An alfalfa polygalacturonase MsPG2, its encoding gene, and applications thereof in plant salt stress tolerance

Abstract

The present invention belongs to the technical field of plant genetic engineering, and relates to a polygalacturonase MsPG2 of alfalfa, its encoding gene, and its application in plant salt stress tolerance. The amino acid sequence of the polygalacturonase MsPG2 is as shown in SEQ ID NO.1 or a derivative sequence or homologous sequence of the amino acid sequence shown in SEQ ID NO.1. The present invention also provides the encoding gene of the polygalacturonase MsPG2, and its nucleic acid sequence is as shown in SEQ ID NO.2; this encoding gene can be induced to express by salt. The present invention realizes the cultivation of MsPG2 transgenic plants by using genetic engineering technology, significantly improves the salt tolerance of the plants, provides an important theoretical basis for the cultivation and breeding of new salt-tolerant varieties of alfalfa, and has great application value.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to a kind of alfalfa polygalacturonase MsPG2 and its encoding gene and its application in plant salt stress tolerance. Background Art

[0002] Alfalfa ( Alfalfa L.) is an important leguminous forage grass, known as the "king of forage grass" for its high yield, excellent grass quality and good palatability. Alfalfa is a perennial, cross-pollinated autotetraploid with a complex genetic background. Traditional breeding methods face great challenges in the selection of stress-resistant varieties. Therefore, it is very necessary to explore resistance genes through reverse genetics and analyze their molecular and physiological mechanisms for alfalfa breeding.

[0003] Soil salinization accounts for about 20% of the world's arable land, which seriously inhibits plant growth and causes yield reduction. Therefore, salt tolerance is one of the most important agronomic traits for crop variety breeding. The salt tolerance of plants depends on the body's ability to absorb and transport Na ions, reactive oxygen ROS metabolism, cell plasticity and other aspects. Among them, the cell wall is extremely important for plants to adapt to salt stress, and plays a role in plants sensing salt stress signals and avoiding salt growth. When the integrity of the cell wall and the cell wall remodeling pathway are damaged, plants show a phenotype that is more sensitive to salt stress. Among the components of the cell wall, cellulose, hemicellulose and pectin are cross-linked to form a complex and dynamically changing network structure to maintain the mechanical properties and ion adsorption properties of the cell wall. Pectin and hemicellulose are negatively charged and reversibly bind cations (Ca 2+ 、Na + etc.), for example, pectin and Ca 2+ Combined to form an "egg box structure" to enhance the rigidity of the cell wall. However, in a high salt environment, Ca 2+ Will be partially + Replacement destroys the "egg box structure" of pectin and inhibits cell elongation growth.

[0004] At present, polygalacturonase has been widely reported to be involved in the softening and shedding of fruit trees (Southern China Fruit Trees, 2017, 46 (3): 14-19), and to promote plant disease resistance by affecting cell wall composition (Microbiology Bulletin, 2023, 50 (8): 3440-3453), but no research has been reported on its involvement in plant response to salt stress. Summary of the invention

[0005] The object of the present invention is to overcome the shortcomings of the prior art, and to provide a Medicago sativa polygalacturonase (MsPG2), its coding gene, and its application in plant salt stress tolerance. The Medicago sativa polygalacturonase MsPG2 has the function of improving the salt tolerance of alfalfa, and can provide theoretical reference and practical guiding significance for the breeding of salt-tolerant Medicago sativa varieties.

[0006] To achieve the above object, the present invention provides a Medicago sativa polygalacturonase MsPG2, and the amino acid sequence of the Medicago sativa polygalacturonase MsPG2 is as shown in (a) or (b) or (c):

[0007] (a) having the amino acid sequence shown in SEQ ID NO.1;

[0008] Further, the amino acid sequence contains four typical conserved domains (NTD, DD, GHG, and RIK) of the plant MSPG2 protein, and belongs to the F subfamily of the MSPG2 family;

[0009] (b) an amino acid sequence derived from (a) by substitution, deletion, or addition of one or several amino acids in the amino acid sequence shown in SEQ ID NO.1 and having the characteristics of the polygalacturonase MsPG2;

[0010] (c) an amino acid sequence having at least 92.44% homology with the amino acid sequence shown in SEQ ID NO.1.

[0011] Further, the Medicago sativa polygalacturonase MsPG2 is an amino acid sequence obtained by deletion, insertion, and / or substitution of 1 to 33 amino acids in the amino acid sequence shown in SEQ ID NO.1.

[0012] Further, the Medicago sativa polygalacturonase MsPG2 is an amino acid sequence obtained by adding 1 to 20 amino acids to the C-terminus and / or N-terminus of the amino acid sequence shown in SEQ ID NO.1.

[0013] Further, the Medicago sativa polygalacturonase MsPG2 is an amino acid sequence that has been artificially modified and has an identity ≥ 92.44% compared with the amino acid sequence of SEQ ID NO.1.

[0014] The present invention also provides a coding gene for the Medicago sativa polygalacturonase MsPG2, and its nucleic acid sequence is as follows (a) or (b) or (c) or (d):

[0015] (a) having the nucleotide sequence shown in SEQ ID NO.2;

[0016] (b) a sequence having at least 95.73% homology with the nucleic acid sequence shown in SEQ ID NO.2;

[0017] (c) a nucleic acid sequence complementary to the nucleotide sequence of SEQ ID NO.2;

[0018] (d) a sequence formed by deletion, insertion and / or substitution of 1 to 49 nucleotides in the nucleic acid sequence shown in SEQ ID NO.2, or addition of less than 60 nucleotides at the 5' and / or 3' ends.

[0019] Further, the nucleic acid sequence of the encoding gene is obtained by alfalfa cloning and / or artificial synthesis methods.

[0020] Further, the nucleic acid sequence of the alfalfa polygalacturonase MsPG2 encoding gene is derived from the alfalfa variety 'WL525'.

[0021] The present invention also provides the application of the alfalfa polygalacturonase MsPG2 or the encoding gene in improving the salt stress tolerance of transgenic alfalfa.

[0022] The present invention also provides a plant expression vector containing the encoding gene. When constructing the plant expression vector, any enhancer promoter or inducible promoter can be added before the transcription start nucleotide.

[0023] The present invention also provides a genetically engineered host cell, which contains the encoding gene of the polygalacturonase MsPG2 or contains the recombinant cloning vector and expression vector constructed from the encoding gene.

[0024] Further, the host cell is an Escherichia coli cell, a Saccharomyces cerevisiae cell or an Agrobacterium cell.

[0025] The present invention also provides the application of the polygalacturonase MsPG2 or the encoding gene or the expression vector or the host cell in genetic engineering.

[0026] The present invention also provides the polygalacturonase MsPG2 or the encoding gene or the expression vector or the host cell in the genetic engineering of improving plant salt tolerance.

[0027] Further, the expression vector carrying the present invention MsPG2 can be used to transform plant cells or tissues by conventional biological methods such as using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroconductivity, Agrobacterium-mediated transformation, etc., and the transformed plant tissues are cultivated into plants.

[0028] Furthermore, the transformed host can be either a monocotyledon or a dicotyledon.

[0029] The present invention also provides the use of the polygalacturonase MsPG2 or the coding gene or the expression vector or the host cell in improving the salt stress tolerance of Medicago sativa.

[0030] Furthermore, an expression vector containing the coding gene of the Medicago sativa polygalacturonase MsPG2 is constructed and transformed into a plant host, and transgenic plants are cultivated and screened.

[0031] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0032] (1) The present invention cloned a coding gene of a polygalacturonase in Medicago sativa in response to salt stress MsPG2 , which can be induced by salt and has a high expression level in stems. MsPG2 mainly alleviates the damage of salt stress and enhances the salt tolerance of plants by changing the cell wall structure of plant cells and reducing the accumulation of Na in vivo.

[0033] (2) The present invention provides a basis for its effective application and has important theoretical value and application significance for cultivating salt-tolerant Medicago sativa varieties.

[0034] (3) The present invention realized the cultivation of MsPG2 transgenic plants by using genetic engineering technology, significantly improved the salt tolerance of the plants, provided an important theoretical basis for the cultivation and breeding of new salt-tolerant Medicago sativa varieties, and has great application value. At the same time, as an excellent salt-tolerant gene resource, it also has important application potential and value in the molecular breeding of salt tolerance in other plants; BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a schematic diagram of the PCR amplification result of the gene involved in the present invention; where M: MsMG2 2K Trans PlusDNA marker; lanes 1-3: ® PCR amplification results. MsPG2 PCR amplification results.

[0036] Figure 2 It is a schematic diagram of the expression pattern of the gene involved in the present invention MsPG2 under different salt treatment times.

[0037] Figure 3 It is a schematic diagram of the expression pattern of the gene involved in the present invention MsPG2 in different tissues.

[0038] Figure 4 It is a schematic diagram of the gene involved in the present invention MsPG2Growth phenotype diagram of transgenic alfalfa under salt treatment.

[0039] Figure 5 This invention relates to MsPG2 The height and biomass of transgenic alfalfa under control and salt treatments, where A is plant height and B is aboveground biomass; GN3 is wild-type Gannong No. 3; OE1 and OE19 are MsPG2 Overexpressing transgenic plants; Ri5B and Ri6B are MsPG2 RNA interference expressing transgenic plants.

[0040] Figure 6 This invention relates to MsPG2 The sodium ion contents in different parts of transgenic alfalfa under control and salt treatments; where A is leaves; B is stems; C is roots; GN3 is wild-type Gannong No. 3; OE1 and OE19 are MsPG2 Overexpressing transgenic plants; Ri5B and Ri6B are MsPG2 RNA interference expressing transgenic plants; different letters indicate significant differences (P<0.05, ANOVA analysis and LSD test).

[0041] Figure 7 This invention relates to MsPG2 Cell wall structure diagram of transgenic alfalfa under control and salt treatments; Detailed implementation manners

[0042] The technical solutions of this invention will be further described in detail below through specific embodiments in conjunction with the accompanying drawings.

[0043] Example 1: MsPG2 Cloning and sequence analysis of genes

[0044] Extraction of total RNA from alfalfa and synthesis of cDNA: Total RNA from leaves of alfalfa 'WL525' was extracted using EasyPure Plant RNA Kit (purchased from TransGen Biotech), and reverse transcription was performed using TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix (purchased from TransGen Biotech) to synthesize cDNA.

[0045] Design and synthesis of primers: Based on the transcriptome data of alfalfa ([[]] Alfalfa L.) 'WL525' under salt treatment and control groups, differentially expressed MsPG2 gene fragments were selected, compared in NCBI, and the Barrel medic gene with relatively high homology to this gene in Medicago truncatula ([[[]] MtPG2Gene. Primers were designed based on this gene sequence, and the upstream primer sequence and downstream primer sequence are shown as follows: MsPG2-F1: 5’-ATGCAGGACTTGTTTATATC-3’ (SEQ ID NO.3); MsPG2-R1: 5’- TTACTGGTGTAGACACAGTG -3’ (SEQ ID NO.4). Using the cDNA of the above alfalfa as a template for homologous cloning, PCR amplification was carried out according to the following reaction system and conditions: 20 μL system, containing 10 μL of 2×EXTaq super PCR Mix (purchased from TaKaRa), 0.8 μL of each of 10 μM MsPG2-F1 and MsPG2-R1 primers, 1 μL of cDNA, and supplemented with deionized water to 20 μL. Reaction conditions: pre-denaturation at 94°C for 5 min; 94°C for 30 s, 57°C for 30 s, 72°C for 1 min, 30 cycles; extension at 72°C for 7 min. After recovering the above amplified fragment, it was ligated with the cloning vector pMD18-T (purchased from TaKaRa), identified by colony PCR, and then sent to Sangon Biotech for sequencing. The sequence result is shown as SEQ ID NO.2.

[0046] The full-length gene sequence of 1194 bp was obtained by PCR amplification. MsPG2 The amino acid sequence of the encoded protein is shown as SEQ ID NO.1, consisting of 397 amino acid residues, and contains four typical conserved domains (NTD, DD, GHG, and RIK) of plant MsPG2 protein. MsPG2 The PCR amplification result of the gene sequence is as Figure 1 shown.

[0047] SEQ ID NO.1:

[0048] MQDLFISGLLIFYIVSCNSFVGFGQNTFNVLQYGAKGDGTSDDTQAFLEAWKALCAANQGTPTLVVPAEHTFFVRQATFKGPCKSQNFHIQIMGNIIAPHRDAWGTCSKRWLYFLDVHGMTVDGSGVINGQGEAWWGNLNGTKGCAANPPPTALLFERCNELQLSGLTHINGPGMHVYVVHSQDVTISHINVSSPKDSHNTDGIDLSNSVRVNIHDSIIQSGDDCIAIKGGSQFINVTQVTCGPGTHGISVGSLGGGGAEEFADHVNVRNCTFNGADSAARIKTWPGGKGYAKAIIFDNIMVNQIRNPIYIQQHYMGAPEQKDAVKVSDVTFSNIYGTCSGDDAIFLDCANIGCDNITLEQIDITSVGPKKPNSAICNNVQGKANNISSPPFHCLHQ*, * indicates the termination of protein translation.

[0049] SEQ ID NO.2:

[0050]

[0051] Example 2: Alfalfa MsPG2 Response pattern of genes to salt treatment

[0052] Cultivation and treatment of alfalfa plants: After removing the coating of the seeds of alfalfa 'WL525' (purchased from Beijing Zhengdao Ecological Technology Co., Ltd.), wash them and evenly distribute them in a growth tray lined with filter paper, keep them moist. When the first true leaf grows after germination, select seedlings with consistent growth and transplant them into 1 / 2 Hoagland nutrient solution for hydroponics. The formula of Hoagland culture solution is as follows: Ca(NO3)2·4H2O 0.62 g / L, KNO3 0.34 g / L, KH2PO4 0.06 g / L, NH4NO3 0.053 g / L, MgSO4 0.24 g / L, MgCl2 0.67 mg / L, H3BO3 0.38 mg / L, MnSO4 0.2 mg / L, ZnSO4·7H2O 0.29 mg / L, CuSO4 0.01 mg / L, FeSO4·7H2O 0.02785 g / L, EDTA-Na2 0.0373 g / L, (pH 5.8), and culture under the conditions of 25°C with 16 h light / 8 h darkness.

[0053] One week later, set two treatments of 0 and 200 mM NaCl respectively. Take the underground roots and above-ground leaves of alfalfa at 0, 1, 3, 6, 9, 12, and 24 h after treatment, quickly place them in liquid nitrogen, and then store them in a -80°C ultra-low temperature freezer.

[0054] Extract total RNA from the taken root and leaf samples, and reverse transcribe it into cDNA, with the method the same as in Example 1. Design real-time fluorescence quantitative PCR primers according to the MsPG2 cDNA sequence. The upstream and downstream primer sequences are as follows: MsPG2 -qRTF1: 5′-GGTGGCTTTATTTCCTTGACG -3′ (SEQ ID NO.5); MsPG2 -qRTR1: 5′- GTTCCATTAAGATTGCCCCAC-3′ (SEQ ID NO.6). Using the alfalfa constitutively expressed gene EF-α as the internal reference gene, the upstream and downstream primer sequences are as follows: MsEF-α-qRTF1: 5'-GCACCAGTGCTCGATTGC-3' (SEQ ID NO.7); MsEF-α-qRTR1: 5'-TCGCCTGTCAATCTTGGTAACAA-3' (SEQ ID NO.8). Using a Bio-rad real-time quantitative PCR instrument, qRT-PCR was performed with the cDNA of the above-mentioned samples as a template. The reaction system contained 10 μL of 2×SYBR qPCR SuperMix (purchased from TransGen Biotech), 0.4 μL of each primer F / R, 2 μL of cDNA, and water was added to a total volume of 20 μL. The reaction program was 30 s at 94 °C; 5 s at 95 °C, 15 s at 57 °C, 15 s at 72 °C, for 40 cycles. Each treatment had 3 biological replicates and 3 technical replicates. The 2 −ΔΔCT -method was used to analyze the data, SPSS 14.0 was used for statistical analysis, and EXCEL was used for graphing.

[0055] MsPG2 The response patterns to salt treatment in the roots and above-ground leaves were as Figure 2 shown. As Figure 2 can be seen, under salt stress, MsPG2 the expression level was up-regulated, reaching the highest level after 3 - 6 hours of treatment, and then the expression level decreased. The above results indicate that MsPG2 is induced to express under salt stress.

[0056] Example 3: MsPG2 Expression patterns of the gene in different tissues

[0057] Plant seedlings were cultured according to the method described in Example 2 without treatment. After about two weeks, samples were taken from the root tips, root bases, stems, leaves (young leaves, mature leaves, and old leaves), petioles, stipules, and apical buds respectively, RNA was extracted, and real-time fluorescence quantitative PCR was performed after reverse transcription. The implementation method was the same as that in Example 2 above, and the results were as Figure 3 shown. As Figure 3 can be seen, MsPG2 had the highest expression level in the stems, followed by the petioles, nodes, and root bases, and had lower expression levels in the leaves, stipules, root tips, and apical buds.

[0058] Example 4 Growth phenotypes of overexpressing or interfering expressing alfalfa MsPG2 plants under salt treatment

[0059] Construction of plant overexpression vector: According to the sequence of the plant overexpression vector pHB and MsPG2Design the upstream primer MsPG2-F2 for the gene sequence: 5′-CTTGATATCGAATTCCTGCAG ATGCAGGACTTGTTTATATC-3′ (SEQ ID NO.9), and the downstream primer MsPG2-R2: 5′-TTATCGATACCGTCACTAGT CTGGTGTAGACAGTGGAAGG-3′ (SEQ IDNO.10). Using the pMD18-T-MsPG2 plasmid in Example 1 as a template, perform PCR amplification with the following reaction system and conditions: 50 μL system, containing 25 μL of 2× Phanta Max Master Mix (purchased from Vazyme), 2 μL each of 10 μM MsPG2-F2 and MsPG2-R2 primers, 2 μL of plasmid template, and make up to 50 μL with deionized water. Reaction conditions: pre-denaturation at 95°C for 3 min; 95°C for 15 s, 57°C for 15 s, 72°C for 1 min 30 s, for 30 cycles; extension at 72°C for 5 min. Electrophoretically detect the above PCR product and cut and recover the gel. Double-digest the plant overexpression vector pHB with the restriction enzymes Pst1 and Spe1, electrophoretically detect the digested product, and cut and recover the gel. Link the above two gel recovery products using seamless cloning according to the following system and conditions to obtain pHB- MsPG2 Plasmid: 4 μL of MsPG2 fragment product, 3 μL of pHB vector digested product, 4 μL of 5× CE II Buffer, 2 μL of Exnase II, make up to 20 μL with deionized water, react at 37°C for 30 min (purchased from Vazyme). Transform the above ligation product into E. coli competent cells and perform sequencing.

[0060] Construction of plant interference expression vector: Design primers MsPG2-Ri-F according to the non-conserved domain segment of the MsPG2 nucleotide sequence: 5′-GAAGGAGCCCTTCACC GGATCC ACAATATCATGGTCAATCAA-3′ (SEQ ID NO.11); MsPG2-Ri-R: 5′- CGGGTTTGAGCTCAAA GAATTC CTGGTGTAGACAGTGGAAGGGA-3′ (SEQ ID NO.12). Perform high-fidelity PCR amplification using the pMD18-T-MsPG2 plasmid as a template (the same PCR reaction system and conditions as in the construction of the plant overexpression vector above). Construct the amplified fragment into the pTOPO vector using seamless cloning to obtain pTOPO- MsPG2Plasmid (the seamless cloning reaction system and conditions in the construction of the above-mentioned plant overexpression vector); For the reaction system of 3 μL of linearized pHellsgate12 plasmid, 1 μL of pTOPO-MsPG2, and 1 μL of LR clone Mix (purchased from Invitrogen), connect at 25 °C for 1 h in a PCR instrument. Transform the above product into Escherichia coli competent cells and perform sequencing.

[0061] Agrobacterium transformation: Transform the pHB- MsPG2 and pHellsgate12- MsPG2 plasmids into Agrobacterium GV3101 competent cells respectively, and perform colony PCR verification. Select positive clones and transfer them into YEB liquid medium containing 50 mg / L Kan and 20 mg / L Rif, 100 mg / L Spe and 20 mg / L Rif respectively, and culture them at 28 °C on a shaker at a speed of 200 rpm until OD600 = 0.8 for infection.

[0062] Explant preparation and infection: The explants are the leaves of Medicago sativa 'Gannong No. 3'. Add a Tween20 solution with a concentration of 0.1 v / v% and an aqueous sodium hypochlorite solution with a concentration of 30 wt% into the culture bottle containing the leaves, and place it on a shaker at 100 rpm for 8 - 10 min for surface sterilization. Then rinse it three times with sterile distilled water. Clip the leaves into the above-prepared bacterial solution containing the overexpression plasmid or the interference expression plasmid for infection, evacuate for 10 min, ultrasonicate for 40 s, and evacuate again for 10 min. Discard the bacterial solution, clip the leaves between two layers of sterile filter paper, and when the residual bacterial solution on the leaf surface is absorbed, transfer it to the co-culture solid medium for dark culture for 4 days. After co-culture, transfer the leaves to the SM4 screening medium, and after about 4 weeks of light culture, transfer them to the MSBK induction and differentiation medium. After small buds differentiate, transfer the callus to the MSS medium, and after about 1 - 2 months, complete leaves grow out, and transfer them to the MSR rooting medium. The medium formula refers to the literature of Fu Chunxiang et al. (Fu, C., Hernandez, T., Zhou, C., et al., Alfalfa ( Alfalfa L.). In Agrobacterium protocols[M]. Springer, New York, 2015: 213 - 221.). After about 1 - 2 months, complete overexpression transgenic plants or interference expression transgenic plants of Medicago sativa can be grown. Identify wild-type, overexpression transgenic plants, and interference expression transgenic plants by PCR and qRT-PCR, select positive plants for cutting and propagation, and perform subsequent physiological phenotype analysis.

[0063] Plant salt treatment: When the wild type, overexpression plants, and RNAi plants grew to a height of 10 cm, they were treated with 1 / 2 Hoagland nutrient solution containing 0 mM NaCl (control group) and 400 mM NaCl (treatment group), respectively. After treatment for about 2 - 3 weeks, the growth phenotypes were observed and photographed, and their plant heights and above-ground fresh weights were measured. The results are as Figure 4 and Figure 5 shown.

[0064] It can be seen Figure 4 that under salt treatment, the growth of the wild type and RNAi plants was significantly inhibited, the leaves turned significantly yellow, and the degree of inhibition of the RNAi plants was significantly higher than that of the wild type. However, the overexpression plants still grew normally and the leaves did not turn significantly yellow. In the control group, the wild type, overexpression transgenic plants, and RNAi transgenic plants all grew normally, and the growth of the overexpression plants was slightly better than that of the wild type and RNAi plants. It can be seen Figure 5 that compared with the control group, the plant heights and above-ground fresh weights of the wild type, overexpression plants (OE1 and OE19), and RNAi plants (Ri5B and Ri6B) in the salt treatment group showed the same change trend.

[0065] Ion content determination: Samples of the wild type, overexpression transgenic plants, and RNAi transgenic plants in the control group and salt treatment group were taken and placed in an oven at 60 °C for 3 days. Equal dry weights of roots, stems, and leaves were weighed into 50 mL centrifuge tubes, 1 mL of HNO3 and 1 mL of H2O2 were added, and digestion was carried out at 120 °C for 2 h until the samples were completely digested. The volume was made up to the same volume with deionized water, and the Na ion content was measured by ICP-MS. The results are as Figure 6 shown. It can be seen Figure 6 that under salt treatment, the Na content in the roots, stems, and leaves of the overexpression plants was significantly lower than that of the wild type, while the Na content in the RNAi plants was higher than that of the wild type or not significantly different from that of the wild type.

[0066] Observation of cell wall structure: The root tip cell wall structures of wild type, overexpressed transgenic plants, and RNAi transgenic plants in the control group and salt-treated group were observed using a scanning electron microscope. The specific method is as follows: The root tips (0 - 1 cm) of the control group or salt-treated samples were placed in 1 mL of 2.5 wt% glutaraldehyde solution, and the samples were completely immersed in the solution and left standing overnight at 4°C. After sucking off the glutaraldehyde solution completely, the samples were washed 4 times with 20 mM HEPES (pH 7.0) at room temperature for 15 minutes each time. Then, the samples were dehydrated successively with ethanol aqueous solutions of different volume concentrations (30%, 40%, 50%, 70%, 85%, 100%), taking care not to touch the root tips during the operation to avoid deformation of the root tip structure. After dehydration, the root tips were wrapped in clean and soft lens paper and subjected to critical point drying in absolute ethanol (EM CPD300, Leica). The dried root tips were sputter-coated with gold for 1 minute in a vacuum coater (Q 150T ES plus, England), and the root tips and the surface cell wall structures were observed using a Raman image-scanning electron microscope (RISE-MAGNA). The results are as Figure 7 shown.

[0067] It can be seen from Figure 7 that in the control group without salt stress, MsPG2 the structures of the root tip cell wall fibers - microfibers of the overexpressed transgenic plants and the wild type were relatively extended. Under salt treatment, the arrangement of the root tip cell wall fibers - microfibers of the wild type and RNAi plants became densely cross-linked and compact, with a reduced porosity; the structure of the root tip cell wall fibers - microfibers of the overexpressed plants was looser, more extended, and had a significantly increased porosity compared to other plants. This indicates that under salt stress, overexpression MsPG2 can maintain the extension of the cell wall structure of alfalfa, relieve the damage to the root tips, reduce the accumulation of Na in the body, and thus improve the salt tolerance of alfalfa.

Claims

1. A Medicago sativa polygalacturonase MsPG2, characterized in that, The amino acid sequence of the alfalfa polygalacturonase MsPG2 is shown in SEQ ID NO.

1.

2. The coding gene of the alfalfa polygalacturonase MsPG2 as described in claim 1, characterized in that, The nucleic acid sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A plant expression vector containing the encoding gene according to claim 2.

4. A genetically engineered host cell, characterized in that, The host cell has the polygalacturonase described in claim 2 MsPG2 encoding gene, or has a recombinant cloning vector and an expression vector constructed from the encoding gene described in claim 2; the host cell is an Escherichia coli cell, a Saccharomyces cerevisiae cell or an Agrobacterium cell.

5. Use of the polygalacturonase MsPG2 according to claim 1, the encoding gene according to claim 2, the expression vector according to claim 3, or the host cell according to claim 4 in improving the salt stress tolerance of alfalfa.

6. Use of the polygalacturonase MsPG2, encoding gene, expression vector or host cell according to claim 5 in improving the salt stress tolerance of alfalfa, characterized in that, Construct an expression vector containing the encoding gene of the alfalfa polygalacturonase MsPG2, transform alfalfa, and cultivate and screen to obtain transgenic alfalfa.

Images