Rice Hot1 gene as well as allele, molecular marker and application thereof

Abstract

The invention discloses a rice Hot1 gene as well as an allele, a molecular marker and application thereof, and belongs to the technical field of molecular biology. A high-temperature-resistant gene Hot1 is cloned in rice, an overexpression experiment proves that the gene positively regulates and controls the high-temperature resistance of the rice, and subsequent haplotype analysis shows that the high-temperature resistance of a plant can be remarkably improved after a Hot1 allele Hot1-Hap7 from Indian rice Kasalath is introduced into japonica rice Nip. An allele type plant of the high-temperature-resistant gene Hot1 is screened by using a molecular marker, high-temperature treatment and agronomic trait analysis prove that the allele type has a remarkable contribution to high temperature resistance of rice, and an important gene resource is provided for high-temperature-resistant breeding of the rice.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a rice Hot1 Genes and their alleles, molecular markers and their applications. Background Art

[0002] Rice is a high-temperature, short-day crop, and its average optimum growth temperature is around 28 (day) / 22℃ (night). Too high or too low an ambient temperature will have a severe restrictive effect on rice growth and development. Studies have shown that high temperature has a very important impact on both the vegetative growth and reproductive growth stages of rice, especially during the heading and flowering stages of reproductive growth (Lin et al., 2008); short-term extreme high temperature stress during the heading and flowering stages will lead to a serious reduction in pollen fertility and anther cracking disorders (Guan et al., 2012), which will seriously reduce rice yields or even lead to crop failure. The impact of high temperature on the heading and flowering stages shows a "short-term effect", and this damage often acts on local parts of the plant body, concentrating on damaging flower organs. Research by the International Rice Research Institute shows that during flowering, high temperatures have a serious impact on the development of male organs. When the temperature is below 41°C, the pollination ability of the stigma is almost unaffected. In contrast, the stamens are very sensitive. Short-term high temperatures during flowering will cause the anthers to lose water rapidly, the number of scattered pollen drops sharply, and the germination of pollen grains is restricted, which eventually leads to fertilization failure and the formation of a large number of empty grains (Satake et al., 1978). So far, several QTLs related to high temperature tolerance during heading and flowering have been located in rice, but the sites whose functions have been analyzed and have application value in breeding are very rare.

[0003] High temperatures threaten the safety of rice production in my country and even the world. Breeding high-temperature resistant varieties is the most effective way to cope with climate change and ensure stable rice production. However, high temperature is a complex quantitative trait, and the target phenotype is easily affected by the environment, which leads to difficulties in the selection and breeding of new varieties. Molecular breeding methods based on resources, with genes as the core and varieties as the carrier are the most effective ways to solve the above problems (Zhao et al., 2017). Among them, the mining and breeding of key high-temperature resistant genes are the biggest technical bottlenecks of this approach. Therefore, cloning key high-temperature resistant genes and mining excellent alleles in their natural variations can provide important gene resources and material reserves for high-temperature resistant breeding. Summary of the invention

[0004] In order to solve the above-mentioned deficiencies in the prior art, the present invention aims to provide a rice Hot1 Genes and their alleles, molecular markers and their applications, in order to provide a new gene for regulating high temperature tolerance of rice and its excellent alleles and molecular markers.

[0005] The technical solution of the present invention to solve the above technical problems is as follows: a rice Hot1 Gene, Hot1 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] The present invention provides a rice Hot1 The application of genes in regulating rice's high temperature tolerance.

[0007] Furthermore, regulating the high temperature tolerance of rice is to overexpress rice Hot1 Genes could improve rice's tolerance to high temperatures

[0008] The present invention provides a rice Hot1 Alleles of a gene, Hot1 The alleles of a gene are named Hot1-Hap7 The nucleotide sequence of its coding region is shown in SEQ ID NO.2.

[0009] The present invention provides a kind of allele Hot1-Hap7 Application in breeding high temperature resistant rice varieties.

[0010] The present invention provides a rice Hot1 The molecular marker of the gene allele is a SNP site -326bp upstream of TG.

[0011] Furthermore, if the SNP site mutates from A to G, the rice will be resistant to high temperature.

[0012] The present invention provides a primer for identifying the above molecular marker, the primer comprises an inner primer and an outer primer; wherein the nucleotide sequence of the inner primer is shown in SEQ NO 14 and SEQ NO 15; the nucleotide sequence of the outer primer is shown in SEQ NO 16 and SEQ NO 17.

[0013] The present invention provides an application of the above-mentioned molecular marker in one or more of the following: (1) Identification of heat-resistant rice varieties; (2) Screening of heat-resistant rice varieties; (3) Improvement of high temperature resistant rice germplasm resources; (4) Auxiliary breeding of heat-resistant rice.

[0014] The present invention also provides a method for identifying a high temperature resistant rice variety, comprising the following steps: using the genomic DNA of a sample to be tested as a template DNA, performing PCR amplification using the above-mentioned inner primers and outer primers, and if the inner primer fragment is 162 bp and the outer primer fragment is 290 bp, it indicates that the sample to be tested is a high temperature resistant rice variety.

[0015] The present invention has the following beneficial effects: (1) The present invention cloned a high temperature resistance gene in rice Hot1The overexpression experiment proved that this gene positively regulated the high temperature tolerance of rice. The subsequent haplotype analysis showed that it originated from the Indian rice Kasalath. Hot1 Allele Hot1- Hap7 The introduction of japonica rice Nip can significantly improve the plant's ability to withstand high temperatures.

[0016] (2) The present invention obtains a new high temperature resistant gene Hot1 The excellent haplotype of rice was identified, and molecular markers were used to screen for an excellent allele plant. High temperature treatment and agronomic trait analysis proved that this allele made a significant contribution to the high temperature resistance of rice, providing an important genetic resource for the breeding of rice with high temperature resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the carrier map of the carrier PC2300 used in Example 1 of the present invention; Figure 2 This is a phenotype diagram of a plant overexpressing the rice Hot1 gene in Example 1 of the present invention; Figure 3 This is the haplotype analysis diagram of the Hot1 gene in Example 2 of the present invention; Figure 4 It is the molecular marker map of Hot1-Hap7 alleles in Example 2 of the present invention; Figure 5 This is a diagram of the high temperature resistance test of the Hot1-Hap7 type plant in Example 3 of the present invention; Figure 6 This is a natural high temperature phenotype diagram of the Hot1-Hap7 type plants in Example 3 of the present invention in multiple fields; Figure 7 This is a test diagram of natural high temperature in multiple fields of Hot1-Hap7 type plants in Example 3 of the present invention. DETAILED DESCRIPTION

[0018] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0019] Embodiment 1: Hot1 Gene overexpression construction, transformation and plant phenotype observation Rice Hot1 The gene coding region sequence was obtained from Rice Resource Center ( http: / / ricerc.sicau.edu.cn ).

[0020] The vector used for overexpression was PC2300 (see Figure 1 ), the coding region sequence was amplified from the cDNA of Nip using specific amplification primers (F1-primer and R1-primer), the restriction sites were selected as Sma1 and Xba1, and the fragment and vector were connected using CEII single-fragment recombinase from Novizan. The constructed overexpression vector was transformed into Kasalath as the recipient material, and Agrobacterium transformation and transgenic experiments were completed by Wuhan Boyuan Company.

[0021] After DNA was extracted from the T0 generation of overexpressing plants, primers (F2-primer and R2-primer) were used to detect the insertion of fragments. Then RNA was further extracted from the positive plants detected, and the fragments were detected using Hot1 Quantitative primers (F3-primer and R3-primer) detection Hot1 Gene expression level, internal reference primers UBQ5 (UBQ5-F1 and UBQ5-R1) were used to retain three high expression lines and propagate to the T1 generation stable lines (see Figure 2 A).

[0022] The stable positive high-expressing plants of the T1 generation were planted in the field until the late tillering and jointing stage, and transferred to the greenhouse 10 days before heading. After 7 days of recovery at mild temperature (22-32°C temperature gradient, 12 / 12 h light), high temperature treatment (32-42°C temperature gradient, 12 / 12 h light) was started at the heading and flowering stage for 4 days. After the treatment, the wild-type plants and overexpressing plants were transferred to the field to recover growth until harvest, and the fruit set rate and single plant yield were investigated (see Figure 2 B-2C).

[0023] The primer sequences are as follows: F1-primer: ggagaggacagggtacccgggATGGCCGGGGGGAGGAGG (SEQ ID NO.3); R1-primer: ggtactagtgtcgactctagaTCCCTGAACTTGTAATTCGGTTT (SEQ ID NO.4); F2-primer: ATGGCCGGGGGGAGGAGG (SEQ ID NO.5); R2-primer:TCCCTGAACTTGTAATTCGGTTT (SEQ ID NO.6); F3-primer: GATTGGAGGAGGAAACATCAGGA (SEQ ID NO.7); R3-primer: CAGAACCAAATCTGCAGGAAAGA (SEQ ID NO.8); UBQ5-F1:ACCTTCATGGCCAACCACTT (SEQ ID NO.9); UBQ5-R1: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 10); Embodiment 2: Hot1 Gene haplotype analysis Hot1 The gene promoter and coding region sequences were obtained from the second generation sequencing database RiceVarmap v2.0 databasee ( http: / / ricevarmap.ncpgr.cn / ) were obtained. To ensure data accuracy, we filtered out incompletely sequenced varieties. Hot1 The coding and promoter region sequences of Hot1 were analyzed and divided into 7 haplotypes. Sequence analysis showed that Hot1 had only 4 SNP variations in the coding region, 2 of which were synonymous mutations. However, the promoter region within 1.2K upstream of ATG was significantly different in different varieties (see Figure 3 A-3B).

[0024] We then collected seven representative varieties of haplotypes and used qPCR primers (qPCR-F and qPCR-R) to detect Hot1 Gene expression level, using UBQ5 (UBQ5-F2 and UBQ5-R2) as internal reference primers, showed that the expression level of the haplotype represented by Aus rice Kasalath was significantly higher than that of other varieties. In vitro promoter activity analysis proved the strong promoter ability of this type of promoter (see Figure 3 C), indicating Hot1-Hap7 type may be a potential excellent haplotype.

[0025] The primer sequences are as follows: qPCR-F: GATTGGAGGAGGAAACATCAGGA (SEQ ID NO. 11); qPCR-R: CAGAACCAAATCTGCAGGAAAGA (SEQ ID NO. 12); UBQ5-F2:ACCTTCATGGCCAACCACTT (SEQ ID NO.13); UBQ5-R2: CTAAGCCTGCTGGTTGTAGA (SEQ ID NO. 14).

[0026] Embodiment 3: Hot1-Hap7 Allelic molecular marker development Sequence analysis showed that Hap7 Hot1 The promoter sequence (SEQ ID NO.19) is significantly different from that of other types. In order to facilitate the screening of natural variant plants containing the Hap7 genotype in the substitution line materials with Nip as the recipient and Kasalath as the donor, we developed molecular markers for the SNP difference site at the -326bp position upstream of TG between the two haplotypes, and designed inner and outer primers to distinguish the sequence differences between the two. The inner primer fragment of Nip type is 184bp, the inner primer fragment of Kasalath type is 162bp, and the outer primer fragment is 290bp (see Figure 4 ).

[0027] The sequences of the inner and outer primers are as follows: rF primer: GGTTTCCTTTGGGTAGGTGGGTGTGGGGGG (SEQ ID NO.15); rR primer:CCCCTCCTGCCACCCAACTCCACGCT (SEQ ID NO.16); wF primer: GCCTTGGTGGGATCTCCGAGGCGGTTTC (SEQ ID NO.17); wR primer: TGGCACTGGGCTGTTCTTCCTCCGAGCA (SEQ ID NO. 18).

[0028] Test Example 1: Hot1-Hap7 Analysis of high temperature resistance test of type plants The above-mentioned method was used to filter Hot1-Hap7 The substitution line plants were tested for high temperature tolerance. Hap7 Plants were planted in the field until the late stage of tillering and jointing, and transferred to the greenhouse 10 days before heading. After 7 days of recovery at mild temperature (22-32℃ temperature gradient, 12 / 12 hours of light), high temperature treatment (32-42℃ temperature gradient, 12 / 12 hours of light) was started at the heading and flowering stage for 2 days. After the treatment, the plants were transferred to the field to resume growth until harvest, and the fruit set rate and single plant yield were examined. The treatment results showed that the high temperature tolerance of plants carrying the Hap7 haplotype was significantly improved (see Figure 5 ).

[0029] Test Example 2: Hot1-Hap7 Analysis of natural high temperature tests on various types of plants in the field Summer 2024 will accept Nip and SSSL-Hot1 Hap7Plants were planted in Wenjiang, Chengdu, Yongchuan, Chongqing and Changsha, and the field temperature changes during heading in July and August were recorded. Then the agronomic traits of the two materials in the three experimental sites were compared, including plant morphology, ear fruiting rate, single plant yield, etc. The results showed that the average temperature in the summer of July and August 2024 in the three sites was Changsha>Chongqing>Wenjiang. The fruiting rate and yield data analysis showed that there was a significant correlation between the yield traits and temperature in the three sites, and SSSL-Hot1 Hap7 The plants were better than Nip (see Figure 6 and Figure 7 ).

[0030] In the present invention Hot1 Gene coding region sequence: Hot1-Hap7 Nucleotide sequence of the coding region: Hot1-Hap7 Nucleotide sequence of the promoter: TTTTTAAAATATATTTATAGCTGGCTTATAATCTGCTATTGTACCTATTCTAATTACCACTTGTAAGAGTTACAAATACTAGTTAATTATTCCGGGAAAAACAATCACCACTAATCCACTACTATCCACCAGGGCAACCAACAAACCAAAACCCAAC CGGCCAGACAAGGCAGGAGGAGGCCAACGAGCCAACCCGCCCCACACGTCGTCGACTCGGCATCGCGACCTCACCCCGTCGC CTACTCCATTCCAATTCCATTCACC CCCCCCCCCCCCCCCCCCTCAAAGCTTCGAATTTTTCCTTCCCAAAAATCATCACCACCACCACCATCACCACCTTCCTCCTCCTCCTCCTCTTCTTTCTTCTTGTTCGCGCGTAGCCGCACCACGCGTCCCCCGCGATTCGCCCCACGCCGCGCCTCGCACGGAACCTCCTCTCTCTCTGCTCG CCGCGCATTGCCGCCGCCGCCGCCGCCGCCGCCGCAACCAGATTCCATCCGTGCGCTGCGCTGCGCTGCGCGCGCTTTTTTTTTTTTGTTCTTTCCTTCCCGCGCCGCGCGCCAAGTTAAGTTGTTGGGAGGGAGGAGGAGGAGAGACGACGACGAGTCGCCCCCGCGCGCCGCATGGATCAGGGTCTCCGGTGCTTCAGCCACCGCCGCCGCCGCCGCCTCGAGCTGCGCTTCTTGGGGTTCTGGGACCCGTGCGCCGCCGCCGCCGCCTTGGTGGGATCTCCGAGGCGGTTTCTCTAGGATTTCTCCCTCTCTCTCTCTCCCTTCCTTCCTCTTCTTAGCTGCGAGTTCACTTGCAGCTCCCAGCTTGTTGCGCAGCTGTGCGTGCGTGCGTGCGGTTTCCTTTGGGTAGGTGGGTGTGGGTGGGAGTGGAGTTGGGTGGCAGGAGGGGCTCGCAATTTATTGCGAGGTGTCTCCTCCTGGCCCAAAGGAGGGGGGATTTCTTTTCTCCCTGAATCTGAGCTGTTCTTGCTCGGAGGAAGAACAGCCCAGTGCCAGTTTGAGGACTGATTAATCAGCTGCTGATTTCGTTGGGTTCTTGTTTTGCTCCCAACAAATTCAATAATCTTGGAGCGATTTGAGGTCTCAGTGGTGGTGGTGGCCAAAGGCCCTGTTTCTGTTCCTGTTGCCCTCTTTGTCCTCCTGGGTTGTGGAGAGCTGCTCACTGATTTGGCTGTCAGTTTTGGGGCA(SEQ ID NO.19)。

[0031] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A kind of rice Hot1 A gene characterized by Said Hot1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The rice according to claim 1 Hot1 The application of genes in regulating rice's high temperature tolerance.

3. The use according to claim 2, characterized in that: The method for regulating the high temperature tolerance of rice is to overexpress rice Hot1 Genes could improve rice's tolerance to high temperatures 4. The rice according to claim 1 Hot1 An allele of a gene, characterized in that Said Hot1 The alleles of a gene are named Hot1-Hap7 The nucleotide sequence of its coding region is shown in SEQ ID NO.

2.

5. The allele according to claim 4 Hot1-Hap7 Application in breeding high temperature resistant rice varieties.

6. The rice according to claim 4 Hot1 A molecular marker for an allele of a gene, characterized in that The molecular marker is a SNP site at -326 bp upstream of TG.

7. The molecular marker according to claim 6, characterized in that The mutation of the SNP site from A to G indicates that the rice is resistant to high temperature.

8. A primer for identifying the molecular marker according to any one of claims 6 to 7, characterized in that: The primers include inner primers and outer primers; wherein the nucleotide sequences of the inner primers are shown in SEQ NO 14 and SEQ NO 15; and the nucleotide sequences of the outer primers are shown in SEQ NO 16 and SEQ NO 17.

9. Use of the molecular marker according to any one of claims 6 to 8 in one or more of the following: (1) Identification of heat-resistant rice varieties; (2) Screening of heat-resistant rice varieties; (3) Improvement of high temperature resistant rice germplasm resources; (4) Auxiliary breeding of heat-resistant rice.

10. A method for identifying high temperature resistant rice varieties, characterized in that: The following steps are involved: The genomic DNA of the sample to be tested is used as the template DNA, and PCR amplification is performed using the inner primers and outer primers described in claim 8. If the inner primer fragment is 162 bp and the outer primer fragment is 290 bp, it indicates that the sample to be tested is a high temperature resistant rice variety.

Images