Bacteroides simplex with porcine epidemic diarrhea virus resisting activity and application thereof

Abstract

The invention relates to the technical field of biology, and aims to provide bacteroides simplex with porcine epidemic diarrhea virus resisting activity and application of the bacteroides simplex. The strain is preserved in the China Center for Type Culture Collection (CCTCC), the preservation name is Bacteroides simplex ZJNB01, the Latin name is Bacteroides uniformises, and the preservation number is CCTCC NO: M 20241757. The swine source bacteroides simplex disclosed by the invention has remarkable probiotic characteristics; due to rapid growth, the strain has relatively strong porcine epidemic diarrhea virus resistance. The bacteroides simplex and / or the metabolite thereof can be used as a pharmaceutical active center for preparing a pharmaceutical agent, and has a wide application prospect in the aspect of preventing and treating the porcine epidemic diarrhea virus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a strain of Bacteroides monomorpha with anti-porcine epidemic diarrhea virus function and application thereof. Background Art

[0002] Various epidemic diseases are one of the most important factors restricting the healthy development of the pig farming industry. In particular, porcine diarrhea caused by porcine epidemic diarrhea virus (PEDV) is the most serious, causing huge direct economic impacts every year. PEDV causes acute diarrhea, vomiting, dehydration, etc. in piglets, with a mortality rate of up to 100%. As an animal coronavirus, PEDV has the characteristics of frequent mutations, resulting in the repeated emergence of new mutant strains, resulting in poor cross-protection of existing vaccines. In view of the breeding model adopted by the modern industry, new green and safe requirements have been put forward for the prevention and control strategy of porcine enteric coronavirus, and it is urgent to carry out the research and development of new natural antiviral drugs.

[0003] The intestinal microecology is composed of a large number of bacteria, fungi, viruses and their environment. Intestinal microorganisms restrict and depend on each other, and jointly maintain the stability of the intestinal microecology, which is crucial for the body to resist intestinal pathogens. Existing research results show that oral Bacteroides uniformis has good safety and is an intestinal probiotic with good development and application prospects. However, the existing uses of oral Bacteroides uniformis are still mainly in improving the intestinal environment, enhancing the intestinal mucosal barrier function, and promoting the development of the immune system.

[0004] So far, there are no reports on the research results of using Bacteroides monocytogenes for antiviral (especially PEDV) research. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a strain of Bacteroides monomorpha having anti-porcine epidemic diarrhea virus activity and its application.

[0006] In order to solve the above technical problems, the solution adopted by the present invention is:

[0007] A strain of Bacteroides uniformis having anti-porcine epidemic diarrhea virus activity is provided, and the strain is deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan City, Hubei Province, zip code 430072, contact number 027-68754052). The deposited name of the strain is Bacteroides uniformis ZJNB01, and the Latin name is Bacteroides uniformis. The deposit number is CCTCCNO: M 20241757, and the deposit date is August 7, 2024.

[0008] In the present invention, the Bacteroides monomorpha is isolated from healthy pig feces.

[0009] In the present invention, the 16S rRNA gene sequence of the Bacteroides monocytogenes is shown as SEQ ID NO: 1.

[0010] The present invention further provides an application method of the aforementioned Bacteroides monocytogenes, which is to use the Bacteroides monocytogenes and / or its metabolites as active ingredients for preparing pharmaceutical preparations.

[0011] The present invention also provides a drug with anti-porcine epidemic diarrhea virus function, wherein the active ingredient of the drug is the Bacteroides monomorpha and / or its metabolites according to any one of claims 1 to 3, and the content of the active ingredient in the drug is 1×10 8 cfu / mL; the dosage of the drug is 3mL / time.

[0012] In the present invention, the dosage form of the drug is a suspension or an oral solution.

[0013] Compared with the prior art, the technical effects of the present invention are:

[0014] 1. The porcine-derived Bacteroides monomorpha described in the present invention has significant probiotic properties; due to its rapid growth, it has a strong ability to resist porcine epidemic diarrhea virus.

[0015] 2. The Bacteroides monomorpha and / or its metabolites described in the present invention can be used as drug active centers to prepare pharmaceutical agents, and have broad application scenarios in the prevention and treatment of porcine epidemic diarrhea virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Colony morphology of porcine Bacteroides monomorpha ZJNB01;

[0017] Figure 2 Gram staining microscopic examination of porcine Bacteroides monomorpha ZJNB01 under 100x oil microscope;

[0018] Figure 3 Electron microscopic particle image of Bacteroides monomorpha ZJNB01 from pig;

[0019] Figure 4 Genetic evolution analysis of 16S rRNA of Bacteroides monomorpha ZJNB01 from pigs;

[0020] Figure 5 Growth curve of porcine Bacteroides monomorpha ZJNB01;

[0021] Figure 6 Cytotoxicity test results of porcine Bacteroides monomorpha ZJNB01;

[0022] Figure 7The result of PEDV infecting Vero cells to produce cytopathic effects; A is the normal morphology of Vero cells; B is the morphology of Vero cells with cytopathic effects;

[0023] Figure 8 The results of the determination of the effect of swine-derived Bacteroides monotheca ZJNB01 on the expression of PEDV N protein; A is the Western Blot detection of the expression content of the viral N protein; B is the grayscale analysis of the viral N protein;

[0024] Fig. 9 The results of the determination of the inhibition of PEDV replication by the swine-derived Bacteroides monotheca ZJNB01; A is the fluorescence intensity and distribution of viral N protein expression observed by indirect immunofluorescence; B is a bar graph analyzing the viral fluorescence expression rate;

[0025] Fig.10 Results of the determination of the effects of the metabolites and bacteria of the porcine Bacteroides monotheca ZJNB01 on the expression of PEDV N protein; A. Western Blot detection of viral N protein expression; B. Grayscale analysis of viral N protein;

[0026] Fig.11 Immunofluorescence assay results of porcine Bacteroides monotheca ZJNB01 metabolites against PEDV infection; A is the fluorescence intensity and distribution of viral N protein expression observed by indirect immunofluorescence; B is a bar graph analyzing the viral fluorescence expression rate;

[0027] Fig.12 The results of the determination of PEDV titer by the metabolites of porcine Bacteroides monocytogenes ZJNB01.

[0028] Fig.13 Observation of the effects of PEDV on intestinal tissues of piglets by the metabolites of porcine Bacteroides monocytogenes ZJNB01.

[0029] Fig.14 Determination of the viral load of PEDV in piglets by the metabolites of porcine Bacteroides monocytogenes ZJNB01. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are described in detail below in conjunction with the accompanying drawings.

[0031] 1. Sources of experimental materials and reagents in the embodiments of the present invention

[0032] 1.1 Fecal samples and viruses

[0033] In the following examples, fresh domestic pig feces samples used to extract the ZJNB01 strain of Bacteroides monothecae were collected from a pig farm in Ningbo, Zhejiang Province. The porcine epidemic diarrhea virus used as the test object was the PEDV ZQ2022 strain, the original strain of which (GenBank accession no. OR061129) was isolated and identified by the Animal Preventive Medicine and Public Health Laboratory, College of Animal Science and Technology, College of Veterinary Medicine, Zhejiang A&F University; the living samples stored in the laboratory were used in this example.

[0034] 1.2 Cell lines and culture

[0035] Vero cells were cultured in DMEM medium containing 10% FBS and subcultured when they grew into monolayer adherent cells. During subculture, they were digested with 0.25% trypsin containing 0.02% EDTA, which took about 2 minutes to digest completely. The specific steps are as follows: select a well-growing Vero cell monolayer, discard the old culture medium, wash the cells twice with 1×PBS (pH=7.2) buffer to remove the residual old culture medium; add 1mL of 0.25% trypsin-EDTA digestion solution into the bottle, shake gently to make the digestion solution flow over all cell surfaces, and place in an incubator for digestion; observe under a microscope, when the cells become obviously round, the cell gaps increase, and the cell monolayer appears misty, immediately pour out the digestion solution and add 1mL of DMEM culture solution containing 10% FBS to terminate digestion; use a pipette to absorb the culture solution in the bottle, repeatedly blow and beat the cells to make them detach from the wall and disperse them to form a cell suspension; distribute the cell suspension into a new culture bottle, and add a certain amount of DMEM culture solution with 10% FBS to make the total volume up to 5mL; shake gently to make the cells evenly distributed, cover the bottle cap, and return to the cell culture incubator for culture.

[0036] 1.3 Main Reagents

[0037] Brain heart infusion (BHI) medium (HB8297-1), anaerobic gas generation bag, anaerobic culture bag and Gram stain kit were purchased from Qingdao Haibo Biotechnology Co., Ltd.; bacterial genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; DNA Marker DL2000 and Taq DNA polymerase were purchased from Kangwei Century Biotechnology Co., Ltd.; DMEM high glucose medium, trypsin and fetal bovine serum (FBS) were purchased from Gibico, USA; PBS buffer (pH 7.2-7.4) and GAPDH antibody were purchased from Sigma-Aldrich, USA; polyclonal antibody of PEDV N protein was provided by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences; 4% paraformaldehyde, skim milk powder and donkey anti-mouse immunoglobulin G (IgG) were purchased from Shanghai White Shark Biotechnology Co., Ltd.; 10% PAGE gel ultra-fast preparation kit, 5× protein loading buffer, PVDF membrane, and protein pre-stained marker were purchased from Beijing Solebow Company; Western cell lysis buffer, CCK-8 kit, and BCA protein concentration determination kit were purchased from Shanghai Bio-Tech Biotechnology Co., Ltd.

[0038] Unless otherwise specified, other reagents or materials were obtained from commercial sources.

[0039] 2. Isolation and identification of Bacteroides monomorpha from pigs

[0040] 2.1 Isolation and purification of porcine Bacteroides monomorpha

[0041] Fresh fecal samples were collected from healthy sows. Under sterile conditions, 1 g of fecal sample was added to 9 mL of sterile saline, shaken thoroughly, centrifuged at 10,000 rpm / min for 10 min at 4 °C, and the supernatant was diluted to 10 -4 , 10 -5 , 10 -6 . After the BHI medium is prepared and sterilized, pour it into a plate. After it solidifies, take 100 μL of sample dilutions of different gradients and apply them to the plate, number and record them, and invert them in a 37°C incubator for anaerobic culture for 48 hours. Pick colonies with typical morphology and streak them on the BHI agarose plate for purification three times. Pour the BHI liquid culture medium into a special anaerobic vial, seal it after filling it with nitrogen, sterilize it at high temperature, pick the purified single colony and inoculate it into the BHI liquid culture medium, and culture it anaerobically at 37°C for 48 hours. The strain ZJNB01 was successfully obtained, and glycerol (final concentration of 25%) was added and stored in an ultra-low temperature refrigerator at -80°C. The pH value of the culture medium is preferably 7.2±0.2.

[0042] 2.2 Morphological identification of Bacteroides monomorpha from pigs

[0043] The isolated strains were activated and 100 μL of 10-6 , 10 -7 , 10 -8 The diluted bacterial solution was spread on BHI solid culture medium, placed in a culture bag containing an anaerobic gas production bag, and placed in a 37°C incubator for anaerobic culture for 48 hours, and the bacterial colony growth morphology was observed every day. A single colony was picked on a slide, a small drop of sterile water was added, and it was fixed on an alcohol lamp, and then the smear was stained with crystal violet, mordanted with iodine solution, decolorized with 95% ethanol, and counterstained with safranin solution in sequence, and the morphology of the bacteria was observed under an oil microscope. A single colony was inoculated into a special anaerobic vial containing BHI liquid culture medium. After anaerobic culture at 37°C for 48 hours, the vial was centrifuged at 8,000 rpm for 5 minutes, the supernatant was discarded, the bacteria were resuspended in PBS buffer, and the cells were washed by repeated centrifugation for 3 times. A 2.5% glutaraldehyde solution was added thereto for fixation for 2 hours, and the cells were sent to Wuhan Saiweier Biotechnology Co., Ltd. for scanning electron microscopy. The specific operation steps were as follows: the bacteria were rinsed with 0.9% NaCl solution, repeated twice for 15 minutes each time, and then fixed with 1% osmic acid for a second time for 2 hours. After dehydration with 20%, 50%, 80% and 100% gradient concentrations of ethanol solution, critical point drying treatment and ion bond gold treatment were performed, and the bacteria were observed under a scanning electron microscope.

[0044] The colony morphology of the isolated strain ZJNB01 on the BHI agarose plate is as follows Figure 1 As shown, it is grayish white, semi-transparent, round, convex in the middle, with a smooth and bright surface and neat edges. Gram staining microscopy showed that it was a negative bacterium, with blunt ends, single distribution, rod-shaped, and no spores ( Figure 2 ), which is consistent with the basic morphology of Bacteroides monomorpha. In addition, scanning electron microscopy revealed that the strain ZJNB01 had thin, wavy filaments attached to its body, namely flagella ( Figure 3 ).

[0045] 2.3 PCR identification of Bacteroides monomorpha from pigs

[0046] The genomic DNA of the strain ZJNB01 isolated above was extracted according to the steps of the bacterial DNA extraction kit, and the genomic DNA was used as a template to amplify the 16S rRNA gene of the strain using universal primers 27F (5′AGAGTTTGATCCTGGCTCAG 3′) and 1492R (5′TACGGTTACCTTGTTACGACTT3′). The PCR reaction system was 12.5 μL of Taq DNA polymerase, 0.5 μL of upstream and downstream primers, 3 μL of DNA template, and ddH 2O 8.5μL, and the amplification conditions were: pre-denaturation at 95℃ for 5min; 95℃ for 30s, 56℃ for 30s, 72℃ for 90s for a total of 35 cycles, and annealing and extension at 72℃ for 10min. 6μL of PCR product was drawn and tested by 1% (w / v) agarose gel electrophoresis, and the remaining PCR product was sent as a sample to Hangzhou Youkang Biotechnology Co., Ltd. for sequencing. The sequence was aligned to the NCBI database (https: / / blast.ncbi.nlm.nih.gov), and the phylogenetic tree was established using MEGA11 software to analyze the genetic evolution.

[0047] By performing PCR amplification and sequencing on strain ZJNB01, a 16S rRNA gene sequence of about 1500 bp was obtained, and the gene sequence is shown in SEQ ID NO: 1:

[0048]

[0049] The BLAST comparison showed that the sequence had the highest homology with Bacteroides uniformis (B. uniformis). The genetic evolutionary tree constructed based on the sequence and the reference sequence was as follows: Figure 4 As shown, the isolated strain ZJNB01 had the closest homology to the 16Sr RNA of Bacteroides monotheca NB-14 (ID: AB117564.1), Bacteroides monotheca NB-13 (ID: AB117563.1), Bacteroides monotheca JCM 5828 (ID: NR_040866.1), Bacteroides monotheca mat-344 (ID: AB215084.1), Bacteroides monotheca JCM5828 (ID: NR_112945.1) and Bacteroides monotheca 23-18 (ID: AB247142.1) in GenBank in NCBI, and the strain was determined to be Bacteroides monotheca and named ZJNB01.

[0050] In addition, the applicant sent Bacteroides monocytogenes ZJNB01 to the China Center for Type Culture Collection for preservation on August 7, 2024, and its survival status is alive; its preservation number is CCTCC NO: M 20241757; the preservation address is the Wuhan University Collection Center, Wuhan City, Hubei Province; the postal code is 430072, and the contact number is 027-68754052.

[0051] 3. Study on the biological characteristics and anti-PEDV characteristics of porcine Bacteroides monomorpha

[0052] In this example, GraphPad Prism 8.0.2 was used to test whether the data obeyed normal distribution and draw relevant bar graphs. All data were expressed as "mean ± standard error (Means ± SEM)". When P < 0.05, it means that there is a significant difference between the two groups.

[0053] 3.1 Growth curve determination of porcine Bacteroides monomorpha ZJNB01

[0054] After the activated strain was activated and cultured in BHI liquid medium for 48 hours, it was inoculated into several 10mL sterile anaerobic tubes containing 5mL BHI liquid medium at a 2% inoculum and cultured at 37°C. From 0h to 72h, one tube was taken out every four hours, and its optical density value at OD 600nm was measured using a specific instrument, and its growth curve was drawn with OD value as the ordinate and time as the abscissa.

[0055] The results are as follows Figure 5As shown, the strain was in the sluggish phase from 0 to 28 h; in the logarithmic growth phase from 28 to 44 h, strain ZJNB01 showed a rapid growth trend; 44 to 60 h was the growth stable phase, and OD 600 The value (0.40±0.01) reached the highest point, and entered the senescence stage after 60h. The above showed that the ZJNB01 strain reached a relatively stable number after 48h of anaerobic culture, which can be used for subsequent experimental research.

[0056] 3.2 Cytotoxicity test of porcine Bacteroides monotheca ZJNB01

[0057] Dilute the Vero cell suspension to a concentration of 5 × 10 3 Cells / mL were inoculated into 96-well cell culture plates, 100 μL was added to each well, and incubated at 37°C and 5% CO 2 Culture in a constant temperature incubator for 24 hours, discard the old culture medium, and wash twice with 1× PBS buffer. Take 2 mL of the culture medium of Bacteroides monotheca ZJNB01 and dilute it in a 2-fold gradient, selecting 1, 1 / 2, 1 / 4, 1 / 8, 1 / 16, 1 / 32 and 1 / 64 dilutions. Add 100 μL of bacterial culture medium of different dilutions to each well of the treatment group, and repeat 5 times for each dilution. Place at 37°C and 5% CO 2 Incubate in a constant temperature incubator for 12 hours, and set up a cell control. Add 10 μL of CCK-8 solution to each well and continue to culture in a cell incubator for 2 hours. Before reading the plate, gently shake it on a shaker and measure the absorbance at 450 nm using an enzyme reader. According to the formula: Cell viability = (OD of treatment group 450 -Blank group OD 450 ) / (control group OD 450 -Blank group OD 450 )×100%, to evaluate the toxicity of Bacteroides monocytogenes ZJNB01 to cells.

[0058] The results are as follows Figure 6 As shown, the undiluted ZJNB01 culture fluid has high cytotoxicity, and its cell survival rate is only 11%; when the dilution is 1 / 2, 1 / 4, 1 / 8, 1 / 16, 1 / 32 and 1 / 64, the survival rate of Vero cells is above 90%. It can be seen that the safe concentration range of ZJNB01 culture fluid in in vitro cells is 1 / 2 to 1 / 64, which clearly shows that the bacterial culture fluid with a dilution of 1 / 2 is the maximum safe concentration.

[0059] 3.3 PEDV virus proliferation and virus titer determination

[0060] Dilute the Vero cell suspension to a concentration of 5 × 10 5 5 mL was inoculated into a T25 cell culture flask and placed at 37°C and 5% CO.2 50 μL of PEDV ZQ2022 virus solution was mixed with 1 mL of serum-free inoculation medium (DMEM medium containing 0.4% trypsin) and inoculated into Vero cells. The cell culture flask was incubated at 37°C and 5% CO. 2 Incubate in a constant temperature incubator for 1 hour, add 4 mL of virus-inoculated culture medium, continue to culture for 24-48 hours, and observe the cell status every day. When more than 80% of the cells show pathological changes, place the bottle containing the virus liquid cell in a -80℃ refrigerator, freeze and thaw three times repeatedly to completely break the cells to release the virus, centrifuge the harvested virus suspension at 4,000rpm for 10 minutes to remove cell debris, collect the supernatant of the virus liquid, and store it at -80℃ for later use after aliquoting.

[0061] The Reed-Muench method was used to calculate the virus titer (TCID 50 / mL), the specific steps are as follows: a concentration of 1×10 5 Vero cells with a concentration of 1 cell / mL were inoculated into a 96-well plate, and 100 μL was added to each well. When the cell confluency reached 90%, the PEDV ZQ2022 virus solution was diluted 10 times to 10 in a 1.5 mL sterile centrifuge tube with inoculation medium. -7 ; The diluted virus solution was inoculated into a 96-well plate at 100 μL / well, and 8 replicate wells were added to each gradient. At the same time, 8 wells inoculated with the same amount of virus-infected culture medium were set as controls. The plates were placed at 37°C and 5% CO 2 Culture in a constant temperature incubator for 5 days; observe and record the cytopathic effect (CPE) every day, and calculate the TCID of PEDV virus solution according to the Reed-Muerch method 50 .

[0062] In order to determine the infection ability of PEDV ZQ2022 on Vero cells, the virus solution was inoculated into Vero cells, and a cell control group without virus solution was set up and placed at 37°C and 5% CO 2 Culture in a constant temperature incubator for 24-48 hours and observe the cell status every day. The morphology of normal Vero cells is as follows Figure 7 As shown in A, the cells are evenly distributed, compact in density, with clear boundaries and in good condition; however, PEDV-infected Vero cells produce obvious lesions ( Figure 7 B), the cell boundaries in the lesion area are blurred, the cells are rounded, fused, and broken, and the cell debris floats in the culture medium. The Reed-Muench method was further used to calculate that the toxicity of PEDV ZQ2022 strain in Vero cells was 10 5.875 TCID 50 The above results indicate that PEDV ZQ2022 virus particles can infect Vero cells.

[0063] 3.4 Detection of the effect of Bacteroides monocytogenes ZJNB01 strain on viral N protein expression by Western Blot

[0064] In order to explore the effect of swine-derived Bacteroides monotheca ZJNB01 on PEDV replication, in this example, Western Blot and indirect immunofluorescence were used to detect the expression level of PEDV N protein in the ZJNB01 bacterial solution treatment group and the control group.

[0065] The concentration was 1×10 5 Vero cells with a concentration of 1 cell / mL were inoculated into a twelve-well cell culture plate, and 1 mL was added to each well. When the cell growth confluence reached 100%, the old culture medium was discarded and the cells were washed twice with 1× PBS buffer; 500 μL of the culture medium of Bacteroides monomorphum ZJNB01 with a dilution of 1 / 2 and 500 μL of the inoculated culture medium containing MOI=0.01 PEDV ZQ2022 virus solution were mixed in a 1.5 mL sterile centrifuge tube and inverted to mix; 1 mL of the mixed solution was inoculated into the monolayer Vero cells of the twelve-well plate and placed at 37°C and 5% CO 2Culture in a constant temperature incubator for 12 hours; discard the old culture medium, wash the cells twice with PBS buffer, add 100μL RIPK cell strong lysis buffer and 1μL protease inhibitor, place on an ice box for lysis for 10 minutes, scrape the cells at the bottom of the well with a disposable cell scraper into a 1.5mL sterile centrifuge tube, continue to blow with a pipette for 2 minutes to fully lyse, centrifuge at 12000rpm for 10 minutes at 4℃, carefully pipette the supernatant into another pre-cooled 1.5mL sterile centrifuge tube, and bury on ice for protein concentration determination. At the same time, set up a control group inoculated with an equal volume of BHI liquid culture medium. Afterwards, the protein concentration of the sample was detected according to the steps of the BCA protein concentration determination kit, and the final concentration of the sample was adjusted to 2 μg / μL with 5× protein loading buffer and PBS buffer, and it was placed in a 100°C metal bath for 10 minutes and then used for SDS-PAGE gel protein electrophoresis. The specific operation steps were: prepare the separation gel and the concentrated gel respectively according to the steps of the 10% PAGE gel ultra-fast preparation kit, add them to the installed gel making device, and insert the comb; after the concentrated gel solidifies, put in 1×SDS electrophoresis solution, pull out the comb, add 8 μL of the above protein sample and Marker to the well, adjust the electrophoresis instrument to 80V, and adjust the voltage to 120V when the protein sample swims to the separation gel; swim to the bottom of the separation gel, select the area according to the size of the marker, and use the dry transfer method for transfer; after the transfer is completed, put the PVDF membrane in 5% skim milk for 2 hours; use 1×TBST buffer to wash 5 times on a shaker for 10 minutes each time to remove excess skim milk, and mix it with PEDV The primary antibody of N protein (1:1500) was incubated at 4°C overnight; washed three times with 1×TBST buffer, 10 min each time, and incubated with donkey anti-mouse secondary antibody (1:1000) in a 37°C constant temperature incubator for 1 h; washed three times with 1×TBST buffer, developer was added to the PVDF membrane, the image was observed, and grayscale analysis was performed using Image J to calculate the difference in PEDVN protein expression between the treatment group and the control group.

[0066] Western Blot test results Figure 8 As shown, compared with the control group, the expression level of PEDV N protein in the Bacteroides monocytogenes ZJNB01 culture fluid treatment group was lower. Grayscale analysis showed that the grayscale value of viral N protein in the treatment group was 0.14, which was significantly lower than that in the control group (P < 0.05). Indirect immunofluorescence observation found that all cell nuclei in the two groups were stained blue by DAPI, there was no green fluorescence in the Mock group, and there were multiple specific green fluorescence in the control group, while the fluorescence intensity in the treatment group decreased and the distribution weakened. According to statistics, the fluorescence expression rate of the treatment group was 20.66%, which was significantly lower than that of the control group (P < 0.05) ( Fig. 9). The above data show that the ZJNB01 strain can inhibit the expression of PEDV N protein in cells in vitro, thus clarifying the inhibitory effect of swine-derived Bacteroides monotheca ZJNB01 on PEDV replication.

[0067] 3.5 Indirect immunofluorescence assay to detect the effect of Bacteroides monocytogenes ZJNB01 strain on PEDV replication

[0068] Referring to the experimental method in step 3.4, after the ZJNB01 culture medium and the virus solution were co-incubated in ST cells for 12 hours, the old culture medium was discarded, the cells were washed 3 times with 1×PBS buffer, and 500 μL of 4% paraformaldehyde fixative was added thereto, and fixed at room temperature for 30 minutes; the fixative was discarded, the cells were washed 3 times with 1×PBS buffer, 500 μL of 0.5% Triton-X-100 solution was added, and the cells were allowed to stand at room temperature for 20 minutes for permeabilization; the permeabilization solution was discarded, the cells were washed 3 times with 1×PBS buffer, 500 μL of 5% BSA solution was added, and the cells were allowed to stand at room temperature for 30 minutes for blocking; 500 μL of the primary antibody of PEDV N protein (1:500) was added thereto, and the cells were incubated at 37°C, 5% CO 2 Block in a constant temperature incubator for 2 hours; discard the primary antibody, wash 3 times with 1×PBS buffer, add 500μL donkey anti-mouse secondary antibody (1:1000), and incubate in a 37°C, 5% CO2 constant temperature incubator in the dark for 1 hour; discard the secondary antibody, wash 3 times with 1×PBS buffer, add 500μL DAPI staining solution, and stain at room temperature in the dark for 5 minutes; wash 3 times with 1×PBS buffer, observe the fluorescence phenomenon under a fluorescent inverted microscope, and collect photos. At the same time, set up a control group inoculated with an equal volume of BHI liquid culture medium.

[0069] 4. Study on the biological characteristics and anti-PEDV virus properties of porcine Bacteroides monomorpha metabolites

[0070] 4.1 Metabolites and bacterial cell preparation of Bacteroides monocytogenes strain ZJNB01

[0071] Preparation of metabolites of Bacteroides monotheca ZJNB01 strain: The concentration of the bacterial suspension of Bacteroides monotheca ZJNB01 strain was adjusted to 1×10 8 cfu / mL; after centrifugation at 3,000×g for 10 min, the supernatant was filtered through a 0.22 μm filter, and the filtered suspension was the metabolite of Bacteroides monotheca ZJNB01 strain.

[0072] Preparation of Bacteroides monotheca ZJNB01 strain: The concentration of the bacterial suspension of Bacteroides monotheca ZJNB01 strain was adjusted to 1×10 8cfu / mL; after centrifugation at 3000×g for 10 min, the supernatant was discarded, 1 mL of 1×PBS buffer was added to resuspend the bacteria, and after repeated centrifugation and washing twice, an equal volume of BHI liquid culture medium was added to the supernatant. The resuspended suspension was the bacteria of Bacteroides monomorpha ZJNB01 strain.

[0073] 4.2 Effects of metabolites and bacteria of Bacteroides monocytogenes ZJNB01 strain on viral N protein expression

[0074] 500 μL of inoculated medium containing MOI=0.01 PEDV ZQ2022 virus solution was mixed with 500 μL of metabolite suspension, bacterial suspension and BHI liquid medium of Bacteroides monotheca ZJNB strain, inoculated into 12-well Vero cells and cultured for 12 hours, and the cells were collected. Western blot and indirect immunofluorescence techniques were used to detect the expression level of PEDVN protein in the treatment group and the control group, and the steps were referred to steps 3.4 and 3.5.

[0075] In order to clarify the components of the porcine Bacteroides monotheca ZJNB01 that play an anti-PEDV infection role, Western Blot was used to detect the expression levels of ZJNB01 metabolites and bacterial viral N protein on Vero cells. Fig.10 As shown in the figure, compared with the control group and the bacterial treatment group, the PEDV N protein content in the group treated with the metabolites of Bacteroides monotheca ZJNB01 was significantly reduced (P < 0.05), but there was no significant difference between the control group and the bacterial treatment group. This indicates that the Bacteroides monotheca ZJNB01 strain inhibits the replication of PEDV through its metabolites.

[0076] 4.3 Effect of metabolites of Bacteroides monocytogenes ZJNB01 strain on PEDV titer

[0077] Referring to the experimental method in step 4.2, the metabolite-virus mixture was inoculated into Vero cells and cultured for 12 hours. At the same time, a control group of BHI-virus solution was set up, the old culture medium was discarded, washed 3 times with 1×PBS buffer, 1 mL of inoculated culture medium was added, stored at -80°C, and repeatedly frozen and thawed three times to release the virus. The above-mentioned freeze-thawed solution was inoculated into a 96-well plate covered with a monolayer of Vero cells, and the titer of the virus in the PEDV virus solution was calculated by the Reed-Muench method (TCID 50 / mL).

[0078] In order to verify the effect of the metabolites of Bacteroides monotheca ZJNB01 from pigs on the replication of PEDV, indirect immunofluorescence was used to detect the fluorescence expression intensity of viral N protein in the metabolite treatment group and the control group. Fig.11As shown, there was no green fluorescence in the Mock group, and multiple obvious green fluorescence was observed in the control group. The fluorescence distribution was weakened in the metabolite treatment group. According to statistics, the fluorescence expression rate of the metabolite treatment group was 18.53%, which was significantly lower than that of the control group (P < 0.05). It can be seen that the fluorescence intensity and distribution of viral N protein in cells can be significantly weakened after metabolite treatment, thus verifying that the metabolites of porcine Bacteroides monomorpha ZJNB01 antagonize PEDV infection.

[0079] In order to further identify the effect of porcine Bacteroides monomorpha ZJNB01 metabolites on PEDV virus titer, the Reed Muench method was used to calculate the virus titer (TCID 50 / mL) changes. The results are as follows Fig.12 As shown, the TCID of the group treated with the metabolites of Bacteroides monocytogenes ZJNB 50 For 10 -4.4583 / mL, TCID of the control group 50 For 10 -4.8333 / mL, it can be seen that the virus titer in the metabolite treatment group was significantly lower than that in the control group (P < 0.05), which shows that the metabolites of porcine Bacteroides monotheca ZJNB01 can inhibit viral replication.

[0080] 5. Evaluation of the efficacy of porcine Bacteroides monotheca ZJNB01 metabolites in protecting piglets against PEDV infection

[0081] 5.1 Effects of porcine Bacteroides monotheca ZJNB01 metabolites on PEDV intestinal tissues in piglets

[0082] Nine 3-day-old piglets were selected for this experiment. All of them were negative for PEDV, PDCoV, TGEV, and PRoV antigens detected by colloidal gold kit. They were randomly divided into 3 groups: culture medium inoculation group, culture medium + PEDV inoculation group, and metabolite + PEDV inoculation group, and were kept in 3 separate rooms. Before the challenge, the piglets in the culture medium + PEDV inoculation group and metabolite + PEDV inoculation group were gavaged 4 times with 3 mL of BHI liquid culture medium and B. uniformis metabolites, each time at an interval of 6 hours. The challenge dose was 1.33×10 6 TCID 50 The piglets in the PEDV virus liquid and medium inoculation groups were gavaged with an equal volume of BHI liquid medium. 36 hours after the piglets were challenged with the virus, all piglets were autopsied and observed, and the pathological changes of the intestines of the pigs in different groups were compared and analyzed.

[0083] The results are as follows Fig.13As shown in the photo, the intestines of piglets in the culture medium + PEDV inoculation group showed thinning and transparent intestinal walls, bloating of the intestinal tube, intestinal expansion, yellow watery contents, and a small amount of bleeding; the intestinal damage of piglets in the metabolite + PEDV inoculation group was relatively mild, and no obvious lesions were found in the intestinal wall; there were no visible lesions in the intestines of piglets in the culture medium inoculation control group.

[0084] 5.2 Effects of metabolites of porcine Bacteroides monotheca ZJNB01 on the viral load of PEDV in piglets

[0085] 36 hours after the virus attack, the fecal samples of the medium + PEDV inoculation group and the metabolite + PEDV inoculation group were collected 36 hours after the virus attack, and the ileum tissues of the piglets after autopsy were collected, and the total RNA was extracted according to the steps of the total RNA extraction kit. The sample RNA concentration was determined using an ultra-micro nucleic acid protein concentration meter, and it was reverse transcribed into cDNA. The fecal and ileal cDNAs were amplified by real-time fluorescence quantitative PCR (Quantitative Real-time-PCR, qPCR) using specific primers PEDV ORF3-F (5'-GCACTTATTGGCAGGCTTTGT-3') and PEDV ORF3-R (5'-CCATTGAGAAAAGAAAGTGTCGTAG-3'). The reaction system is shown in Table 1, and the reaction procedure is: 95°C pre-denaturation for 15s; 40 cycles including 95°C denaturation for 15s, 60°C annealing for 30s, and 72°C extension for 30s. β-Actin was used as the internal reference gene according to 2 -ΔΔCt The method is used for computational analysis to obtain the starting copy number of the sample.

[0086] Table 1 qPCR system

[0087]

[0088] In order to clarify the excretion of PEDV in piglets by the metabolites of ZJNB01 from porcine Bacteroides monomorpha, feces and intestinal tissue samples were collected from piglets 36 hours after infection, and the PEDV viral load levels of the above samples were detected by qPCR. The results showed that compared with the culture medium + PEDV inoculation group, the viral load of piglet feces in the metabolite + PEDV inoculation group was significantly reduced (P<0.01) ( Fig.14 The viral load in the ileum and rectum tissues of the metabolite + PEDV group also showed the same downward trend (P < 0.01) ( Fig.14 The above results indicate that the metabolites of porcine Bacteroides monocytogenes ZJNB01 can protect piglets against PEDV infection.

[0089] Therefore, it can be confirmed that the use of the porcine Bacteroides monotheca ZJNB01 strain of the present invention to prepare metabolites (drugs) can meet the needs of preventing and treating PEDV virus in actual domestic pig breeding scenarios.

[0090] Based on the above research results and animal experimental data, this application proposes the specific application of ZJNB01 strain:

[0091] The Bacteroides monomorpha and / or its metabolites are used as active ingredients to prepare a pharmaceutical preparation with anti-porcine epidemic diarrhea virus function, and the content of the active ingredients in the medicine is 1×10 8 cfu / mL, the dosage is 3mL / time. The dosage form of the drug can be selected as a suspension or an oral solution. In view of the fact that the methods or processes for preparing drugs using strains are publicly recorded in a large number of existing documents, the present invention will not repeat them.

Claims

1. A strain of Bacteroides monomorpha having anti-porcine epidemic diarrhea virus activity, characterized in that: The strain is deposited in the China Center for Type Culture Collection, the preservation name is Bacteroides uniformis ZJNB01, the Latin name is Bacteroides uniformis, and the preservation number is CCTCC NO: M 20241757.

2. The Bacteroides monomorpha according to claim 1, characterized in that The Bacteroides monomorpha was isolated from healthy pig feces.

3. The Bacteroides monomorpha according to claim 1, characterized in that The 16S rRNA gene sequence of the Bacteroides monocytogenes is shown in SEQ ID NO:

1.

4. The method for using Bacteroides monothecae as claimed in any one of claims 1 to 3, characterized in that: The Bacteroides monomorpha and / or its metabolites are used as active ingredients in preparing pharmaceutical preparations.

5. A drug having anti-porcine epidemic diarrhea virus function, characterized in that: The active ingredient of the drug is the Bacteroides monomorpha and / or its metabolites as described in any one of claims 1 to 3, and the content of the active ingredient in the drug is 1×10 8 cfu / mL; the dosage of the drug is 3mL / time.

6. The drug according to claim 5, characterized in that This medicine is available as a suspension or an oral solution.

Images