Plant promoter Pxh327 and application

Abstract

The invention discloses a plant promoter Pxh327 and application, the plant promoter Pxh327 is a constitutive expression promoter, is screened from a petunia genome, can drive a target gene to be effectively expressed in various plant tissues, especially has higher transcriptional ability at night than in the daytime, and is suitable for the situation that high expression genes are needed at night; the method has important significance when applied to transgenic plants and plant germplasm resource improvement.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, in particular to a plant promoter Pxh327 and an application thereof. Background Art

[0002] Plant genetic engineering technology is a technical means of using molecular biological experimental methods to isolate and clone target genes, integrate target genes into the plant genome through a transgenic vector system or other physical and chemical methods, and express the target genes in the plant body, thereby achieving the purpose of changing the shape of the plant.

[0003] The most commonly used plant transgenic engineering technology is to integrate the target gene into the plant genome through a plant transgenic expression vector containing the target gene carried by Agrobacterium. The promoter on the plant transgenic expression vector plays the role of regulating gene transcription. According to the function of the promoter, it can be divided into constitutive expression promoter, spatiotemporal specific expression promoter and inducible expression promoter. Among them, the constitutive expression promoter can play a continuous and stable gene transcription function in all tissues of the plant, and the transcription of the gene by the inducible and spatiotemporal specific promoters is affected by inducers or specific developmental periods and tissue locations. Constitutive expression promoters are the most commonly used type of promoters, and are widely used in plant gene function research, plant genetic transformation breeding, plant gene editing and other aspects. Through these applications, gene functions are analyzed, plant traits are improved to improve insect resistance, disease resistance and stress resistance, increase yield, and change phenotypes to create new varieties.

[0004] In plant genetic engineering, it is often necessary to transcribe multiple genes at the same time, and multiple constitutive expression promoters are needed to transcribe the target genes continuously and at a high level. However, there are currently few types of constitutive promoters available, and some of them also have potential biosafety risks. The CaMV (Cauliflower Mosaic Virus) 35S promoter is a promoter from tobacco mosaic virus and is a common promoter in plant transgenic expression vectors. Although it has high transcription ability and can be expressed in most plant tissues, it has the risk of being methylated during the propagation of transgenic plants, causing gene expression silencing. Virus-derived promoters may cause mutations in other plant viruses in nature, enhance the destructive ability of viruses and affect biosafety. Using the same promoter in series with multiple genes can also easily cause gene loss and gene silencing, which increases the difficulty of construction and reduces the stability of the vector during the construction of the vector. Constitutive expression promoters derived from plants themselves have the advantages of low biosafety risk, not easy to be methylated to cause gene silencing, and good stability. Some plant-derived constitutive promoters have the disadvantages of long promoter sequences, which increase the instability and construction difficulty of the vector, and low heterologous expression activity. It was found that mining constitutively expressed promoters from plants is particularly important for the application of plant multi-gene transformation. Summary of the invention

[0005] The present invention amplifies a Pxh327 promoter fragment from petunia genomic DNA. The promoter is a constitutive expression promoter selected from the petunia genome. The promoter can drive the effective expression of target genes in functional tissues such as roots, stems, leaves, and flowers of tobacco, petunia, and tomatoes, and has a stronger transcription ability at night than during the day. The promoter is suitable for situations where high gene expression is required at night, and is expected to provide a better choice for the improvement of transgenic plants and plant germplasm resources.

[0006] The first aspect of the present invention is to provide a plant promoter Pxh327, which is:

[0007] i. the nucleotide sequence as shown in SEQ ID NO: 1;

[0008] ii. a nucleotide sequence complementary to the sequence shown in SEQ ID NO: 1;

[0009] iii. a nucleotide sequence having the same or similar promoter function as the nucleotide sequence shown in SEQ ID NO: 1 obtained by replacing, deleting, or adding one or more nucleotide sequences;

[0010] iv. A derived nucleotide sequence having at least 70% homology with the nucleotide sequence shown in SEQ ID NO: 1 and having equivalent functions; preferably, the homology is at least 80%; more preferably, at least 90%.

[0011] The second aspect of the present invention is to provide the promoter-related biological material in the first aspect, which is any one of the following:

[0012] a) a gene expression cassette containing the promoter according to claim 1;

[0013] b) A recombinant vector containing the promoter as claimed in claim 1.

[0014] The third aspect of the present invention is to provide a host cell, an engineered bacterium or a recipient plant cell comprising the biological material described in the second aspect.

[0015] Furthermore, the engineered bacteria include but are not limited to Escherichia coli, Agrobacterium, etc.; the recipient plant cells are non-reproductive plant cells.

[0016] The fourth aspect of the present invention is to propose the use of promoter Pxh327 in driving the circadian rhythmic expression of exogenous genes in plants; the nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO: 1.

[0017] Furthermore, the driving of the exogenous gene to express in a circadian rhythm in the plant may be to make the expression of the gene show a circadian rhythm or to increase the circadian rhythm expression level of the gene.

[0018] The fifth aspect of the present invention is to propose the use of promoter Pxh327, an expression cassette or vector containing the promoter Pxh327, a host cell, an engineered bacterium or a recipient plant cell containing the promoter Pxh327 in the regulation of plant circadian rhythm or the improvement of plant germplasm resources. The nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO: 1.

[0019] The sixth aspect of the present invention is to propose the use of promoter Pxh327, expression cassette or vector containing the promoter Pxh327, host cells, engineered bacteria or recipient plant cells containing the promoter Pxh327 in cultivating transgenic plants, and the nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO: 1.

[0020] In the applications described in the fourth to sixth aspects above, the plants include crops, trees, vegetables, flowers or forage, including but not limited to tobacco, petunia, tomato and other plants.

[0021] The seventh aspect of the present invention is to propose a method for driving the circadian expression of exogenous genes in plants, wherein the gene is operably connected to the downstream of the promoter Pxh327, and the promoter Pxh327 drives the expression of the exogenous gene. The nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO: 1.

[0022] The eighth aspect of the present invention is to provide primers for specifically amplifying the promoter Pxh327 described in the first aspect, characterized in that the primers have a nucleotide sequence as shown in SEQ ID NO: 3-4.

[0023] The eighth aspect of the present invention is to provide a kit containing the primers described in the eighth aspect.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The plant promoter Pxh327 provided by the present invention is a constitutive expression promoter screened from the petunia genome, which can drive the effective expression of target genes in various plant tissues, especially has stronger transcription ability at night than during the day, and is suitable for situations where high gene expression is required at night; it is of great significance to be applied to the improvement of transgenic plants and plant germplasm resources.

[0026] The plant promoter Pxh327 sequence provided by the present invention has very low similarity with commonly used promoters (promoters such as CaMV 35S, ZmUbi, Nos) or plant endogenous promoters reported in other literature, so when used in an expression vector with other promoters at the same time, mutual interference can be reduced to ensure the normal progress of transcription function. The promoter length is only 1080bp, which is shorter than the common plant-derived promoter sequence, and is suitable for constructing a multi-gene expression vector, because the sequence length carried by the vector is limited, the shorter the sequence is, the more stable the vector is, and the surplus load is left for the loading of other genes. The acquisition of plant promoter Pxh327 increases the number of optional constitutive expression promoters, avoids the occurrence of gene expression silencing and loss caused by reusing the same promoter. The biosafety risk of the promoter of plant origin is low, and the problem of biosafety risk of promoter of virus origin is solved.

[0027] The plant promoter Pxh327 provided by the present invention drives the expression of exogenous genes in a wide tissue range, for a long duration, with high expression intensity, and further improves the expression intensity at night, and is suitable for gene application environments that require higher expression at night. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a schematic diagram of the IDs of the top 20 highly expressed genes with high expression levels at 8 o'clock in the evening obtained in Example 1 of the present invention.

[0029] Figure 2 Schematic diagram of the Pxh327 plant genetic transformation vector constructed in Example 2 of the present invention.

[0030] Figure 3 This is an agarose gel electrophoresis diagram of the PCR system products in Example 2 of the present invention.

[0031] Figure 4 This is a schematic diagram of the wild-type control plant provided in Example 3 of the present invention.

[0032] Figure 5 This is the intention of the transgenic positive tobacco plant provided in Example 3 of the present invention.

[0033] Figure 6 These are the expression results of the pxh327 promoter relative to the internal reference Actin in tobacco leaves at three time points in Example 3 of the present invention.

[0034] Figure 7 These are the expression results of the Pxh327 promoter relative to the internal reference Actin7 in petunia leaves at three time points in Example 4 of the present invention.

[0035] Figure 8 These are the expression results of the Pxh327 promoter relative to the internal reference Actin7 in tomato leaves at three time points in Example 5 of the present invention. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037]

[0038] Example 1 Obtaining the Pxh327 promoter fragment

[0039] At 8:00, 14:00, 20:00, and 23:00, petunia flowers, young leaves, and old leaves were collected to extract RNA. RNA-seq sequencing was performed on these RNA samples. The sequencing results were compared with the reference genomes of petunia P. axillaris and petunia P. integrifolia to obtain the statistical results of the expression of each gene. The expression of each gene in the old leaves at 20:00 was sorted from high to low, and the gene IDs with high expression at 8:00 p.m. were obtained. The top 20 highly expressed gene IDs were obtained as follows: Figure 1As shown. Through the obtained gene ID, the 1000bp reference sequence upstream of the ORF (open reading frame) of the corresponding gene was searched on the website https: / / solgenomics.net / . The 1000bp reference sequence upstream of the ORF (open reading frame) of the Peaxi162Scf00684g00327 gene was obtained, Peaxi162Scf00684g00327_1000bp, and the sequence was: agctgattggtcctctagtggatgaaaaagcatgtggacataataattcattattcaactaactgctaaagcagt(SEQID NO:2)。

[0040] Primers seqPF and seqPR were designed with Peaxi162Scf00684g00327_1000bp as reference.

[0041] The promoter fragment of Px h327 was obtained by PCR amplification of petunia genomic DNA using primers seqPF and seqPR. The variety used in the experiment was Petunia x hybrida, Mitchell diploid (W115), and its ancestors P. integrifolia and P. axillaris can be queried at https: / / solgenomics.net / organism / Petunia_axillaris / genome and https: / / solgenomics.net / organism / Petunia_inflata / genome as genome references (A draft sequence of the Petunia axil laris genome, one of the ancestors of Petunia hybrida, is publicly available (Bombarely et al, 2016). A draft sequence of the Petunia inflata genome, on e of the ancestors of Petuniahybrida, is publicly available (Bombarely et al, 2016).)

[0042] The specific sequences of the primers are as follows:

[0043] seqPF: agctgattggtcctctagtggatg (SEQ ID NO: 3)

[0044] seqPR:tgagataatttttttataacagagaa (SEQ ID NO: 4)

[0045] The PCR amplification system is as follows:

[0046] Make a 50uL system and perform the amplification reaction according to the following procedure:

[0047] PCR system:

[0048]

[0049] Amplification Procedure:

[0050]

[0051]

[0052] Use 1% agarose gel electrophoresis for PCR system products at 5v / cm for 20 minutes, cut out the 1080bp electrophoresis fragment under ultraviolet light, use DNA agarose gel recovery kit for sol recovery, refer to the kit instructions of the specific manufacturer for the recovery procedure, use a total volume of 40uL of water to dissolve and recover DNA (the recovered product is marked as: Pxh327_seg), and use the Beyotime Ultra-Fast DNA Ligation Kit to obtain the cloning vector product carrying Pxh327_seg. Refer to the kit instructions of the specific manufacturer for the specific operation, transform the cloning vector product into DH10B Escherichia coli competent cells, obtain monoclonal colonies through resistance screening, randomly pick 3 monoclonal colonies and send them to the sequencing company for sequencing, use 4 ml of LB liquid culture medium to culture the correctly sequenced colonies overnight, extract the plasmid from the cultured Escherichia coli, dissolve it in 50 microliters of deionized water and mark it as Pxh327_V.

[0053] Example 2 Construction of Pxh327 plant genetic transformation vector

[0054] Primers seqPF_2 and seqPR_2 were synthesized and used to amplify Pxh327_V as a template to obtain the Pxh327_rm fragment by PCR. The Pxh327_rm fragment was assembled into the pBWA(V)K-ruby (preserved in the laboratory) linearized by bsai restriction endonuclease using the Gibson assembly reaction using Biorun 2*EasyClone Mix to obtain pBWA(V)K-Pxh327-ruby ( Figure 2 ),like Figure 2 As shown, Pxh327 is inserted upstream of the RUBY gene module to drive the expression of the RUBY gene. The RUBY gene module can express three proteins related to betaine biosynthesis, converting tyrosine into betaine red pigment visible to the naked eye. The level of promoter activity can be judged by observing the depth of red.

[0055] The specific sequences of the primers are as follows:

[0056] seqPF_2: TGGCAAGCTGCTCTAGCAACagctgattggtcctctagtggatg (SEQ ID NO: 5)

[0057] seqPR_2: GCGAGGGTCGCATGATCCATtgagataatttttttataacagagaa (SEQ ID NO: 6)

[0058] The PCR amplification system is as follows:

[0059] Make a 50uL system and perform the amplification reaction according to the following procedure:

[0060] PCR system:

[0061]

[0062] Amplification Procedure:

[0063]

[0064] The PCR system product was electrophoresed on a 1% agarose gel at 5 v / cm for 20 minutes. The 1080 bp electrophoresis fragment ( Figure 3 ) was cut out under ultraviolet light and the sol was recovered using a DNA agarose gel recovery kit. The recovery procedure was described in the kit instructions of the specific manufacturer. The DNA was dissolved and recovered in a total volume of 40uL of water.

[0065] The Gibson assembly reaction system is as follows:

[0066]

[0067] After 30 minutes of reaction, 5-10uL of the ligation product was transformed into DH10B competent E. coli, and the transformed cells were coated on the corresponding resistance plate of the vector and cultured at 37°C for 12 hours. Multiple monoclonal colonies were randomly picked for sequencing, and a monoclonal colony with correct sequencing was cultured overnight in 4 ml of LB liquid culture medium. The plasmid was extracted from the cultured E. coli, dissolved in 50 microliters of deionized water and labeled as pBWA(V)K-Pxh327-ruby.

[0068] Example 3: Transforming the Pxh327-ruby gene into tobacco cells to obtain tobacco plants carrying the target gene

[0069] The specific process is as follows:

[0070] 1. Preparation of Agrobacterium carrying pBWA(V)K-Pxh327-ruby

[0071] Take 1ul of pBWA(V)K-Pxh327-ruby plasmid and add it to the electroporation competent cell of Agrobacterium EHA105, and transform it with 1.8KV electric shock. The transformed competent cells are spread on LB solid plates containing kanamycin and rifampicin resistance, and cultured at 28℃ for 2 days. Pick single clones and use seqPF and seqPR primers for colony PCR detection. The colony that can amplify the 1080bp target band is the positive colony. Pick the positive colony and use 4ml of liquid LB containing kanamycin and rifampicin resistance to shake the bacteria for 2 days, and save the bacterial solution for infecting tobacco cells.

[0072] 2. Agrobacterium-mediated genetic transformation of tobacco

[0073] 2.1 Pre-culture

[0074] Tobacco seeds were sterilized in 75% alcohol for 30 seconds, washed with sterile water for 1 minute, and then sterilized with 84 disinfectant for 3-5 minutes, and washed with sterile water for 3 times, 1 minute each time. The sterilized tobacco seeds were sown on the germination medium, cultured at 23℃ with 16h / 8h light / dark for 4-5 weeks, and the sterilized tobacco leaves were cut into small pieces with a scalpel and inoculated on the pre-culture medium.

[0075] 2.2 Agrobacterium infection and co-cultivation

[0076] Take the prepared pBWA(V)K-Pxh327-ruby Agrobacterium and revive it on the LB solid plate with kanamycin and rifampicin resistance, pick the revived Agrobacterium in the infection solution, prepare the Agrobacterium resuspension with OD600=0.2, inoculate the tobacco leaves pre-cultured for 2-3 days in the Agrobacterium suspension and infect for 10-15 minutes, inoculate the infected tobacco leaves on filter paper, dry them and inoculate them on the co-culture medium, and culture them in the dark for 48-72 hours.

[0077] 2.3 Induction

[0078] After 2 days of co-cultivation, the leaves were transferred to the induction medium to induce callus for about 10 days until callus tissue grew.

[0079] 2.4 Screening

[0080] Select callus tissue that meets the standards and inoculate it on the corresponding resistance screening medium. The culture time is 15-30 days and the culture temperature is: 23±2℃.

[0081] 2.5 Differentiation and rooting

[0082] Inoculate the second screened positive callus tissue with vigorous growth on the differentiation medium, 4-5 calli / dish, and culture at 23℃ with 16h / 8h light / dark for 15-30 days. During the differentiation process, if seedlings are formed from the callus, inoculate them on the seedling medium and grow them for 7-10 days.

[0083] 2.6 Detection and transplanting

[0084] The tobacco genomic DNA was extracted by CTAB method and PCR detection was performed. The detection method is as shown in the Agrobacterium colony PCR in step 1 of Example 3. The tobacco surface with amplified positive target bands was transplanted to a culture medium mixed with nutrient soil and vermiculite in a ratio of 1:1 and placed in an environmental nursery room at room temperature of 25°C, with 12 hours of light and 12 hours of darkness.

[0085] 3. Expression Analysis in Tobacco Tissues

[0086] Observation of transgenic tobacco seedlings revealed that the roots, stems and leaves of the entire plant were red ( Figure 5 ), while the wild-type control plants had green leaves and stems and white roots ( Figure 4 ), indicating that betalain is expressed in all tissues of the plant and remains red throughout the entire growth cycle, indicating that the promoter is an efficient and stable constitutive promoter.

[0087] 4. Expression levels at different time points in tobacco leaves

[0088] The leaves of four independent transgenic plants were collected at three time points: morning (9 o'clock), mid-day (14 o'clock), and evening (19 o'clock), and fluorescence quantitative PCR was performed to determine the expression intensity of the Px327 promoter at different time points. The specific experimental steps are as follows:

[0089] 4.1 RNA extraction

[0090] Reference Plant RNA Kit Plant RNA extraction kit instructions.

[0091] The RNA solution can be stored at -80℃ for a long time.

[0092] 4.2 Reverse transcription of RNA into cDNA

[0093] Refer to the instructions of Evo M-MLV RT Mix Kit with gDNAClean for qPCR Ver.2, prepare 20uL reverse transcription reaction system on ice, use the maximum amount of RNA, incubate at 37℃ for 15min, 85℃ for 5sec, and cool on ice. Can be stored at -20℃ for a short period of time.

[0094] Detection targets and primers:

[0095] RUBY-114F:CGTTGACCCATCTGGCATTA (SEQ ID NO: 7)

[0096] RUBY-114R:GTAGTTGTGGTGGAGGAATCTG (SEQ ID NO: 8)

[0097] actin:ACCACTGCAGAACGGGAAAT (SEQ ID NO: 9)

[0098] actin:CCGATCATGGATGGCTGGAA(SEQ ID NO: 10)

[0099] Fluorescence quantitative PCR system and conditions:

[0100] ①Reaction system (20uL)

[0101]

[0102] ②Reaction conditions

[0103]

[0104] After the program runs, the generated data is calculated using the formula, where the calculation formula is as follows:

[0105] A = CT (target gene, sample to be tested) - CT (reference gene, sample to be tested)

[0106] B = CT (target gene, control sample) - CT (reference gene, control sample)

[0107] △△CT=AB

[0108] Relative expression level = 2 -△△CT

[0109] The final relative quantitative (ΔΔCT method) calculation results are as follows Figure 6 As shown, the results show that the expression level of pxh327 promoter was higher than that of internal reference actin at three time points, indicating that the promoter has strong transcriptional expression ability and its activity is further enhanced at night.

[0110] Example 4: Transforming the Pxh327-ruby gene into petunia cells to obtain petunia plants carrying the target gene

[0111] Referring to Example 3, the Pxh327-ruby gene was transformed into petunia cells. In order to determine the expression level of the promoter pxh327 in petunia leaves at different time points, leaves of four independent transgenic plants were taken at three time points: early (9 o'clock), mid (14 o'clock), and late (19 o'clock), and fluorescent quantitative PCR was performed to determine the expression intensity of the Px327 promoter at different time points. The results are shown in FIG. Figure 7As shown, it can be seen that the expression level of pxh327 promoter was higher than that of internal reference actin7 at three time points, indicating that the promoter has strong transcriptional expression ability and its activity is further enhanced at night.

[0112] Example 5: Transforming the Pxh327-ruby gene into tomato cells to obtain dwarf tomato plants carrying the target gene

[0113] Referring to Example 3, the Pxh327-ruby gene was transformed into tomato cells. In order to determine the expression level of the promoter pxh327 in tomato leaves at different time points, the transgenic plant leaves of three independent transgenic lines of T0 generation (Peaxi0327-3, Peaxi0327-5, Peaxi0327-9) were taken in this example. The expression intensity of the Px327 promoter at different time points was determined by fluorescence quantitative PCR detection at three time points: morning (9 o'clock), mid-day (14 o'clock), and evening (19 o'clock). The results are shown in Figure 2. Figure 8 As shown, it can be seen that the expression level of pxh327 promoter was higher than that of internal reference actin7 at three time points, indicating that the promoter has strong transcriptional expression ability and its activity is further enhanced at night.

[0114] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Plant promoter Pxh327, characterized in that The promoter Pxh327 is: i. the nucleotide sequence as shown in SEQ ID NO: 1; ii. a nucleotide sequence complementary to the sequence shown in SEQ ID NO: 1; iii. a nucleotide sequence having the same or similar promoter function as the nucleotide sequence shown in SEQ ID NO: 1 obtained by replacing, deleting, or adding one or more nucleotide sequences; iv. A derivative nucleotide sequence having at least 70% homology to the nucleotide sequence shown in SEQ ID NO: 1 and having equivalent functions.

2. The promoter-related biological material according to claim 1 is any one of the following: a) a gene expression cassette containing the promoter according to claim 1; b) A recombinant vector containing the promoter as claimed in claim 1.

3. A host cell, engineered bacteria or recipient plant cell comprising the biological material according to claim 2.

4. Application of promoter Pxh327 in driving circadian rhythmic expression of exogenous genes in plants; the nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO:

1.

5. Application of promoter Pxh327, expression cassette or vector containing the promoter Pxh327, host cells, engineered bacteria or recipient plant cells containing the promoter Pxh327 in regulating plant circadian rhythm or improving plant germplasm resources. The nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO:

1.

6. Use of promoter Pxh327, expression cassette or vector containing the promoter Pxh327, host cells, engineering bacteria or recipient plant cells containing the promoter Pxh327 in cultivating transgenic plants, the nucleotide sequence of the promoter Pxh327 is shown in SEQ ID NO:

1.

7. The use according to claims 4-6, characterized in that: The plants include tobacco, petunia, and tomato.

8. A method for driving circadian rhythmic expression of exogenous genes in plants, characterized in that: The gene is operably connected to the downstream of promoter Pxh327 to drive the expression of the exogenous gene with promoter Pxh327. The nucleotide sequence of promoter Pxh327 is shown in SEQ ID NO:

1.

9. Primers for specifically amplifying the promoter Pxh327 according to claim 1, characterized in that: The primers have nucleotide sequences shown in SEQ ID NO: 3-4.

10. A kit comprising the primers according to claim 9.

Images