Toona sinensis BLH3 gene and its application in efficient genetic transformation and regeneration of Toona sinensis

Abstract

The present invention relates to the technical field of plant tissue culture, and more specifically, to the Toona sinensis BLH3 gene and its application in efficient genetic transformation and regeneration of Toona sinensis. The Toona sinensis BLH3 gene of the present invention has a nucleotide sequence as shown in SEQ ID NO.3 and has the function of promoting root growth. Using the genetic transformation and regeneration method of the present invention for tissue culture of Toona sinensis has the characteristics of a high plant multiplication multiple, a short rooting time, a large number of strong roots, and a high genetic transformation efficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of plant tissue culture, and particularly to the Toona sinensis BLH3 gene and its application in efficient genetic transformation and regeneration of Toona sinensis. Background Art

[0002] Toona sinensis (A.Juss.) Roem. is a perennial woody plant in the Meliaceae family and Toona genus. The leaves of Toona sinensis are seasonal delicacies, rich in vitamins and secondary metabolites such as flavonoids, and contain volatile aromatic organic compounds such as toonasin. They not only help enhance the body's immune function but also strengthen the spleen and stimulate the appetite. The wood of Toona sinensis is yellowish-brown with red bands, has beautiful texture, and has the advantages of durability, corrosion resistance, high density, and antibacterial properties, and is widely used, enjoying the reputation of "Chinese mahogany".

[0003] At present, with the in-depth research on the food and medicinal values of Toona sinensis buds, as the only woody vegetable, there has been a boom in Toona sinensis in the market. The previous open-field cultivation mode limited to spring harvest can no longer meet people's needs. Due to the small amount of Toona sinensis seeds, limited resources, and dioecy, the traits of offspring propagated by seeds are prone to segregation and degradation. The propagation coefficient by methods such as cutting seedlings, burying roots, and tillering is very low. The terminal buds have dormancy phenomena and slow growth rates, making it difficult to meet production requirements. Although tissue culture has become an important propagation method for Toona sinensis, most of them have a low multiplication multiple of adventitious buds (3 - 5 times), a very low rooting efficiency (about 25%), a long cycle, and a lack of a genetic transformation system, seriously hindering the development of Toona sinensis transgenic breeding.

[0004] Therefore, providing a method for efficient genetic transformation and regeneration of Toona sinensis is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] The purpose of the present invention is to provide the Toona sinensis BLH3 gene and its application in efficient genetic transformation and regeneration of Toona sinensis. Using the Toona sinensis BLH3 gene and method of the present invention for tissue culture of Toona sinensis has the characteristics of high plant regeneration efficiency, short rooting time, strong roots, and high genetic transformation efficiency.

[0006] To achieve the above purpose, the present invention provides the following technical solutions:

[0007] The present invention provides a Toona sinensis BLH3 gene, and its nucleotide sequence is as shown in SEQ ID NO.3.

[0008] The present invention also provides an application of the Toona sinensis BLH3 gene in efficient genetic transformation and regeneration of Toona sinensis.

[0009] The present invention also provides a method for efficient genetic transformation and regeneration of Toona sinensis, including the following steps:

[0010] (1) After disinfecting and sterilizing the toon stem segments with axillary buds, inoculate them in MS medium and culture for one month to obtain sterile lateral branches; transfer the sterile lateral branches to the differentiation medium and culture until callus forms at the base;

[0011] (2) Connect the toon BLH3 gene to the expression vector pBI121-GFP to construct the recombinant expression vector pBI121-BLH3-GFP;

[0012] (3) Transform the recombinant expression vector pBI121-BLH3-GFP into Agrobacterium. Take the Agrobacterium containing the recombinant expression vector pBI121-BLH3-GFP and suspend it in sterilized MS liquid medium. After adding acetosyringone, obtain the infection solution; infect the callus with the infection solution, and transfer the callus to the co-culture medium after infection for dark culture;

[0013] (4) Transfer the co-cultured callus to the screening medium for dark culture until adventitious buds are generated, and then transfer it to the light for continuous culture until the height is ≥3 cm to obtain transformed small plants;

[0014] (5) Transfer the transformed small plants to the rooting medium and culture until 4 - 6 young roots are formed. When the root system is 3 - 4 cm long and the seedling height is ≥4 cm, obtain complete regenerated transgenic plants.

[0015] Preferably, the components of the differentiation medium in step (1) are 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 35 g / L, agar 5 - 8 g / L, and make up to 1 L with MS medium, pH 5 - 6.

[0016] Preferably, the nucleotide sequences of the primers used in the construction of the recombinant expression vector in step (2) are as shown in SEQ ID NO.4 - 5.

[0017] Preferably, the components of the co-culture medium in step (3) are 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 35 g / L, agar 5 - 8 g / L, acetosyringone 80 - 120 μmol / L, and make up to 1 L with MS medium, pH 5 - 6.

[0018] Preferably, the components of the screening medium in step (4) are 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 40 g / L, agar 5 - 7 g / L, kanamycin 20 - 40 mg / L, ticarcillin 150 - 300 mg / L, and supplemented to 1 L with MS medium, pH 5 - 6.

[0019] Preferably, the components of the rooting medium in step (5) are IBA 0.8 - 1.0 mg / L, paclobutrazol 0.4 - 0.6 mg / L, sucrose 15 - 25 g / L, agar 5 - 7 g / L, ticarcillin 150 - 300 mg / L, and supplemented to 1 L with 1 / 2 MS medium, pH 5 - 6.

[0020] Preferably, except for dark culture, the culture conditions in steps (1) - (5) are: temperature 23 - 25 °C, humidity 70 - 80%, light intensity 1500 - 2000 lx, duration 16 h / day.

[0021] Preferably, after obtaining the regenerated transgenic plants in step (5), they need to be transplanted into a plant culture room, and the conditions of the plant culture room are temperature 23 - 27 °C, humidity 60 - 80%, light intensity 200 - 400 μmol / m 2 / s, duration 14 h / day.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] Using the regeneration method of the present invention for Toona sinensis tissue culture, the plant multiplication multiple can reach 10 times, the roots are well-developed and grow to 3 - 4 cm, the plant multiplication multiple is high and the roots are robust; in addition, the BLH3 gene of the present invention also has the effect of promoting root growth. Transforming the Toona sinensis BLH3 gene of the present invention into Toona sinensis for tissue culture, the transgenic plants have better root growth. After 25 days of rooting, the roots are well-developed and grow to 3 - 4 cm, and the number of roots can reach 6 - 8, and the transformation rate is as high as 54.2%. It has many advantages such as short rooting time, many and robust root numbers, high genetic transformation efficiency, and high transplanting survival rate. Description of the Drawings

[0024] Figure 1 It is the germination diagram of the axillary bud stem segment of Toona sinensis in Example 1;

[0025] Figure 2 It is the adventitious bud differentiation diagram of Toona sinensis in Example 1;

[0026] Figure 3 It is the adventitious bud differentiation callus and proliferation diagram of Toona sinensis in Example 1;

[0027] Figure 4 Identification diagram of Agrobacterium tumefaciens EHA105 competent transformation in Example 2; where M: DL2000 Marker; 2-11 are pBI121-BLH3-GFP, 1 is the negative control; 12 is the positive control;

[0028] Figure 5 Diagram of Agrobacterium tumefaciens infecting callus in Example 2;

[0029] Figure 6 Diagram of adventitious bud differentiation of callus after dark culture in Example 2;

[0030] Figure 7 Diagram of rooting of transformed plantlets in Example 2;

[0031] Figure 8 Diagram of transplanting regenerated transgenic plants in Example 2;

[0032] Figure 9 Identification diagram of transgenic Toona sinensis lines, where M: DL2000 Marker; + is the plasmid as the positive control, - is the non-transgenic Toona sinensis as the negative control, and Ts1-Ts8 are the regenerated transgenic plants. Detailed implementation method

[0033] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be construed as limiting the protection scope of the present invention.

[0034] Example 1

[0035] A method for efficient regeneration of Toona sinensis, comprising the following steps:

[0036] 1. After collecting the axillary bud-bearing stem segments of Toona sinensis in the wild and bringing them back to the laboratory, rinse them with running water overnight, disinfect them with 70% alcohol for 1 min in a laminar flow hood, disinfect them with sodium hypochlorite for 50 min, and inoculate them on MS medium. After one month, sterile lateral branches are obtained (see Figure 1 ).

[0037] 2. Transfer the sterile lateral branches to the differentiation medium and culture for 7 days. Callus and callus cluster buds begin to differentiate at the base of the stem (see Figure 2 ), and continue to culture for 18 days until the cluster buds grow to 2 cm to obtain adventitious buds.

[0038] The differentiation medium consists of MS medium + 6-BA 1.0 mg / L + KT 1.0 mg / L + NAA 0.05 mg / L + sodium nitroprusside 6 mg / L + sucrose 30 g / L + agar 6.5 g / L, pH 5.8;

[0039] 3. Transfer the adventitious buds to the rooting medium and culture for 10 days to form 4-6 young roots, obtaining rooted tissue culture seedlings;

[0040] The rooting medium consists of 1 / 2 MS medium + 1.0 mg / L IBA + 0.5 mg / L paclobutrazol + 20 g / L sucrose + 6.5 g / L agar, pH 5.8;

[0041] 4. Acclimatization and transplantation.

[0042] The rooted tissue culture seedlings are cultured for another 10 days. When the roots are well-developed, 3 - 4 cm long and the seedling height is ≥ 4 cm, they are transplanted into a cultivation substrate with a volume ratio of peat soil: vermiculite: perlite of 3:3:1 and cultured in a plant culture room.

[0043] Conditions in the tissue culture room: temperature 24°C, humidity 75%, light intensity 1800 lx, duration 16 h / day.

[0044] Conditions in the plant culture room: temperature 25°C, humidity 70%, light intensity 300 μmol / m 2 / s, duration 14 h / day.

[0045] In Example 1 of the present invention, another adventitious bud from step 2 is transferred to a fresh differentiation medium for subculture proliferation culture for 25 days. As a result, a large amount of callus and callus cluster buds are differentiated at the base of the stem. After cutting, it can be separated into 10 adventitious buds, and the average proliferation multiple is counted as 10 (see Figure 3 ).

[0046] Example 2 A method for efficient genetic transformation and regeneration of Toona sinensis, comprising the following steps:

[0047] I. Preparation of the binary plant recombinant expression vector pBI121 - BLH3 - GFP

[0048] 1. Cloning of the Toona sinensis BLH3 gene

[0049] Using the Toona sinensis genome (CNSA: https: / / db.cngb.org / search / project / CNP0000958 / ) as a reference, primers for amplifying BLH3 are designed. The primer sequences are as shown in SEQ ID NO.1 - 2. The cDNA sequence is amplified in Toona sinensis and sequenced by Zhejiang Shangya Company. The sequence of the Toona sinensis BLH3 gene after sequencing is as shown in SEQ ID NO.3 below;

[0050] F1 (shown in SEQ ID NO.1): 5’ - TCTCGATTTCAAGGAGAGCA - 3’;

[0051] R1 (shown in SEQ ID NO.2): 5’ - ACCCCATATTTGCAGCTACC - 3’.

[0052] The sequencing sequence (shown in SEQ ID NO.3) is as follows:

[0053]

[0054] The PCR reaction system is shown in Table 1 below:

[0055] Table 1 PCR reaction system (25 μL)

[0056]

[0057]

[0058] The PCR reaction program is as follows:

[0059]

[0060] 2. Restriction digestion of the vector plasmid

[0061] The linearized vector plasmid pBI121-GFP was obtained by double restriction digestion, and its reaction system is shown in Table 2 below.

[0062] Table 2 Double restriction digestion reaction system

[0063] Component Volume (μL) Vector plasmid pBI121-GFP 2 μg XbaⅠ 2 μL KpnⅠ 2 μL Cutsmart 5 μL <![CDATA[ddH2O]]> Add up to 50 μL

[0064] The prepared restriction digestion system was placed in a PCR tube, pipetted and mixed well, taken out after standing at 37 °C for 3 h, and purified and recovered using a PCR product purification kit for standby.

[0065] 3. PCR amplification

[0066] To ensure the consistency of the target sequence, the template is the nucleotide sequence described in SEQ ID NO.3. According to the characteristics of seamless assembly, primer sequences with vector adapters were designed, and the primer sequences are shown in SEQ ID No.4 - 5 below.

[0067] F2 (as shown in SEQ ID No.4):

[0068] 5’-agaacacgggggactctagaATGGGTGCTTATAATCCAAG-3’

[0069] R2 (as shown in SEQ ID NO.5):

[0070] 5’-ctcaccatggtacccccgggCACTACAAAATCATGCATCA-3’

[0071] The PCR reaction system and program are the same as the gene cloning step in step 1, and the amplified product was purified and recovered using a PCR product purification kit.

[0072] 4. Seamless assembly to construct the recombinant plasmid

[0073] Prepare a seamless assembly reaction system (10 μL) as shown in Table 3 below.

[0074] Table 3 Seamless assembly reaction system

[0075]

[0076] Place the prepared reaction system in a 37 °C water bath, take it out after standing for 30 min.

[0077] 5. Transform Escherichia coli competent DH5α (Vidi Biotechnology, DL1001S) with the reaction mixture by heat shock method.

[0078] 6. Positive clone identification

[0079] Pick a single colony grown overnight and inoculate it into a liquid LB medium containing 50 mg / L kanamycin resistance, shake the bacteria, and then perform colony PCR verification (see Figure 4 ), use primers F2 and R2, and the PCR reaction system (25 μL) is as shown in Table 4 below.

[0080] Table 4 PCR reaction system

[0081] Component Volume (μL) F2 1 R2 1 2×PhantaMax Master Mix 12.5 Bacterial solution 1 <![CDATA[ddH2O]]> 9.5

[0082] The PCR reaction program is

[0083]

[0084] For those with correct PCR verification, perform sequencing. The sequencing result is 2079 bp, which is the recombinant expression vector pBI121 - BLH3 - GFP.

[0085] II. Transformation of Agrobacterium

[0086] Transform Agrobacterium tumefaciens competent cell EHA105 by electroporation. Add 4 μl of the recombinant expression vector pBI121 - BLH3 - GFP to the competent cell EHA105 dissolved on ice, mix well, then transfer it to a pre - cooled electroporation cuvette, and perform transformation according to the instrument instructions. The voltage of the electroporator is set to 2.0 kv. Immediately add 1 ml of LB medium to the transformation cuvette, transfer it to a 1.5 ml centrifuge tube, and culture it with shaking at 28 °C for 4 hours. After slightly centrifuging to remove an appropriate amount of the medium, spread it on a plate containing 50 mg / L kanamycin appropriately, and culture it at 28 °C for 3 days. Pick a single colony and use the PCR method to identify whether the target plasmid has been transferred (the method is the same as the positive clone identification of Escherichia coli).

[0087] III. Infection transformation and co - culture

[0088] The monoclonal strain of Agrobacterium tumefaciens EHA105 containing the recombinant expression vector pBI121-BLH3-GFP was cultured in LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin at 28 °C for 3 days. The Agrobacterium cells were collected and suspended in sterilized MS liquid medium. The OD 600 of the cell suspension was adjusted to 0.4 - 0.6, and then acetosyringone with a final concentration of 100 μmol / L was added to obtain the infection solution;

[0089] During infection, the callus (0.5 cm × 0.5 cm) at the base of the sterile lateral branch stem in Example 1 was selected and infected with 200 ml of the infection solution. After 30 minutes of infection, the callus was taken out, blotted dry to remove the residual infection solution, and then transferred to the co-culture medium for dark culture for 3 days (see Figure 5 );

[0090] The composition of the co-culture medium is as follows:

[0091] MS medium + 6-BA 1.0 mg / L + KT 1.0 mg / L + NAA 0.05 mg / L + sodium nitroprusside 6 mg / L + sucrose 30 g / L + agar 6.5 g / L + acetosyringone 100 μmol / L, pH 5.8.

[0092] IV. Screening and differentiation of callus

[0093] The co-cultured callus was transferred to the screening medium for dark culture for 10 days to differentiate adventitious buds, and then transferred to the light for growth for 10 days until the height was ≥ 3 cm to obtain the transformed plantlets (see Figure 6 );

[0094] The composition of the screening medium is as follows:

[0095] MS medium + 6-BA 1.0 mg / L + KT 1.0 mg / L + NAA 0.05 mg / L + sodium nitroprusside 6 mg / L + sucrose 30 g / L + agar 6.5 g / L + kanamycin 30 mg / L + ticarcillin 200 mg / L, pH 5.8.

[0096] V. Rooting of transformed plantlets

[0097] The transformed plantlets were transferred to the rooting medium for culture for 25 days until 6 - 8 young roots were formed (see Figure 7 ). When the root length was 3 - 4 cm and the seedling height was ≥ 4 cm, the complete regenerated transgenic plants were obtained and transplanted into the plant culture room (see Figure 8 ).

[0098] The composition of the rooting medium is as follows:

[0099] 1 / 2 MS medium + 1.0 mg / L IBA + 0.5 mg / L paclobutrazol + 20 g / L sucrose + 6.5 g / L agar + 30 mg / L kanamycin + 200 mg / L ticarcillin, pH 5.8.

[0100] Conditions in the tissue culture room: temperature 24°C, humidity 75%, light intensity 1800 lx, duration 16 h / day.

[0101] Conditions for dark culture: temperature 24°C, humidity 75%.

[0102] Conditions in the plant culture room: temperature 25°C, humidity 70%, light intensity 300 μmol / m 2 / s, duration 14 h / day.

[0103] In Example 2, due to the presence of the antibiotic kanamycin, the multiplication factor of the transgenic plants was 4 times. The genomic DNA of the leaves of 24 intact transgenic plants was extracted in the present invention, and PCR identification was carried out using the primers described in SEQ ID NO.1 and SEQ ID NO.2. Those with correct PCR verification were sequenced, and the sequencing result was 2079 bp (see Figure 9 ), and finally 13 transgenic Toona sinensis positive plants were obtained, and the statistical conversion rate was 54.2%.

[0104] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A Toona sinensis BLH3 gene, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

3.

2. Use of the Toona sinensis BLH3 gene according to claim 1 in the high-efficiency genetic transformation and regeneration of Toona sinensis.

3. A method for efficient genetic transformation and regeneration of Toona sinensis, characterized in that, It includes the following steps: (1) After disinfecting and sterilizing the axillary bud-bearing stem segments of Toona sinensis, inoculate them in MS medium and culture for one month to obtain sterile lateral branches; transfer the sterile lateral branches to differentiation medium and culture until callus forms at the base; (2) Connect the Toona sinensis BLH3 gene according to claim 1 to the expression vector pBI121-GFP to construct the recombinant expression vector pBI121-BLH3-GFP; (3) Transform the recombinant expression vector pBI121-BLH3-GFP into Agrobacterium. Take the Agrobacterium containing the recombinant expression vector pBI121-BLH3-GFP and suspend it in sterilized MS liquid medium. After adding acetosyringone, an infection solution is obtained; infect the callus with the infection solution, and after infection, transfer the callus to the co-culture medium and culture it in the dark; (4) Transfer the co-cultured callus to the selection medium and culture it in the dark until adventitious buds are generated, then transfer it to the light and continue to culture until the height is ≥3 cm to obtain transformed plantlets; (5) Transfer the transformed plantlets to the rooting medium and culture until 6 - 8 young roots are formed. When the root system is 3 - 4 cm long and the seedling height is ≥4 cm, a complete regenerated transgenic plant is obtained.

4. The method according to claim 3, characterized in that, The composition of the differentiation medium in step (1) is 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 35 g / L, agar 5 - 8 g / L, and make up to 1 L with MS medium, pH 5 - 6.

5. The method according to claim 3, wherein The nucleotide sequences of the primers used in the construction of the recombinant expression vector in step (2) are shown in SEQ ID NO.4 - 5.

6. The method according to claim 3, wherein The composition of the co-culture medium in step (3) is 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 35 g / L, agar 5 - 8 g / L, acetosyringone 80 - 120 μmol / L, and make up to 1 L with MS medium, pH 5 - 6.

7. The method according to claim 3, characterized in that The composition of the selection medium in step (4) is 6-BA 0.8 - 1.2 mg / L, KT 0.8 - 1.2 mg / L, NAA 0.04 - 0.06 mg / L, sodium nitroprusside 4 - 8 mg / L, sucrose 25 - 40 g / L, agar 5 - 7 g / L, kanamycin 20 - 40 mg / L, ticarcillin 150 - 300 mg / L, and make up to 1 L with MS medium, pH 5 - 6.

8. The method according to claim 3, wherein The composition of the rooting medium in step (5) is IBA 0.8 - 1.0 mg / L, paclobutrazol 0.4 - 0.6 mg / L, sucrose 15 - 25 g / L, agar 5 - 7 g / L, ticarcillin 150 - 300 mg / L, and make up to 1 L with 1 / 2MS medium, pH 5 - 6.

Images