kit for detecting human CEACAM5 protein, comprising the above-mentioned anti-human CEACAM5 protein antibody or antibody pair.

[0016] Furthermore, the kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody, the second antibody serves as a detection antibody, and the second antibody is coupled with a detection label.

[0017] The advantages and positive effects of the present invention are as follows: the present invention provides two antibodies that specifically recognize and bind to the CEACAM5 protein, which have the advantages of high specificity, affinity and good thermal stability. The two antibodies bind to different antigenic epitopes of the human CEACAM5 protein. When the two antibodies are used to develop a double-antibody sandwich enzyme-linked immunosorbent assay system for detecting human CEACAM5 protein, the standard curve has good linearity and a wide detection concentration range, so that ng-level CEACAM5 protein can be detected efficiently, specifically, accurately, sensitively and reliably in blood, urine or other body fluids and cells / tissues. The system has good application prospects in the clinical diagnosis, long-term monitoring and prognosis evaluation of diseases with abnormal CEACAM5 expression, as well as in scientific research. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 A map of the vector used to construct the rabbit monoclonal antibody expression vector in Example 1 of the present invention, including, from left to right, the pRB322 vector carrying the light chain constant region and the heavy chain constant region;

[0020] Figure 2 This is an affinity curve of the antibody 2C11 binding to human CEACAM5 protein in Example 2 of the present invention;

[0021] Figure 3 This is an affinity curve of the antibody 3A11 binding to human CEACAM5 protein in Example 2 of the present invention;

[0022] Figure 4 This is a graph showing the antigen epitope recognition of human CEACAM5 protein by antibodies 2C11 and 3A11 according to Example 2 of the present invention;

[0023] Figure 5 This is the standard curve for detecting human CEACAM5 protein using a double antibody sandwich enzyme-linked immunosorbent assay system established based on antibodies 2C11 and 3A11 in Example 3 of the present invention;

[0024] Figure 6This is the standard curve of the double antibody sandwich enzyme-linked immunosorbent assay system established based on antibodies 2C11 and 3A11 in Example 4 of the present invention for detecting human CEACAM5 protein after treatment at different temperatures. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0026] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0027] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0028] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0029] The terms "include", "comprising", "containing", "having" and the like are non-limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0030] The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0031] The terms "first," "second," and the like are used to distinguish similar objects and are not necessarily used to describe a particular order or sequence, and it should be understood that such usage can be interchangeable under appropriate circumstances.

[0032] The terms "rabbit monoclonal antibody," "rabbit antibody," and "rabbit monoclonal antibody" have synonymous meanings and, unless otherwise specified, refer to rabbit antibodies that specifically bind to human carcinoembryonic antigen cell adhesion molecule 5 (CEACAM5). The modifier "rabbit" indicates that the complementarity-determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences. The terms "carcinoembryonic antigen cell adhesion molecule 5," "CEACAM5," "carcinoembryonic antigen," "CEA," "CEACAM-5," ​​and other similar terms have synonymous meanings and can be used interchangeably.

[0033] An antibody is an immunoglobulin molecule that is capable of specifically binding to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and encompasses various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and genetic or chemical modifications thereof, as long as they exhibit the desired antigen-binding activity. Antibody fragments can be one or more portions or fragments of a full-length antibody that retain the antibody's ability to specifically bind to the target antigen.

[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types: kappa (κ) and lambda (λ); heavy chains can be classified into five types: μ, δ, γ, α, and ε, which define antibodies as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of heavy and heavy chains vary greatly, while the remaining amino acid sequences are relatively constant. The regions of the light and heavy chains with the most variable amino acid sequences near the N-terminus are called the variable region (V), while the regions with relatively stable amino acid sequences near the C-terminus are called the constant region (C). The heavy chain variable region (VH) and light chain variable region (VL) are generally the most variable parts of antibodies and contain the antigen recognition site. The VH and VL regions can be further subdivided into hypervariable regions (HVRs) and framework regions (FRs). The HVRs, also known as complementarity-determining regions (CDRs), are circular structures. The heavy and light chain CDRs are closely aligned and interact with each other through the FRs, forming a surface that complements the three-dimensional structure of the target antigen or epitope. This determines the antibody's specificity and is the site of antigen recognition and binding. The FRs are the more conserved portions of the VH and VL sequences. They generally follow a β-pleated sheet configuration and are connected by three CDRs forming a connecting loop. Each VH and VL sequence typically consists of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0035] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, a cumulative of the Kabat and Chothia definitions, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define CDRs.

[0036] The light chain constant region (CL) and heavy chain constant region (CH) are not directly involved in antibody-antigen binding, but they exhibit different effector functions, such as antibody-dependent cytotoxicity. The CL length is essentially the same for different Ig types (κ or λ), but the CH length varies across Ig classes. For example, IgG, IgA, and IgD comprise CH1, CH2, and CH3, while IgM and IgE comprise CH1, CH2, CH3, and CH4. The amino acid sequences of the heavy and light chain constant regions of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0037] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "intact antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0038] Antibody fragments are one or more parts or fragments of a full-length antibody that essentially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR regions as the full-length antibody, and more preferably the same variable regions, thereby retaining complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, particularly to the same epitope. Typical examples include: Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antibody fragments can be obtained using conventional techniques in the art.

[0039] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of the heavy chain (variable and first constant regions). By proteolytic cleavage of the full-length antibody, fragments such as Fab, F(ab')2, and Fab' can be obtained. For example, IgG can be degraded into two Fab fragments and an Fc fragment by papain; and into an F(ab')2 fragment and a pFc' fragment by pepsin. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab contains the antigen-binding region and a portion of the constant region, it not only possesses the same antibody-antigen affinity and excellent tissue penetration as scFv, but also has a more stable structure.

[0040] (ii) F(ab)2: A bivalent fragment consisting of two Fabs linked by a disulfide bridge at the hinge region.

[0041] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of the intact antibody.

[0042] (iv) (Fv)2: Consists of two covalently linked Fv fragments.

[0043] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) connected by a flexible linker (typically consisting of 10-25 amino acids). It retains the antigen-binding specificity of the original antibody. The linker in this invention is not particularly limited, as long as it does not hinder the expression of the antibody variable regions connected to it. Compared to full-length antibodies, scFv has a smaller molecular weight, resulting in higher penetration and lower immune side effects.

[0044] (vi) The sc(Fv)2 fragment is composed of two heavy chain variable regions and two light chain variable regions connected by a linker or the like.

[0045] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may comprise a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may comprise amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody comprising a non-human antibody, such as a rabbit antibody, with a CDR region and a human FR region. In some cases, the variable region of a non-human antibody is combined with a constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with a FR region and a constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, which is derived from the FR sequence of a single or multiple other human antibody variable regions. In the present invention, the CDR regions in the chimeric or humanized antibodies are derived from rabbit-derived CDR regions.

[0046] The terms "monoclonal antibody" or "single antibody" and other similar terms are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies comprising the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitope on the antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0047] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer-lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0048] In order to make the above-mentioned objects and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0049] An embodiment of the present invention provides an anti-human CEACAM5 protein antibody, which is a first antibody or a second antibody, comprising a light chain variable region and a heavy chain variable region, wherein each of the light chain variable region and the heavy chain variable region comprises three complementarity determining regions (CDRs), designated as CDR1, CDR2, and CDR3, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 in the light chain variable region of the first antibody are set forth in SEQ ID NOs. 3, 4, and 5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 in the heavy chain variable region are set forth in SEQ ID NOs. 8, 9, and 10, respectively. The amino acid sequences of CDR1, CDR2, and CDR3 in the light chain variable region of the second antibody are set forth in SEQ ID NOs. 13, 14, and 15, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 in the heavy chain variable region are set forth in SEQ ID NOs. 18, 19, and 20, respectively.

[0050] This method uses B cell labeling and sorting techniques to enrich and isolate B cells capable of recognizing human carcinoembryonic antigen cell adhesion molecule 5 (CEACAM5) from the spleens of immunized rabbits. These cells are then cultured as single cells to directly produce monoclonal antibodies, eliminating the tedious steps of multiple subcloning in hybridomas. Recombinant technology is then used to express the antibody genes secreted by the monoclonal B cells, enabling large-scale production of the target antibody strain. This approach offers advantages such as a simple process, low production costs, good batch stability, and a stable and continuous supply.

[0051] The two antibodies provided herein are monoclonal antibodies that recognize and bind to the human CEACAM5 protein. They exhibit high specificity, affinity, and good thermal stability, with affinity constants of 0.0642 nM and 0.479 nM, respectively. They can effectively recognize low concentrations of the antigen, providing an ideal tool for qualitative or quantitative detection of human CEACAM5 levels by immunological methods. Furthermore, these two antibodies bind to different epitopes on the human CEACAM5 protein and were used to develop a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) assay system, using the first antibody as the capture antibody and the biotin-labeled second antibody as the detection antibody, for quantitative detection of recombinant human CEACAM5 protein. The standard curve exhibits excellent linearity and a wide detection concentration range, with a detection limit as low as 0.85 ng / mL. The assay system established by the present invention can efficiently, specifically, accurately, sensitively, and reliably detect CEACAM5 protein at the ng level in blood, urine, or other body fluids, as well as cells / tissues. It has promising applications in clinical diagnosis, long-term monitoring, prognostic assessment, and scientific research of diseases with abnormal CEACAM5 expression.

[0052] Optionally, the light chain variable region and the heavy chain variable region each include four framework regions (FRs), and the four FRs and three CDRs are arranged in a staggered order to form a variable region. The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7. The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0053] Optionally, the rabbit monoclonal antibody of the present invention further comprises a light chain constant region and a heavy chain constant region, wherein CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of an antibody is usually obtained by querying the IMGT online database.

[0054] Specifically, the amino acid sequence of the light chain (FL) of the first antibody is shown in SEQ ID NO. 1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 6. The amino acid sequence of the light chain (FL) of the second antibody is shown in SEQ ID NO. 11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 16.

[0055] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially maintains the same biological function or activity as the full-length form of the antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv and sc(Fv)2. These antigen-binding regions can be obtained by conventional techniques in the art.

[0056] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the aforementioned nucleic acid molecule, or a host cell comprising the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0057] Nucleic acid molecules can be in the form of DNA (e.g., cDNA, genomic DNA, or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be either a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be derived from the antibody amino acid sequence by conventional means, such as codon coding rules.

[0058] The full-length sequence of a nucleic acid molecule or a fragment thereof can usually be obtained by PCR amplification, recombination or artificial synthesis.

[0059] Illustratively, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

[0060] Illustratively, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

[0061] The original vector for constructing the recombinant vector is a variety of vectors conventional in the art, as long as it can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., for transferring the nucleic acid molecule into the host and multiplying it in large quantities in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technology in the art.

[0062] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy chain and light chain are expressed in different host cells, each chain can be isolated from the host cell expressing it, and the isolated heavy and light chains can be mixed and incubated under appropriate conditions to form the antibody. In other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence linked to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a different promoter, or the nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a single promoter so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0063] Conventional techniques are used to transfect or transform the recombinant vector into host cells. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl2 or MgCl2. Alternatively, transfection can be accomplished by microinjection, electroporation, or liposome packaging. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or particle bombardment to achieve gene introduction.

[0064] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (e.g., DH5α, JM109, BL21, W3110), Bacillus (e.g., Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (e.g., Salmonella typhimurium, Serratia marcescens), and Pseudomonas. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining a host cell transfected or transformed with the recombinant vector described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain purified antibodies.

[0065] In the present invention, transfection or transformation of the recombinant vector into host cells is performed using conventional techniques. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2 or MgCl2. If desired, methods such as microinjection, electroporation, or liposome packaging can also be used. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, etc.

[0066] Preferably, the recombinant vector is the expression vector pBR322, and the host cell is a human kidney epithelial (293F) cell.

[0067] Another embodiment of the present invention provides an anti-human CEACAM5 protein antibody pair consisting of the first antibody and the second antibody as described above.

[0068] The primary and secondary antibodies provided by the present invention recognize and bind to different epitopes of human CEACAM5 and can be used to pair antibodies to develop a double-antibody sandwich ELISA system or kit. The detection limit for detecting human CEACAM5 protein can reach 0.85 ng / mL, and the system has the advantages of high specificity and sensitivity, a low detection limit, a wide linear range, and high reliability.

[0069] Yet another embodiment of the present invention provides use of the above-mentioned anti-human CEACAM5 protein antibody or antibody pair in the preparation of a kit for detecting human CEACAM5 protein.

[0070] The advantages of using the anti-human CEACAM5 protein antibody or antibody pair in preparing a kit for detecting human CEACAM5 protein are the same as those of the anti-human CEACAM5 protein antibody or antibody pair described above, which will not be repeated here.

[0071] Based on the same inventive concept as above, an embodiment of the present invention further provides a kit for detecting human CEACAM5 protein, wherein the kit comprises the first antibody and / or the second antibody as described above.

[0072] It should be emphasized that the first antibody and the second antibody can be used separately, together, or in pairs. During detection, whether used separately or together, the first antibody and / or the second antibody serve as a primary antibody or capture antibody, the sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be coupled (covalently or non-covalently) to a detection label, and qualitative or quantitative detection of CEACAM5 can be achieved by analyzing the signal change generated by the detection label. In other embodiments, the anti-human CEACAM5 primary antibody is not labeled, but the detection label is coupled to a secondary antibody (as a detection antibody) or other molecule that can bind to the capture antibody. For example, if the anti-human CEACAM5 antibody is a rabbit IgG antibody, the secondary antibody can be an anti-rabbit IgG antibody, thereby generating a signal change through the coupling of the detection-labeled secondary antibody. If used in pairs, one of the two antibodies serves as the primary antibody or capture antibody, and the other serves as the secondary antibody or detection antibody.

[0073] The detection method uses common immunological methods, such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoblotting (WB), flow cytometry (FC), etc. The detection targets include recombinantly expressed human CEACAM5 protein as well as human CEACAM5 protein naturally secreted or expressed by cells / tissues. The test samples include, but are not limited to, serum, plasma, urine, cells or cell culture fluid, tissue or tissue homogenate, etc.

[0074] Preferably, the detection kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody serves as a capture antibody (or primary antibody) and the second antibody serves as a detection antibody (or secondary antibody) and is coupled with a detection label.

[0075] The detection labels for generating a recognizable signal change include, but are not limited to, biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0076] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0077] Example 1 Screening and Preparation of Rabbit Antibodies 2C11 and 3A11 Recognizing Human CEACAM5 Protein

[0078] This example uses B cell labeling and sorting technology to directly enrich and isolate B cells capable of recognizing the target antigen from the spleen of rabbits immunized with the human oncofetal protein CEACAM5. The isolated B cells are then cultured as single cells to produce monoclonal antibodies 2C11 and 3A11. Finally, the monoclonal antibodies are mass-produced using genetic engineering recombinant expression technology. Antibody sequencing was completed by Jinkairui Biotechnology Co., Ltd., and their amino acid (AA) and gene (DNA) sequences are shown in Tables 1-2, respectively. For ease of description, light chain CDR1-3 is represented by LCDR1-3, and heavy chain CDR1-3 is represented by HCDR1-3.

[0079] Table 1 Sequence information of monoclonal antibody 2C11 in this example

[0080]

[0081]

[0082] Table 2 Sequence information of monoclonal antibody 3A11 in this example

[0083]

[0084] 1. Animal Immunization: Two New Zealand white rabbits were immunized with human CEACAM5 protein (from ABclonal, Catalog No. RP01157) at a dose of 200 μg / rabbit. Prior to the first immunization, the immunogen was mixed with an equal amount of complete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple sites on the rabbit's abdomen and back. Three weeks apart, 100 μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple sites on the rabbit's abdomen and back for two booster immunizations. After three immunizations, rabbit serum samples were collected and diluted, and the titer against human CEACAM5 was determined using an ELISA. Rabbits with high serum titers were given a booster immunization with 200 μg of the immunogen injected subcutaneously at multiple sites. Three days later, the animals were sacrificed and their spleens were harvested.

[0085] 2. Isolate B cells from the spleen and perform B cell sorting: Use conventional methods to isolate B cells from the spleen, and sort out antigen-specific B cells. For related methods, please refer to the patents "Method for Efficiently Isolating Single Antigen-Specific B Cells from Spleen Cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)" and "A B Cell In Vitro Culture System and Application (Publication No.: CN111518765A, Publication Date: 2020-08-11)".

[0086] 3. Cloning of monoclonal antibody gene: The cultured rabbit B cell supernatant was used to identify positive clones by antigen-coated ELISA. The cells of positive clones were collected and lysed and then analyzed by Quick-RNA TM RNA was extracted using a MicroPrep kit (purchased from ZYMO, catalog number R1051) and reverse transcribed into cDNA. Using cDNA as a template, naturally paired antibody light chain variable regions (VL) and heavy chain variable regions (VH) were amplified from positive clones by PCR. The PCR reaction system consisted of 4 μL cDNA, 1 μL forward primer (10 mM), 1 μL reverse primer (10 mM), 12.5 μL 2× Gloria HiFi (from ABclonal, catalog number RK20717), and 6.5 μL H2O. The amplification procedure included a 98°C initial denaturation for 30 seconds, followed by 40 cycles of 98°C for 10 seconds, 64°C for 30 seconds, and 72°C for 30 seconds, followed by a final hold at 72°C for 5 minutes. The resulting reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent forward and reverse primers, respectively:

[0087] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0088] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0089] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0090] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0091] The amplified products were sequenced to obtain the variable regions of the antibodies and their encoding gene sequences. The heavy chain constant region (CH) was obtained by searching the IMGT online database (www.imgt.org) for rabbit IgG gamma C reign, and the light chain constant region (CL) was obtained by searching the rabbit IgG Kappa C reign.

[0092] 4. Production and purification of rabbit monoclonal antibodies: In order to produce antibodies on a large scale, the obtained CL and CH genes were inserted into the mammalian expression vector pBR322. The resulting vector map is shown in Figure 1 , where the pBR322 origin and f1 origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PAterminator is a tailing signal, the light chain constant is the CL gene sequence (left), and the heavy chain constant is the CH gene sequence (right). The amplified VL and VH genes were then ligated via homologous recombination with the pBR322 expression vector carrying the CL and CH genes, linearized with the XbaI and NheI restriction endonucleases, respectively, to generate complete light chain (FL) and heavy chain (FH) gene expression vectors. Sequencing verified the successful construction of the vectors.

[0093] Usually, in order to achieve secretory expression of antibodies, signal peptides need to be added to the front ends of the VL and VH genes. Signal peptides commonly used in the field can be used for antibody expression, such as the patent "Rabbit monoclonal antibody against human interferon α2 and its application (publication number: CN116063487A, publication date: 2023-05-05)" and the patent "High-affinity human IL-5 rabbit monoclonal antibody and its application (publication number: CN115819578A, publication date: 2023-03-21)". The upstream of VL has a signal peptide "MDTRAPTQLLGLLLLWLPGATF" (the encoding gene in this example is atggacacgagggcccccactcagctgctg The VH sequence is encoded by the gene "ATGACACGAGGGCCCCCACTCAGCTGCTGGGTTTGCTCCTGCTGTGTTACCCGCTGT", and the VH sequence has a signal peptide "METGLRWLLLVAVLKGVQC" (the gene encoding the gene is "ATGAGACTGGCTGCGCTGGCTTCTCCT ggttgccgttttgaaaggtgtgcaatgt or "ATGAGACTGGCTGCGCTGGCTTCTCTCTGCTGCTGAAGGAGTGCAGTGC"). Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not reflected in the antibody sequence of Table 1-2 of this embodiment.

[0094] The successfully constructed expression vectors containing FL and FH genes were co-transfected into 293F cells and cultured for 72-96 hours after transfection. The culture supernatant was collected and a recombinant rabbit monoclonal antibody that recognized human CEACAM5 was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, catalog number SA023100).

[0095] Example 2 Performance testing of antibodies 2C11 and 3A11

[0096] 1) Identification of Antibody Affinity: Antibody affinity was determined by measuring antigen-antibody binding curves using the Gator Biomolecular Interaction Analyzer from Probe Life. First, the antibody was immobilized on a Pro1 probe (purchased from GatorBio, Cat. No. 160009) at a concentration of 3 μg / mL. The probe was then placed in 5.26 μg / mL and 5.99 μg / mL human CEACAM5 solutions, respectively, to allow antigen binding. Affinity curves for antibodies 2C11 and 3A11 were obtained, as shown in Figure 2. Figure 2-3 , where the ordinate represents the change in the thickness of the conjugate after the probe binds to the antibody and protein, the abscissa represents the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants calculated by curve fitting are shown in Table 3, where the dissociation coefficient K off The constant that characterizes the dissociation rate between antibody and antigen, the binding coefficient K on A constant that characterizes how quickly an antibody binds to its target, the affinity constant K D K off / K on The ratio of , which characterizes the dissociation equilibrium constant between antibody and antigen.

[0097] Table 3 Affinity-related parameter determination results of monoclonal antibodies 2C11 and 3A11

[0098] Monoclonal antibodies <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M) <!-- 11 -->]]> 2C11 <![CDATA[6.79×10 -5 ]]> <![CDATA[1.06×10 6 ]]> <![CDATA[6.42×10 -11 ]]> 3A11 <![CDATA[2.09×10 -4 ]]> <![CDATA[4.36×10 5 ]]> <![CDATA[4.79×10 -10 ]]>

[0099] The dissociation equilibrium constants of antibodies 2C11 and 3A11 against human CEACAM5 protein were 0.0642 nM and 0.479 nM, respectively, demonstrating excellent affinity.

[0100] 2) Identification of antigen recognition epitopes: The obtained antibodies were paired using the Gator biomolecular interaction analyzer from Probe Life. First, human CEACAM5 protein was immobilized on the Pro1 probe at a concentration of 3 μg / mL. The probes with the immobilized antigen were then placed in a 3 μg / mL solution of antibody 2C11 to allow antibody 2C11 (as the first antibody) to bind to the antigen until saturation. The probes were then placed in a 3 μg / mL solution of antibody 3A11 to allow antibody 3A11 (as the second antibody) to bind to the antigen. The antibody recognition epitopes were identified by analyzing the binding characteristics of different antibodies on the antigen. The results are shown in the table. Figure 4 , where the ordinate represents the change in thickness of the complex after the probe binds to the antibody and protein, and the abscissa represents the binding time.

[0101] The results showed that the probe immobilized with human CEACAM5 could significantly bind to 3A11 after binding to 2C11, confirming that the two antibodies recognized and bound to different epitopes on human CEACAM5 and could be used as paired antibodies for double antibody sandwich enzyme-linked immunosorbent assay.

[0102] Example 3 Establishment of a double-antibody sandwich ELISA system based on antibodies 2C11 and 3A11 and its analytical sensitivity

[0103] Biotinylation of Antibody 3A11: Prepare a 1 mg / mL 3A11 solution and a 60 mg / mL NHS-LC-biotin solution. Add 10 μL of the 60 mg / mL NHS-LC-biotin solution to 200 μL of the 1 mg / mL 3A11 solution, mix well, and incubate at room temperature for 30 minutes. Then, add 50 μg of 500 mM Tris solution (pH 9.0) to terminate the reaction. Finally, add a large amount of 1× PBS buffer (pH 7.4) and centrifuge using a spin column with a size exclusion limit of 30 kD to remove excess biotin molecules and equilibrate the buffer system to obtain biotin-labeled 3A11 antibody (3A11-biotin).

[0104] Antibody 2C11 was used as the capture antibody and antibody 3A11-biotin was used as the detection antibody to establish a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system. The steps are as follows: 1) Coating with capture antibody 2C11: Antibody 2C11 was diluted to 2 μg / mL with 1× PBS and added to a 96-well microplate at 100 μL / well. The plate was covered with a cover film and incubated at 4°C for 16-20 h; 2) Washing: After the incubation was completed, the liquid in the wells was discarded, and the plate was washed once with 1× PBST. 300 μL of sample was added, and the sample was allowed to stand for 40 s before the liquid in the wells was discarded; 3) Blocking: Blocking solution (1× PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20 and 0.1% proclin) was added at 200 μL / well. 300, pH 7.2) into the microplate, cover with a cover film, block at 37°C for 2 hours, discard the blocking solution after blocking, and place in a 37°C oven to dry for 0.5-2 hours; 4) Add antigen protein: human CEACAM5 protein was diluted with diluent (1× PBS containing 2% BSA, 0.05% Tween 20 and 0.1% proclin 300, pH 7.2) Dilute to the following concentrations: 100, 50, 25, 12.5, 6.25, 3.125, 1.5625, and 0 ng / mL, then add 100 μL / well to the microplate, cover with a cover film, and incubate at 37°C for 2 h; 5) Wash the plate: Same as step 2); 6) Add detection antibody 3A11: Dilute the biotin-labeled antibody 3A11 (3A11-biotin) to 0.01 μg / mL, then add 100 μL / well to the microplate, cover with a cover film, and incubate at 37°C for 1 h; 7) Wash the plate: Same as step 2); 8) Add SA-HRP: Add 100× SA-HRP (horseradish peroxide 10) Add TMB colorimetric solution: Add 3,3',5,5'-tetramethylbenzidine (TMB) colorimetric solution (purchased from Tetramethylpyridamole, product number 4ATMB1000) to the microplate at 100 μL / well, cover with cover film, and incubate at 37°C for 15 min; 11) Read: Remove the microplate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and read immediately using a microplate reader.

[0105] The concentration of human CEACAM5 protein was used as the horizontal axis, and the corrected value of absorbance was ΔOD (ΔOD = OD 450nm -OD 630nm ) is the vertical axis, see Figure 5The results showed that paired antibodies 2C11 and 3A11 demonstrated excellent linearity for the detection of human CEACAM5, ensuring high accuracy and reliability. The sensitivity of the assay was calculated using the average absorbance of 16 dilution blank wells and an absorbance signal greater than three times the average of the blank control absorbance as the sensitivity. (See Table 4) The detection limit was 0.85 ng / mL, demonstrating high sensitivity.

[0106] Table 4 Sensitivity of the double-antibody sandwich ELISA method based on antibodies 2C11 and 3A11

[0107]

[0108]

[0109] Example 4 Establishment of a double-antibody sandwich ELISA system based on antibodies 2C11 and 3A11 and thermal stability test

[0110] The detection system formed by the enzyme labeling plate coated with the capture antibody, human CEACAM5, and 100× concentrated detection antibody was sealed and stored at -20°C and 37°C respectively. After 7 days, the plate was taken out and tested according to the double antibody sandwich ELISA established in Example 3. The standard curves obtained under different storage temperatures are shown in FIG. Figure 6 and Table 5, with antibodies stored at -20°C as the reference value.

[0111] Table 5 Standard curves of antibodies 2C11 and 3A11 for detecting human CEACAM5 protein at different storage temperatures

[0112]

[0113] The results showed that the coefficient of variation of antibodies 2C11 and 3A11 in detecting human CEACAM5 protein concentration after treatment at -20℃ and 37℃ for 7 days was less than 15%, indicating that they have strong thermal stability.

[0114] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An antibody against human CEACAM5 protein, characterized in that: Selected from the first antibody or the second antibody, wherein: The amino acid sequences of the complementary determining regions CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 8-10, respectively; The amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the complementary determining regions CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 18-20, respectively.

2. The anti-human CEACAM5 protein antibody according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The anti-human CEACAM5 protein antibody according to claim 2, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The anti-human CEACAM5 protein antibody according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the first antibody or the second antibody as described in any one of claims 1 to 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO. 24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is shown in SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

8. An anti-human CEACAM5 protein antibody pair, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A kit for detecting human CEACAM5 protein, characterized in that: The kit comprises the anti-human CEACAM5 protein antibody according to any one of claims 1 to 4 or the anti-human CEACAM5 protein antibody pair according to claim 8.

10. The kit for detecting human CEACAM5 protein according to claim 9, characterized in that: The kit is a double antibody sandwich enzyme-linked immunosorbent assay kit, comprising a first antibody and a second antibody, wherein the first antibody is a capture antibody and the second antibody is a detection antibody coupled with a detection label.

Citation Information

Patent Citations

  • Method for efficiently separating single antigen-specific B lymphocyte from spleen cells

    CN110016462A

  • B lymphocyte in vitro culture system and applications thereof

    CN111518765A

  • High-affinity Human IL-5 rabbit monoclonal antibody and application thereof

    CN115819578A

  • Anti-human interferon alpha 2 rabbit monoclonal antibody and application thereof

    CN116063487A

  • Cells for immunotherapy engineered for targeting antigen present both on immune cells and pathological cells

    CN106029875A