Anti-helicobacter pylori lactobacillus plantarum and application thereof

Abstract

The invention belongs to the technical field of microorganisms, and discloses anti-helicobacter pylori lactobacillus plantarum and application thereof. The preservation number of the lactobacillus plantarum resistant to helicobacter pylori is CGMCC (China General Microbiological Culture Collection Center) No: 32235. The thallus, the fermentation supernatant and / or the intracellular substance of the lactobacillus plantarum RH JS002 can inhibit the growth of helicobacter pylori, inhibit the urease activity of the helicobacter pylori, co-aggregate with the helicobacter pylori, inhibit the colonization of the helicobacter pylori and improve the inflammation caused by the helicobacter pylori. According to the invention, the lactobacillus plantarum, the thallus, the fermentation supernatant and / or the intracellular substance are applied to preparation of drugs or health-care foods for resisting helicobacter pylori and gastric cancer induced by helicobacter pylori.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a plant lactobacillus resistant to Helicobacter pylori and a use thereof. Background Art

[0002] Helicobacter pylori (HP) is a microaerophilic Gram-negative bacterium that is spiral or arc-shaped under a microscope. A large number of studies have shown that Helicobacter pylori is closely related to the occurrence of gastric diseases such as peptic ulcer, chronic gastritis and even gastric cancer. Helicobacter pylori can resist gastric acid and colonize in the epithelial cells of the gastric mucosa after entering the human body. It secretes urease to increase the pH locally, thereby growing and multiplying. During the growth process, it produces a large number of invasive factors and toxins, which promote the occurrence of gastric diseases. The pathogenic mechanism of Helicobacter pylori causing gastritis is mainly that Helicobacter pylori can produce a large number of virulence factors after colonization in the stomach. The gastric mucosal epithelial cells undergo degeneration under the stimulation of these virulence factors, which leads to the destruction of the normal gastric mucosal barrier, gastric acid erosion of the gastric mucosa, and then gastritis; the pathogenic mechanism of Helicobacter pylori for peptic ulcer is mainly that Helicobacter pylori may promote the secretion of gastric acid while invading the gastric mucosal barrier, further damaging the gastric mucosa and duodenal mucosa, thereby leading to the occurrence of gastric ulcer or duodenal ulcer, and about 10% of Helicobacter pylori patients will eventually develop gastric ulcer. In addition, Helicobacter pylori can also affect the balance of reproduction and death of gastric mucosal epithelial cells, leading to chronic atrophic gastritis. As the disease further develops, it can develop into intestinal metaplasia, atypical hyperplasia and even cancer. WHO (World Health Organization) defines Helicobacter pylori (Hp) as a Class I biological carcinogen. Helicobacter pylori can directly or indirectly activate transcription factors, and further affect the expression of downstream genes through transcription, playing an important role in the formation, spread, and drug resistance of gastric cancer cells.

[0003] For the infection of Helicobacter pylori, antibiotic therapy is generally used clinically at present, and the mainstream treatment scheme is triple or quadruple drug therapy, but antibiotic therapy has certain clinical side effects, which can lead to the reduction of leukocytosis and gastrointestinal reactions, such as diarrhea, nausea, dizziness, vomiting, etc. In addition, during the treatment process, due to the large side effects of antibiotics on the human body, some patients are difficult to bear, resulting in a low treatment compliance rate, and the eradication rate of antibiotic therapy is also decreasing year by year. For this reason, the prior art has opened up new anti-Helicobacter pylori approaches, for example, using relatively safe probiotics to inhibit Helicobacter pylori. However, the probiotic strains with Helicobacter pylori inhibition reported at present are quite limited in resources and effects. Therefore, this area is in urgent need of developing probiotic strains with significant inhibition of Helicobacter pylori. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art such as limited probiotic strain resources and poor antibacterial effect against Helicobacter pylori and to provide an anti-Helicobacter pylori Lactobacillus plantarum and its use.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention provides a plant lactobacillus that resists Helicobacter pylori, and its preservation number is CGMCC No: 32235.

[0007] The anti-Helicobacter pylori Lactobacillus plantarum RH JS002 of the present invention is named Lactobacillus plantarumRH JS002, and its Latin name is named Lactobacillus plantarum. It was deposited in the General Microbiology Center of China National Microbiological Culture Collection Committee on October 16, 2024, with a deposit number of CGMCC No: 32235, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Contact number: 010-64807355.

[0008] The bacterial body, fermentation supernatant and / or intracellular substances of the plant lactobacillus JD08 of the present invention can inhibit the growth of Helicobacter pylori, inhibit the urease activity of Helicobacter pylori, co-aggregate with Helicobacter pylori, inhibit the colonization of Helicobacter pylori, and improve inflammation caused by Helicobacter pylori.

[0009] In a second aspect, the present invention provides the bacterial body, fermentation supernatant and / or intracellular substances of the Lactobacillus plantarum.

[0010] Any act of culturing, propagating, fermenting, enriching, producing, preparing, using, inoculating, amplifying, transforming, modifying, transforming, selling, or promising to sell the Lactobacillus plantarum strain RHJS002 with a preservation number of CGMCC No: 32235, and / or using the Lactobacillus plantarum strain RH JS002 with a preservation number of CGMCC No: 32235 in combination with other probiotics, and / or using the Lactobacillus plantarum strain RH JS002 with a preservation number of CGMCC No: 32235 to antagonize various pathogens, and / or preparing antibacterial products, and / or preparing anti-Helicobacter pylori drugs all fall within the protection scope of the present invention.

[0011] In a more specific embodiment, the other probiotics include but are not limited to: Lactobacillus plantarum, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus delbrueckii lactic acid subsp., Lactobacillus helveticus, Lactobacillus casei, Lactobacillus crispatus, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus johnsonii, Lactobacillus paracasei, Lactobacillus rhamnosus, Lactobacillus salivarius, Saccharomyces cerevisiae, Delb's spores, Candida, Wickham's yeast, Pichia, Saccharomyces boulardii, Pseudomonas, Schizosaccharomyces, Rhodotorula, Schizosaccharomyces, , Saccharomyces cerevisiae, Bacillus thuringiensis, Brevibacillus laterosporus, Bacillus megaterium, Bacillus mucilaginosus, Bacillus azotobacterium, Bacillus sphaericus, Clostridium butyricum, Bifidobacterium adolescentis, Bifidobacterium angularis, Bifidobacterium animalis, Bifidobacterium asteroides, Bifidobacterium bifidum, Bifidobacterium bovis, Lactobacillus casei, Bifidobacterium breve, Bifidobacterium dentate, Bifidobacterium infantis (i.e., Bifidobacterium longum infantis subsp. infantis), Bifidobacterium lactis (i.e., Bifidobacterium animalis subsp. lactis), Bifidobacterium longum, Bifidobacterium pseudocatenulatum, as well as Bifidobacterium thermophilum and Bifidobacterium acidothermophilum.

[0012] Those skilled in the art can make conventional selections or adjustments to pharmaceutical excipients or health food excipients according to actual production needs, in combination with conventional technical means or basic common sense of production processes in the field of medicines or health foods (for example, "Drug Preparation Technology", "Production, Processing and Technical Requirements for Health Foods", etc.), and then prepare Lactobacillus plantarum strain RH JS002 with a preservation number of CGMCC No: 32235 into products with different dosage forms, different storage conditions and different shelf lives. This is possible and easy to do without any technical obstacles for those skilled in the art.

[0013] In a third aspect, the present invention provides an agent or medicine against Helicobacter pylori, comprising the Lactobacillus plantarum, or the bacterial cells, fermentation supernatant and / or intracellular substances.

[0014] As a preferred embodiment of the reagent or drug of the present invention, it also includes a pharmaceutically acceptable excipient.

[0015] In a more specific embodiment, the pharmaceutically acceptable excipient is selected from: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants, deflocculating agents, filter aids, release retardants, etc.

[0016] In a fourth aspect, the present invention provides an anti-Helicobacter pylori health food, comprising the Lactobacillus plantarum, or the bacterial cells, fermentation supernatant and / or intracellular substances.

[0017] As a preferred embodiment of the health food of the present invention, it also includes food-acceptable auxiliary materials.

[0018] In a more specific embodiment, the excipient is selected from: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, adhesives, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, glidants, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesives, integrities, penetration enhancers, pH regulators, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, inclusion agents, humectants, absorbents, diluents, flocculants, deflocculating agents, filter aids, release retardants, etc.

[0019] As a further preferred embodiment of the reagent or medicine, or the health food of the present invention, the dosage form of the reagent or medicine, or the health food includes any one of powder, tablet, injection, oral liquid, suppository, gel, patch, spray, lotion, and granule.

[0020] According to the content of the present invention, for different needs in actual production and application, combined with conventional technical means in the field of drug preparation (for example, "Encyclopedia of Preparation Technology", "Drug Preparation Technology", "Research and Application of Microbial Agent Technology", "Health Food Technology", "Production Technology and Production Technology of Health Food", "Production, Processing and Technical Requirements of Health Food", etc.), those skilled in the art can select and formulate the above-mentioned pharmaceutically or food-acceptable excipients, and prepare the Lactobacillus plantarum strain RH JS002 with a preservation number of CGMCC No: 32235 into different dosage forms, such as powders, tablets, injections, oral liquids, suppositories, gels, patches, sprays, lotions, granules, etc.

[0021] In a specific embodiment, the dosage form of the health food is selected from at least one of powder, tablet, liquid and capsule.

[0022] In a fifth aspect, the present invention provides a method for inhibiting Helicobacter pylori for the purpose of non-disease diagnosis and treatment, wherein the Lactobacillus plantarum, or the bacterial cells, fermentation supernatant and / or intracellular substances are added to inhibit Helicobacter pylori.

[0023] In a sixth aspect, the present invention uses the plant lactobacillus, the bacterial cells, the fermentation supernatant and / or the intracellular substances in the preparation of anti-Helicobacter pylori drugs or health foods.

[0024] In a seventh aspect, the present invention uses the plant lactobacillus, the bacterial cells, the fermentation supernatant and / or the intracellular substances in the preparation of a medicine or health food for gastric cancer induced by Helicobacter pylori.

[0025] The plant lactobacillus RH JS00 of the present invention, its bacterial body, fermentation supernatant and / or intracellular substances can inhibit the growth of Helicobacter pylori, inhibit the urease activity of Helicobacter pylori, co-aggregate with Helicobacter pylori, inhibit the colonization of Helicobacter pylori, and improve the inflammation caused by Helicobacter pylori. The mechanism of action of improving the inflammation caused by Helicobacter pylori includes inhibiting the secretion of immune factors by gastric cancer cells induced by Helicobacter pylori and improving the atrophy of gastric glands in mice caused by Helicobacter pylori. The gastric cancer cells are human gastric cancer cells AGS; the immune factors include IL-8; and the mice are Balb / c mice.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The Lactobacillus plantarum strain RH JS002 provided by the present invention is screened from fecal samples of healthy humans. The strain has good ability to inhibit Helicobacter pylori, which is specifically manifested in: being able to inhibit the growth of Helicobacter pylori, inhibiting the urease activity of Helicobacter pylori, co-aggregating with Helicobacter pylori, inhibiting the colonization of Helicobacter pylori, and improving inflammation caused by Helicobacter pylori, etc. In addition, after whole-genome sequencing, gene annotation of the strain RH JS002 shows that it does not have key genes for virulence synthesis, and is considered to be relatively safe for the human body. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a transparent calcium-dissolving circle of lactic acid bacteria;

[0029] Figure 2 Phylogenetic tree analysis of JD01;

[0030] Figure 3 Phylogenetic tree analysis for JD02;

[0031] Figure 4 This is the evolutionary tree analysis of JD03;

[0032] Figure 5 This is the evolutionary tree analysis of JD04;

[0033] Figure 6 This is the evolutionary tree analysis of JD05;

[0034] Figure 7 Phylogenetic tree analysis for JD20;

[0035] Figure 8 Phylogenetic tree analysis for JD08 (RH JS002);

[0036] Fig. 9 Phylogenetic tree constructed for JD08 (RH JS002) based on the single copy gene set of the core gene set;

[0037] Fig.10 The phylogenetic tree of JD08 (RH JS002) was constructed based on the multiple sequence alignment results of the SNP sites in the whole genome;

[0038] Fig.11 Urease method for detecting Helicobacter pylori in mouse tissues;

[0039] Fig.12 qPCR was used to detect the number of Helicobacter pylori in mice;

[0040] Fig.13 HE staining results of mouse stomach tissue. DETAILED DESCRIPTION

[0041] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0042] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial sources.

[0043] The Helicobacter pylori ATCC26695 involved in the following examples was purchased from Beijing Biobo Biotechnology Co., Ltd.; the mice involved were Balb / c mice purchased from Shanghai Slake Company.

[0044] The AGS cells involved in the following embodiments were purchased from Yuchi (Shanghai) Biotechnology Co., Ltd.; the NaCl involved was purchased from Sinopharm Group; the Columbia basal medium involved was purchased from OXOID Company in the UK; the sterile defibrinated sheep blood involved was purchased from Hangzhou Xinrui Company; and the fetal bovine serum involved was purchased from Nanjing Senbega Company.

[0045] The formula of the solution involved in the following embodiment is as follows:

[0046] Artificial gastric juice (g / L): pepsin 3g / L, sodium chloride 5g / L, pH adjusted to 4.0±0.2;

[0047] Urea phenol red solution: 0.9% NaCl, 20mmol / L urea, 14μg / mL phenol red.

[0048] The formula of the culture medium involved in the following examples is as follows:

[0049] MRS solid medium (g / L): peptone 10g / L, beef extract 10g / L, glucose 20g / L, sodium acetate 2g / L, yeast powder 5g / L, diammonium hydrogen citrate 2g / L, K 2 PO 4 ·3H 2 O 2.6g / L, MgSO 4 7H 2 O0.1g / L, MnSO 4 0.05g / L, Tween 80 1mL / L, agar 20g / L, cysteine ​​salt 0.5g / L.

[0050] MRS liquid medium (g / L): peptone 10g / L, beef extract 10g / L, glucose 20g / L, sodium acetate 2g / L, yeast powder 5g / L, diammonium hydrogen citrate 2g / L, K 2 PO 4 ·3H 2 O 2.6g / L, MgSO 4 7H 2 O0.1g / L, MnSO 4 0.05g / L, Tween 80 1mL / L, cysteine ​​salt 0.5g / L.

[0051] Columbia blood agar medium: Dissolve 39g of Columbia medium solid powder in 1L of water, sterilize at 121℃ for 15min, add 7.5% (v / v) sterile defibrinated sheep blood after cooling to 55℃~60℃, mix well and pour on the plate.

[0052] BHI liquid culture medium (g / L): tryptone 10.0 g / L, beef heart extract powder 17.5 g / L, sodium chloride 5.0 g / L, glucose 2.0 g / L, disodium hydrogen phosphate (12H2O) 2.5 g / L, pH 7.4±0.2.

[0053] The detection methods involved in the following embodiments are as follows:

[0054] (1) Inhibition zone detection: The inhibition zone is measured using the Oxford cup method. Helicobacter pylori is spread on the surface of the plate, and Oxford cups are placed at equal distances. An equal amount of probiotic solution is added to the cups. The larger the inhibition zone, the better the antibacterial effect.

[0055] (2) Urease inhibition activity test: Mix lactic acid bacteria fermentation liquid or lactic acid bacteria suspension with Helicobacter pylori, take 40 μL Helicobacter pylori suspension and 10 μL lactic acid bacteria fermentation liquid or lactic acid bacteria heavy suspension and mix them evenly, set up three parallel, put them in a microaerobic environment and shake and culture for 4 hours, then take them out, add 150 μL urea-phenol red solution, and measure its absorbance at a wavelength of 550 nm after shaking. Pure Helicobacter pylori suspension was used as the positive control. Inhibition rate (%) = (A 0 -A t ) / A 0 × 100%. 0 is the absorbance value of the positive group, i.e., the pure Helicobacter pylori group, at 550 nm. t It is the absorbance value of the mixed group of lactic acid bacteria and Helicobacter pylori at 550nm.

[0056] (3) Detection and calculation method of copolymerization rate:

[0057] The lactobacillus and mixed bacterial solution were measured before and after reaction (0 min / T min ) OD value, the copolymerization rate was calculated according to the following formula: Copolymerization rate (%) = [(OD 600 Milk rod + OD 600 Pylorus)-2×OD 600 Mixed] / (OD 600 Milk rod + OD 600 pylorus)×100.OD 600 Milk bar and OD 600 Pyloric is the value before reaction, i.e. 0 min OD of Lactobacillus suspension and Helicobacter pylori suspension 600 , O.D. 600 Mixed is the value of the bacterial solution after the reaction, that is, T min OD of the mixed bacterial solution 600 .

[0058] The preparation methods of the bacterial liquid and bacterial cells of Helicobacter pylori involved in the following embodiments are as follows:

[0059] Helicobacter pylori was plated on Columbia blood agar medium and incubated at 37°C in a three-gas incubator (85% N 2 , 10% CO 2 , 5% O 2 ) for 4 days to obtain a blood plate full of colonies; use a sterile cotton swab to gently scrape the Helicobacter pylori colonies on the blood plate, suspend them in a small amount of BHI medium, take 200 μL of the BHI suspension containing Helicobacter pylori, spread it on Columbia blood agar medium, and incubate it in a 37°C three-gas incubator (85% N 2 , 10% CO 2 , 5% O 2) Cultivate for 3-4 days to obtain a blood plate full of colonies; repeat the above operation twice, gently scrape the colonies on the latest blood plate with a sterile cotton swab, resuspend in BHI medium, and centrifuge the resuspended liquid at 8000g for 10 minutes to obtain Helicobacter pylori cells;

[0060] Columbia blood plate: 39g Columbia medium solid powder is dissolved in 1L water, sterilized at 121°C for 15min, and after cooling to 55°C to 60°C, 7.5% (v / v) sterile defibrinated sheep blood is added, mixed and poured into the plate.

[0061] The preparation methods of the fermented liquid, supernatant and bacterial cells of the lactobacillus involved in the following embodiments are as follows:

[0062] Each lactobacillus was streaked on MRS solid medium and cultured at 37°C for 48 hours to obtain a single colony; a single colony was picked and inoculated into MRS liquid medium, cultured at 37°C for 18 hours for activation, and activated for two generations to obtain an activated liquid, which was inoculated into MRS liquid medium at an inoculum volume of 2% (v / v), cultured at 37°C for 18 hours, and fermented liquid was obtained, centrifuged at 8000r / min, 15min, and 4°C, and the supernatant and bacterial precipitate were collected respectively. The supernatant was sterilized by filtering twice with a 0.22μm filter membrane, and the bacterial precipitate was washed twice with sterile PBS and resuspended to make the number of viable bacteria reach 1×10 8 CFU / mL.

[0063] Example 1: Isolation and screening of strains

[0064] Fecal samples from healthy humans are collected by using a fecal collector to collect fresh fecal samples; dilute with 0.9% saline gradient under sterile conditions, select appropriate dilution gradients and spread on MRS agar plates containing 1% calcium carbonate, and culture at 37°C for 48-72 hours. Observe the colony morphology and the presence of calcium-dissolving rings with the naked eye, such as Figure 1 Single colonies with calcium-dissolving circles were selected for microscopic observation and preliminary screening and purification culture, and strains JD01, JD02, JD03, JD04, JD05, JD08 (RH JS002), and JD20 were obtained.

[0065] After the strain was purified, it was cultured in MRS liquid medium at 37°C for 16 hours, centrifuged to remove the supernatant, resuspended in a sterile 30% glycerol aqueous solution, and stored at -80°C for later use.

[0066] Example 2: Identification of strains

[0067] Strain Identification The strain isolated and screened in Experimental Example 1 was cultured in liquid, the bacteria were collected, the genomic DNA was extracted, the 16S rDNA sequence was amplified using universal primers 27F and 1492R, the PCR amplification products were detected by agarose gel electrophoresis, and the PCR products were sequenced.

[0068] The PCR reaction system was as follows: 2× Taq Mixture 10 μL, 10 μM upper and lower primers 0.5 μL each, DNA template 0.5 μL, ddH 2 The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 50°C for 30 s, and 72°C for 1.5 min, followed by extension at 72°C for 10 min.

[0069] The PCR product was detected by gel electrophoresis and sent to Suzhou Genewise Biotechnology Co., Ltd. for sequencing. The nucleotide sequence information is shown in SEQ ID No.1.

[0070] The identified gene sequences were compared in the NCBI database using the BLAST tool. Based on the molecular biological identification and comparison results, combined with biological characteristics observation and sequencing analysis, it was determined that strains JD01, JD02, JD03, JD04, JD05, JD08 (RH JS002), and JD20 all belonged to Lactobacillus plantarum. The 16s rDNA sequences of each strain and the 16s rDNA sequences in the NCBI database were compared, and the 10 strains with the highest similarity were selected from the sequencing results, and the NJ neighbor-joining method was used to construct the tree, as shown in Figure 2 . Figures 2 to 8 shown.

[0071] Example 3: Lactobacillus plantarum JD08 (RH JS002) inhibits the growth of Helicobacter pylori

[0072] Scrape the Helicobacter pylori cultured for 72 hours and resuspend it in BHI medium. Adjust the concentration of the bacterial solution to about 1×10 8 cfu / mL, 200 μL of Helicobacter pylori suspension was applied to Columbia blood agar medium. When no water stains were seen on the plate, three Oxford cups were placed equidistantly on the plate, and the Oxford cups were gently pressed to prevent their positions from drifting. After the Oxford cups were fixed, lactic acid bacteria solution was dripped into the Oxford cups. The same solution was dripped into the three Oxford cups on each plate as parallel samples, and 200 uL of solution was dripped into each Oxford cup. Plant Lactobacillus CN2018 and Lactobacillus acidophilus LA8, which can inhibit Helicobacter pylori, were used as positive controls, and MRS medium was used as a negative control. All plates were placed in a three-gas incubator (85% N 2 , 10% CO 2 , 5% O 2) were cultured at 37°C for 4 days. After the culture was completed, the diameter of the inhibition zone around the Oxford cup was measured with a vernier caliper.

[0073] The test results are shown in Table 1:

[0074] Table 1 Size of inhibition zone

[0075]

[0076]

[0077] As shown in the above results, Lactobacillus plantarum JD08 (RH JS002) has the largest inhibition zone, reaching 16.53±0.78 mm, which is larger than the inhibition zone of commercial Lactobacillus plantarum CN2018 (14.55±1.16 mm) and the inhibition zone of commercial Lactobacillus acidophilus LA88 (14.79±0.58 mm). It can be seen that Lactobacillus plantarum JD08 (RH JS002) has a stronger ability to inhibit the growth of Helicobacter pylori.

[0078] Example 4: Lactobacillus plantarum JD08 (RH JS002) inhibits urease activity of Helicobacter pylori

[0079] Lactobacillus plantarum CN2018 and Lactobacillus acidophilus LA8, which can inhibit Helicobacter pylori, were used as positive controls. Two groups were set up in the experiment, one group was mixed culture of plant lactic acid bacteria fermentation broth and Helicobacter pylori, and the other group was mixed culture of Lactobacillus plantarum and Helicobacter pylori after centrifugation of the fermentation broth with BHI culture broth. 40 μL of Helicobacter pylori suspension and 10 μL of JD08 (RH JS002) fermentation broth or resuspension were mixed in a 96-well plate, and three parallels were set for each type. After shaking and culturing in a microaerobic environment for 4 hours, they were taken out, 150 μL of urea-phenol red solution was added, and the absorbance value was measured at a wavelength of 550nm after shaking.

[0080] The urease inhibition rate is calculated as follows: Inhibition rate (%) = (A 0 -A t ) / A 0 × 100%. 0 is the absorbance value of pure Helicobacter pylori group at 550nm, A t is the absorbance value of each experimental group at 550 nm.

[0081] The test results are shown in Table 2:

[0082] Table 2 Urease inhibition rate

[0083]

[0084] As shown in the above results, the inhibition rate of plant lactobacillus fermented bacteria liquid to Helicobacter pylori urease is generally very high, and when the supernatant is removed and only the plant lactobacillus thalline is retained, the inhibition ability of plant lactobacillus to Helicobacter pylori urease obviously decreases. The inhibition rate of plant lactobacillus JD08 (RH JS002) fermented bacteria liquid to Helicobacter pylori urease reaches 83.98% ± 0.67%, and when the supernatant is removed and only the plant lactobacillus thalline is retained, the inhibition rate of plant lactobacillus to Helicobacter pylori urease reaches 62.15% ± 0.74%, which is greater than the inhibition rate of commercial plant lactobacillus CN2018 fermented bacteria liquid to Helicobacter pylori urease 81.43% ± 2.38%, and when the supernatant is removed and only the plant lactobacillus CN2018 thalline is retained, the inhibition rate of Helicobacter pylori urease 61.68% ± 2.99%. Lactobacillus plantarum JD08 (RH JS002), whether in fermented bacterial broth or bacterial resuspension, has a higher urease inhibition ability than commercial strains. Lactobacillus plantarum JD08 (RH JS002) can better inhibit Helicobacter pylori urease.

[0085] Example 5: Coaggregation of Lactobacillus plantarum JD08 (RH JS002) and Helicobacter pylori

[0086] (1) Helicobacter pylori suspension: Helicobacter pylori was spread on Columbia blood agar plates and incubated at 37°C in a three-gas incubator (85% N 2 , 10% CO 2 , 5% O 2 ) for 4 days to obtain a large number of Helicobacter pylori colonies; use a sterile cotton swab to gently scrape the Helicobacter pylori colonies on the blood plate, resuspend them in a small amount of BHI culture medium to obtain Helicobacter pylori bacterial solution; then centrifuge at 8000g for 10 minutes to obtain Helicobacter pylori cells, wash them twice with artificial gastric juice (pH=4), resuspend them in artificial gastric juice (pH=4), and adjust the concentration of the bacterial solution to OD 600 = about 0.5, and a Helicobacter pylori suspension was obtained.

[0087] (2) Lactobacillus suspension: streak the lactobacillus to be tested on MRS solid culture medium, and culture at 37°C for 48 hours to obtain a single colony; pick a single colony and inoculate it into MRS liquid culture medium, and culture it at 37°C for 18 hours for activation, and activate it for two generations to obtain an activated solution; inoculate the activated solution into MRS liquid culture medium at an inoculum amount of 2% (v / v), and culture it at 37°C for 18 hours to obtain a lactic acid bacteria solution; centrifuge the lactic acid bacteria solution at 8000g for 10 minutes to obtain lactic acid bacteria cells, wash them twice with PBS buffer (pH=7.42), resuspend them in PBS buffer (pH=7.42), and adjust the concentration of the bacterial solution to OD 600 =about 0.5.

[0088] (3) Take 2 mL of the adjusted bacterial concentration of Helicobacter pylori and 2 mL of the bacterial suspension of Lactobacillus plantarum JD08 (RH JS002), mix them in equal volume ratio, and shake them thoroughly for 10 seconds to mix them evenly. Incubate them at 37°C for 120 minutes. After the reaction of the mixed bacterial solution of Lactobacillus plantarum and Helicobacter pylori (T min ) OD value, substitute into the formula: copolymerization rate (%) = [(OD 600 Milk rod + OD 600 Pylorus)-2×OD 600 Mixed] / (OD 600 Milk rod + OD 600 pylorus)×100.OD 600 Milk bar and OD 600 Pyloric is the value before reaction, i.e. 0 min OD of Lactobacillus suspension and Helicobacter pylori suspension 600 , O.D. 600 Mixed is the value of the bacterial solution after the reaction, that is, T min OD of the mixed bacterial solution 600 . And calculate the copolymerization rate.

[0089] The test results are shown in Table 3:

[0090] Table 3 Copolymerization rate of different lactic acid bacteria and Helicobacter pylori

[0091]

[0092] As shown in the table above, Lactobacillus plantarum JD08 (RH JS002) can achieve a coaggregation rate of 28.62% with Helicobacter pylori within 2 hours, which is greater than the 23.50% of commercial Lactobacillus plantarum CN2018 and the 21.74% of commercial Lactobacillus acidophilus LA88. It can be seen that Lactobacillus plantarum JD08 (RH JS002) has better coaggregation ability with Helicobacter pylori.

[0093] Based on the comprehensive data results of the ability to inhibit the growth of Helicobacter pylori, the ability to inhibit Helicobacter pylori urease, and the ability to co-aggregate with Helicobacter pylori, it was screened that Lactobacillus plantarum JD08 (RH JS002) has a strong anti-Helicobacter pylori ability.

[0094] Lactobacillus plantarum JD08 (RH JS002) was purified and cultured, and the culture product was sent to Sangon Biotech (Shanghai) Co., Ltd. for gene draft drawing. Based on the gene draft, the single copy gene set of the core gene set and the SNP sites based on the whole genome were used as the multiple sequence alignment results, and the phylogenetic tree (core gene tree and SNP tree) was constructed by neighbor-joining clustering, as shown in the figure. Fig. 9 and 10Whether it is the phylogenetic tree constructed based on the single copy gene set of the core gene set or the phylogenetic tree constructed based on the multiple sequence alignment results of the SNP sites of the whole genome, the results show that Lactobacillus plantarum JD08 (RH JS002) is most closely related to Lactiplantibacillus_plantarum_Zhang-LL GCA_001581895.1, and strain JD08 (RH JS002) is further identified as Lactobacillus plantarum.

[0095] The plant lactobacillus JD08 (RH JS002) was named Lactobacillus plantarum RH JS002, and its Latin name was named Lactobacillus plantarum. It was deposited in the General Microbiological Center of China Microorganism Culture Collection on October 16, 2014, with a deposit number of CGMCC No: 32235, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0096] Example 6: Urease method to test the ability of Lactobacillus plantarum RH JS002 to inhibit Helicobacter pylori in mouse gastric tissue

[0097] Helicobacter pylori gavage mouse model: The animals used were SPF-grade Balb / c inbred mice, 4 weeks old. Before gavage of Helicobacter pylori, mixed antibiotics were used to kill the existing bacteria in the mouse stomach to provide suitable conditions for Helicobacter pylori colonization. The mixed antibiotic formula was: ampicillin (0.5g / tube) was diluted with 25ml of sterile saline to a solution with a concentration of 20mg / ml, gentamicin (80mg / tube) was diluted with 20ml of sterile saline to a solution with a concentration of 4mg / ml, and clarithromycin (0.25g / tablet) was diluted with 5ml of sterile saline to a solution with a concentration of 50mg / ml.

[0098] The three antibiotic solutions were mixed to obtain 50 ml of antibiotic mixture, which was fully mixed to form an antibiotic mixture. Each mouse was gavaged with 0.2 ml each time per day for 7 days.

[0099] After the antibiotic treatment, Helicobacter pylori model was established by intragastric administration. The concentration of Helicobacter pylori suspension fed to the model was adjusted to 10 9 -10 10cfu / ml or more. The modeling process lasted for 7 days. On the first day, 0.2 ml of Helicobacter pylori suspension was given. From the second to the seventh day, 0.1 ml of sodium bicarbonate was first gavaged to neutralize gastric acid, and then 0.1 ml of Helicobacter pylori liquid was gavaged 0.5 hours later. After the modeling, the mice were fed normally for one week. After one week, the urease test was performed on the mouse feces to identify the success rate of the modeling. The results showed that only a few mice were not infected with Helicobacter pylori. The uninfected mice were removed, and the remaining mice were evenly divided and gavaged twice before treatment began.

[0100] Treatment of mice infected with Helicobacter pylori: The treatment group was gavaged with the bacterial solution of strain RH JS002, and different solutions were gavaged at a volume of 0.2 ml / mouse. The treatment lasted for three weeks, and after three weeks, the mice were killed to obtain serum and mouse stomach tissue. The operation process is shown in the following table.

[0101] Table 4 Animal experiment operation plan

[0102]

[0103] After killing the mice, part of the mouse stomach tissue was immediately taken and placed in sterile EP tubes containing urea-phenol red solution (10 g urea and 0.006 g phenol red were dissolved and mixed, then the pH of the solution was adjusted to 6.5 and the volume was fixed to 50 mL, wherein the ratios of urea and phenol red were 20% and 0.012%, respectively). The EP tubes were placed in a 37°C incubator and incubated for 30 min. If the solution changed color, it proved that Helicobacter pylori was present in the tissue. If the solution did not change color, it proved that the number of Helicobacter pylori in the tissue was small or did not exist.

[0104] The results are as follows Fig.11 As shown in Table 5:

[0105] Table 5 Urease method for direct detection of Helicobacter pylori in mouse gastric tissue

[0106] Modeling group number Modeling group results Treatment group number Treatment group results 1 + 10 2 + 11 + 3 + 12 + 4 + 13 + 5 + 14 6 + 15 + 7 16 8 + 17 9 18

[0107] The results showed that only 2 samples in the Helicobacter pylori modeling group did not change color and were negative, and the remaining 7 samples changed color to varying degrees. Five samples in the Lactobacillus plantarum RH JS002 treatment group did not change color significantly, and the color development degree of the discolored samples was much weaker than that of the Helicobacter pylori modeling group. It is believed that the Helicobacter pylori colonization in the gastric tissue of mice decreased after treatment with Lactobacillus plantarum RH JS002.

[0108] Example 7: Cultivation method to test the ability of Lactobacillus plantarum RH JS002 to inhibit Helicobacter pylori in mouse gastric tissue

[0109] The modeling, grouping, processing and treatment of mice gavaged with Helicobacter pylori were the same as those in Example 6.

[0110] Part of the gastric tissue of each mouse was placed in different 30% glycerol cryopreservation tubes, numbered and stored in a -80°C refrigerator. The cryopreservation tubes were fully shaken before plating, and the liquid in the tubes was evenly spread on Columbia blood agar medium containing 7% defibrinated sheep blood. The tubes were placed at 37°C and cultured in a microaerobic environment for 72 hours. The presence of Helicobacter pylori in the growing colonies was determined by microscopic examination and urease method.

[0111] The results are shown in Table 5:

[0112] Table 5 Detection of Helicobacter pylori in mouse gastric tissue by culture method

[0113]

[0114]

[0115] The results showed that Helicobacter pylori was cultured in 6 groups of samples in the modeling group, while Helicobacter pylori was not cultured in 3 groups of samples in the group treated with Lactobacillus plantarum RH JS002 by oral gavage. It is believed that consuming Lactobacillus plantarum RH JS002 can help reduce the amount of Helicobacter pylori in mice.

[0116] Combined with the results of Example 6, only mice No. 7 and No. 9 in the modeling group had negative results, and the other 7 mice all had positive results. Among the mice gavaged with Lactobacillus plantarum RH JS002, only 4 mice No. 11, No. 12, No. 13, and No. 15 had positive results, and the other 5 mice were always negative. Based on this, it is believed that eating Lactobacillus plantarum RH JS002 can help mice significantly reduce the content of Helicobacter pylori in the body.

[0117] Example 8: Quantitative detection of Helicobacter pylori in mouse gastric tissue by qPCR

[0118] Extract DNA: Weigh 90-120 mg of mouse stomach tissue sample into a 2 mL centrifuge tube and place the tube on ice. Use a gene extraction kit to extract DNA from mouse tissue samples. Follow the instructions of the kit. Store the final extracted DNA product at -20°C to prevent DNA degradation. After extraction, use a micro-nucleic acid detector to detect the OD 260 / OD 280 , a ratio greater than 1.8 can prove that the DNA purity is high and can be used for subsequent experiments.

[0119] qPCR: The system uses 25 μL, including 12.5 μL SYBR Mix solution, 0.3 μL upper and lower primers, 1 μL DNA template, and the rest is filled with ddH2O. The reaction program is 95℃ pretreatment for 10 min, then 95℃ denaturation for 10 s, 55℃ extension for 90 s, and 40 cycles. Primers are designed based on the babA virulence gene fragment of Helicobacter pylori. The primer sequences are as follows:

[0120] babA-F: GGTGGGGTTTTGGAATGTCTTA;

[0121] babA-R: AAAGAACAGGGTGATGGAAGTGGA.

[0122] See Fig.12 The qPCR annotation results based on the babA virulence gene showed that the average expression level of the babA virulence gene in 9 mice in the modeling group was 2.58×10 4 The average expression level of babA virulence gene in mice treated with Lactobacillus plantarum RH JS002 was 1.08×10 3 It can be seen that eating Lactobacillus plantarum RH JS002 can significantly reduce the number of Helicobacter pylori colonizing in mice.

[0123] Experimental Example 9: HE staining of mouse stomach tissue sections to observe improvement of inflammation

[0124] Weigh 90-120 mg of mouse stomach tissue sample into a 2 mL centrifuge tube, add paraformaldehyde solution for tissue fixation, use alcohol from low to high concentration as a dehydrating agent, and gradually remove the water in the tissue block. Then place the tissue block in xylene to make it transparent, place the transparent tissue block in the dissolved paraffin, put it in a wax melting box for insulation, and embed it after the paraffin is completely immersed in the tissue block. Fix the embedded wax block on the slicer and cut it into thin slices. Then dewax the slices with xylene to remove the paraffin in the slices, then treat them with alcohol from high to low concentrations, and finally put them in distilled water, then they can be stained. After the slices are placed in a hematoxylin aqueous solution for staining for a few minutes, they are placed in acid water and ammonia water for color separation for a few seconds each, then rinsed with running water for 1 hour and then placed in distilled water for a while, then placed in 70% and 90% alcohol for dehydration for 10 minutes each, and finally placed in alcohol eosin staining solution for staining for 2-3 minutes, and the staining is completed. The stained sections were dehydrated with pure alcohol, and then made transparent with xylene. After sealing, a section scanner was used to obtain a scanned image of HE staining of mouse tissue sections.

[0125] The staining results are as follows Fig.13As shown in the figure, the cells in the normal group were full, with normal morphology and a small number of inflammatory cells. The cell morphology of the modeling group was obviously abnormal, the glands were atrophied and there were a large number of inflammatory cells. The tissue sections of mice gavaged with Lactobacillus plantarum RH JS002 showed that the gland atrophy phenomenon was improved and the inflammation was relieved.

[0126] Experimental Example 10: Supernatant of Lactobacillus plantarum RH JS002 inhibits the secretion of inflammatory factors by AGS cells

[0127] Pretreatment: The experimental group used lactic acid bacteria supernatant to pretreat AGS cells for 2 hours, discarded the treatment solution, and cultured AGS cells in RPMI1640 medium containing 1ng / mL IL-1β. The cells were cultured in a 5% carbon dioxide incubator at 37°C for 16 hours. The cultured mixture was transferred to a centrifuge tube and centrifuged at 3000r / min for 10 minutes to obtain the supernatant. The modeling group was not pretreated with lactic acid bacteria supernatant and was directly cultured with IL-1β-containing culture medium. The blank group was neither pretreated with lactic acid bacteria supernatant nor did the culture medium contain IL-1β. The secreted IL-8 was determined according to the instructions for use of the kit.

[0128] Post-treatment: AGS cells were pre-incubated with IL-1β (1 ng / mL, 2 hours), and the lactic acid bacteria supernatant containing IL-1β was co-cultured with AGS cells for 24 hours. The culture mixture was transferred to a centrifuge tube and centrifuged at 3000 r / min for 10 minutes to obtain the supernatant. The modeling group consisted of AGS cells treated with medium containing IL-1β only. The secreted IL-8 was determined according to the instructions for use of the kit.

[0129] The results are shown in Table 6:

[0130] Table 6 Test results

[0131] Blank Group Modeling Group RH JS002 Preprocessing 96.67±3.09 165.13±1.35 116.51±1.80 Post-processing 96.67±3.09 266.93±30.80 158.99±22.72

[0132] It can be seen from the data in the table that the use of the bacterial solution of strain RH JS002, whether for pre-treatment of cells or post-treatment of AGS cells, can reduce the amount of inflammatory factor IL-8 secreted by cells to a certain extent. Based on this, it is speculated that strain RH JS002 can relieve gastric inflammation and play a certain role in protecting the stomach.

[0133] Experimental Example 11: Annotation of virulence factors and drug resistance genes of Lactobacillus plantarum RH JS002

[0134] (1) Virulence factor annotation

[0135] Download the VDFB database file, set the environment variables and system variables locally on the computer, establish the database, use the NCBI Blast+2.15.0+ tool to retrieve the protein sequence in the Lactobacillus plantarum RH JS002 gene draft and compare it with the established database, and set the result filtering parameters to evalue~1e-5, min length~50, pident~30.

[0136] The results showed that 83 annotation results were obtained based on SetA, and 169 annotation results were obtained based on SetB. The highest matching degree of all annotation results was 75.3%, which is lower than the 85% stipulated in my country's "Technical Guidelines for Safety Inspection and Evaluation of Bacteria Used as Health Food Ingredients". Therefore, it is believed that the bacteria do not have known virulence factors and do not have the ability to produce toxins at the genetic level.

[0137] (2) Annotation of drug resistance genes

[0138] According to the CARD drug-resistant gene database, the antibiotic resistance genes of Lactobacillus plantarum JD17 were predicted, and the filtering parameters were set as e<1e-2, coverage>70, and pident>40.

[0139] The annotation results show that the drug resistance gene annotation results based on the CARD database show that RH JS002 has 46 antibiotic resistance genes with a matching degree greater than 30%, which mainly play a role in aminoglycoside antibiotics, macrolide antibiotics, lincosamide antibiotics, cephalosporins, tetracycline antibiotics, etc., and improve drug resistance by actively expelling antibiotics, changing antibiotic targets, protecting antibiotic targets, etc. Due to the large number of antibiotic resistance genes, it is necessary to combine the results of drug sensitivity tests to comprehensively analyze the antibiotic resistance of RH JS002.

[0140] Experimental Example 12: Antibiotic sensitivity test of Lactobacillus plantarum RH JS002

[0141] Lactobacillus plantarum RH JS002 was activated twice with MRS liquid medium and cultured at 37°C for about 16 hours; the paper diffusion test method was used. The cultured bacterial solution was fully shaken and mixed, 1.5 mL was taken for centrifugation, and the bacterial sludge was washed twice with 1.5 mL PBS buffer and the OD was adjusted. 600 Around 0.6. Take 200 μL of bacterial solution and evenly spread it on the MRS agar medium with an L-shaped coating stick. When no water stains can be seen on the surface of the medium, use sterile tweezers to carefully stick different types of drug-sensitive paper sheets on the upper layer of the plate coated with bacterial solution, press lightly and place it. After standing for a while, place it in a 37°C incubator and culture it upright for 48 hours, and measure the diameter of the inhibition zone.

[0142] The results are shown in Table 7:

[0143] Table 7 Antibiotic susceptibility test

[0144]

[0145] Antibiotic sensitivity test is considered to be a necessary selection criterion for the safety evaluation of probiotics. The above results show that Lactobacillus plantarum RH JS002 is very sensitive to multiple antibiotics such as penicillin, ampicillin, erythromycin, chloramphenicol, etc., and it is believed that Lactobacillus plantarum RH JS002 has application development potential.

[0146] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A plant lactobacillus against Helicobacter pylori, characterized in that: Its deposit number is CGMCCNo:32235.

2. the thalline, fermentation supernatant and / or intracellular material of the described plant lactobacillus of claim 1.

3. An agent or drug for resisting Helicobacter pylori, characterized in that: The method comprises the plant lactobacillus according to claim 1 or the bacterial body, fermentation supernatant and / or intracellular matter according to claim 2.

4. The reagent or drug according to claim 3, characterized in that Pharmaceutically acceptable excipients are also included.

5. A health food for resisting Helicobacter pylori, characterized in that: The method comprises the plant lactobacillus according to claim 1 or the bacterial body, fermentation supernatant and / or intracellular matter according to claim 2.

6. The health food according to claim 5, characterized in that Also included are food-acceptable excipients.

7. The reagent or medicine according to claim 3 or the health food according to claim 5, characterized in that: The dosage form of the reagent or medicine or the health food includes any one of powder, tablet, injection, oral liquid, suppository, gel, patch, spray, lotion and granule.

8. A method for inhibiting Helicobacter pylori for the purpose of non-disease diagnosis and treatment, characterized in that: Adding the plant lactobacillus described in claim 1 or the bacterial cells, fermentation supernatant and / or intracellular substances described in claim 2 inhibits Helicobacter pylori.

9. Use of the plant lactobacillus according to claim 1, the bacterial body, fermentation supernatant and / or intracellular material according to claim 2 in the preparation of anti-Helicobacter pylori medicine or health food.

10. Use of the plant lactobacillus according to claim 1, the bacterial body, fermentation supernatant and / or intracellular material according to claim 2 in the preparation of a medicine or health food for gastric cancer induced by Helicobacter pylori.

Images