Application of verticillium dahliae GH6 cellulase VdCel6B gene

Abstract

The invention is applicable to the technical field of functional genes, provides application of a verticillium dahliae GH6 cellulase VdCel6B gene, and particularly, the verticillium dahliae GH6 cellulase VdCel6B gene can be used for inhibiting verticillium dahliae from infecting plants. Wherein the VdCel6B gene can influence the growth, development and pathogenicity of verticillium dahliae, and the VdCel6B protein coded by the VdCel6B gene can degrade plant cell walls and inhibit plant immune response through cellulase to play a pathogenic role. Therefore, the invention has important theoretical value for prevention and control of verticillium dahliae and development of novel bactericides, and has important practical significance for promoting safety production of cotton.

Description

Technical Field

[0001] The invention belongs to the technical field of functional genes, and in particular relates to an application of a Verticillium dahliae GH6 cellulase VdCel6B gene. Background Art

[0002] Cotton is one of the important economic crops in my country. Xinjiang has become the largest cotton-producing region in my country due to its special geographical environment and climate suitable for cotton growth. It occupies an important strategic position in my country's cotton industry. In my country, studies have found that the main pathogen causing cotton wilt is Verticillium dahliae ( Verticillium dahliae Kleb.). This pathogen primarily reproduces asexually. Its spores are oval and, upon germination, produce whorled, branching hyphae. These mycelium expands within the host plant, causing disease. Under adverse growth conditions and during the aging phase of the mycelium, the hyphae swell and become highly brown, forming microsclerotia. These microsclerotia are highly resilient and can survive in the soil for extended periods, playing a key role in the infection cycle. V. dahliae can infect over 600 host plant species, including those in the Cruciferae, Leguminosae, Solanaceae, and Chenopodiaceae families. Different strains of V. dahliae vary in pathogenicity and host range.

[0003] The plant cell wall is the first biological barrier during pathogen infection. Pathogens can produce large amounts of carbohydrate enzymes to degrade the cell wall, facilitating its entry. These carbohydrate enzymes, also known as cell wall degrading enzymes (CWDEs), are classified according to the substrate they degrade, including cellulases, xylanases, and pectinases.

[0004] Glycoside hydrolases are widely present in pathogens and are the largest family in the Carbohydrate-Active Enzyme Database (CAZy). Currently, the CAZy database lists 173 glycoside hydrolase families (GHs). In recent years, the role of multiple glycoside hydrolase families in pathogen invasion and pathogenicity has been demonstrated. Cellulase is a complex enzyme, primarily relying on the synergistic action of endoglucanases, exoglucanases, and β-glucosidases to degrade cellulose. Endoglucanases hydrolyze β-1,4-glucosidic bonds in the amorphous regions of cellulose chains, releasing cellooligosaccharides. Exoglucanases act on short cellulose molecules and cellooligosaccharides, releasing disaccharides such as cellobiose. β-glucosidases then cleave cellobiose into glucose. Studies have shown that cellulases from GH6 and GH7 contribute to host epidermal penetration and further invasion by plant pathogens.

[0005] The Glycoside Hydrolases 6 (GH6) family is an important group of hydrolases that primarily hydrolyze β-1,4-glycosidic bonds in cellulose through a reverse mechanism, converting insoluble polysaccharides into soluble sugars. Current research has found that GH6 family cellulases are primarily composed of two enzymes: endoglucanases (EG, EC 3.2.1.4) and exoglucanases (cellobiose, CBH, EC 3.2.1.176 / 91). These two enzymes do not solely perform hydrolysis, but rather work in a synergistic mode, both of which can generate new chain ends.

[0006] Currently, the GH6 family cellulases discovered in research play an important role in cellulose degradation and synergistic biocatalytic conversion. Their main characteristics are: (1) GH6 cellulases use a one-step, reverse mechanism to hydrolyze β-1,4-glycosidic bonds; (2) GH6 cellulases are likely to hydrolyze through the Grotthuss mechanism; (3) The GH6 family consists of CBHs and EGs, both of which are able to specifically degrade the non-reducing ends of crystalline cellulose; (4) GH6 protein CBHs exhibit disordered loops, forming a typical tunnel-like structure. These loops show significant flexibility in responding to mutations and ligand binding, which may be related to the mechanism of action or activity properties of GH6 CBHs; (5) GH6 cellulases play a key role in the synergistic activity of cellulase mixtures. They are the only known non-reducing end-specific cellulases and have been shown to generate new free chain ends for GH7 cellulases.

[0007] The GH6 family also plays a role in the interaction between pathogens and hosts. The cellulases secreted by pathogens when infecting host plants can hydrolyze crystalline cellulose in plant cell walls. The GH6 and GH7 family cellulases MoCel6A, MoCel7A and MgEGL1 secreted by rice blast fungus are transcribed and expressed in large quantities during the infection process. However, in the mutants, the transcription levels of target genes in KD_CEL1, KD_CEL2 and KD_sd1, the cellulase activity and the pathogenicity to the host are reduced, indicating that GH6 family cellulases are also involved in the infection process of pathogens.

[0008] Because the pathogenicity of Verticillium dahliae is complex and the interaction between the pathogen and the host plant is unclear, identifying and functionally analyzing genes associated with pathogenicity or virulence of this fungus will help reveal the molecular pathogenesis of Verticillium dahliae. Summary of the Invention

[0009] The purpose of the embodiments of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6B gene, aiming to solve the problems raised in the background technology.

[0010] To address the above problems, the present invention provides a use of a Verticillium dahliae GH6 cellulase VdCel6B gene in inhibiting Verticillium dahliae infection of plants, wherein the nucleotide sequence of the VdCel6B gene is shown in SEQ ID NO.1 in the sequence listing.

[0011] Preferably, the plant comprises cotton.

[0012] Preferably, the VdCel6B gene exerts its pathogenic effect by degrading plant cell walls through cellulase and suppressing plant immune response.

[0013] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6B gene in promoting the growth and development of Verticillium dahliae.

[0014] Preferably, said growth and development comprises propagule production.

[0015] Preferably, the propagules include microsclerotia and conidia.

[0016] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6B gene in influencing the pathogenicity of Verticillium dahliae.

[0017] Preferably, the pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

[0018] Another object of the present invention is to provide an application of the Verticillium dahliae GH6 cellulase VdCel6B gene in influencing plant resistance.

[0019] Preferably, the plant comprises cotton.

[0020] Preferably, the plant resistance includes at least one of a plant necrosis response and the ability to express disease-resistant genes.

[0021] Preferably, the disease-resistant gene includes at least one of NbAcre31, NbLOX and NbPR4.

[0022] The VdCel6B gene provided by this invention affects the growth and pathogenicity of Verticillium dahliae. The encoded VdCel6B protein exerts its pathogenic effects by degrading plant cell walls through cellulase and suppressing plant immune responses. Therefore, this invention has important theoretical value for the prevention and control of Verticillium dahliae and the development of new fungicides, and has important practical significance for promoting safe cotton production. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the result of transcriptional expression of VdCel6B gene in different tissues of Verticillium dahliae; Figure 2 This is the result of transcriptional expression of VdCel6B gene at different times after cotton root induction; Figure 3 Figure 2 is the transcriptional expression result of VdCel6B gene induced by different substrates; Figure 4 Figure 2 shows the results of VdCel6B inhibiting the immune response induced by BAX; Figure 5 is the relative expression level of defense-related genes NbAcre31, NbLOX, and NbPR4; Figure 6 Colony morphology diagram of the Verticillium dahliae ΔVdCel6B mutant, complemented strain and wild-type strain V592 constructed in the present invention; Figure 7 dahliae ΔVdCel6B mutant, complemented strain and wild-type strain V592 constructed by the present invention, showing microsclerotia formation by microsclerotia; Figure 8 This is a graph showing the results of measuring the spore production of the Verticillium dahliae ΔVdCel6B mutant, the complemented strain, and the wild-type strain V592 constructed in the present invention; Figure 9 Figure 2 is a microscopic observation result of the sporangium stalks of the Verticillium dahliae ΔVdCel6B mutant strain, the complemented strain and the wild-type strain V592 constructed in the present invention; Figure 10 The results of the pathogenicity test of the Verticillium dahliae ΔVdCel6B mutant, the complemented strain, and the wild-type strain V592 on cotton constructed in the present invention are shown in FIG. A shows the morphology of pathogenic plants; B shows the disease index result; Figure 11 This is a graph showing the results of measuring the penetration ability of mycelium of the Verticillium dahliae ΔVdCel6B mutant strain, the complemented strain, and the wild-type strain V592 constructed in the present invention into cotton; Figure 12 This is the phenotypic observation diagram of the ΔVdCel6B gene mutant after Congo red staining. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0025] In the early stage of the present invention, cotton roots were used to induce the expression of Verticillium dahliae related genes. Analysis revealed that the VdCel6B gene (GenBank accession number: VDAG_04022) was expressed in large quantities in the early stage of induction. This gene belongs to the GH6 family.

[0026] Specifically, in an embodiment of the present invention, a new application of the Verticillium dahliae GH6 cellulase VdCel6B gene is provided, which clarifies that the VdCel6B gene can provide a basis for controlling Verticillium dahliae and developing new fungicides.

[0027] The nucleotide sequence of the VdCel6B gene is shown in SEQ ID NO: 1, specifically:

[0028] To determine whether knockout of the VdCel6B gene affects conidia formation in Verticillium dahliae, a VdCel6B knockout mutant strain ΔVdCel6B was constructed based on the wild-type strain V592. Gene complementation was then performed on ΔVdCel6B to obtain a complemented strain EC-VdCel6B. The VdCel6B knockout mutant strain ΔVdCel6B was constructed using the principle of homologous recombination. For details, see the prior art for obtaining knockout and complemented mutants (WANG S, XING H, HUA C, GUO HS, ZHANG J. An improved single-step cloning strategy simplifies the Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption method for Verticillium dahliae. Phytopathology, 2016, 106(6): 645-652.).

[0029] In this study, a series of experiments using ΔVdCel6B, the complemented strain EC-VdCel6B, and the wild-type strain V592 were performed. The results showed that the ΔVdCel6B knockout strain exhibited reduced conidia production. Pathogenicity analysis also revealed a significant decrease in the disease index and amelioration of symptoms in the ΔVdCel6B knockout strain, demonstrating that the ΔVdCel6B gene is involved in the growth and pathogenicity of Verticillium dahliae.

[0030] In the present invention, the GH6 cellulase VdCel6B from Verticillium dahliae can enhance the pathogenicity of Verticillium dahliae. The present invention analyzed the expression of the VdCel6B gene at different times and in different tissues. The results showed that the wild-type strain V592 expressed the highest level of VdCel6B in mycelium after 48 days of culture on PDA solid medium. Based on the principle of homologous recombination, a knockout vector targeting VdCel6B was constructed. Conidia of the cotton Verticillium dahliae strain V592 were transformed via Agrobacterium-mediated transformation (ATMT), resulting in the identification of two VdCel6B knockout mutants. Furthermore, a complementation vector targeting VdCel6B was constructed, resulting in the identification of two VdCel6B complementation strains. Compared with the wild-type strain V592 and the complementation strains, the VdCel6B knockout mutants showed decreased conidia production and reduced pathogenicity to cotton. The effect of the gene on cellulase activity was reflected by the size of the hyaline zone produced by the mutant. The hyaline zone produced by the VdCel6B knockout mutant was significantly smaller than that of the wild-type strain V592, indicating that the VdCel6B protein can degrade cellulose and possesses cellulase activity. The VdCel6B cellulase gene was transiently expressed in tobacco plants through Agrobacterium-mediated genetic transformation. The results showed that VdCel6B did not induce hypersensitive necrosis in tobacco plants, but it suppressed the immune response induced by BAX proteins and significantly inhibited the expression of defense-related genes (NbAcre31, NbLOX, and NbPR4). This suggests that VdCel6B exerts its virulence by suppressing plant immunity during the infection of Verticillium dahliae.

[0031] In summary, the present invention knocks out the VdCel6B gene and complements its function, and studies the gene's role in the growth and development of Verticillium dahliae and its interactions with plants. The VdCel6B gene plays an important role in the growth and development, spore production, and pathogenicity of Verticillium dahliae. The encoded VdCel6B protein exerts its pathogenic effects by degrading plant cell walls through cellulase and suppressing plant immune responses. Therefore, the present invention has important theoretical value for the prevention and control of Verticillium dahliae and the development of new fungicides, and has important practical significance for promoting safe cotton production.

[0032] In the following examples, the experimental methods without specific experimental conditions are generally carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents, raw materials, and equipment used in the present invention can be obtained from commercial sources.

[0033] Example 1: This example measures the expression of the cellulase VdCel6B gene in different tissues of V592, as follows: Wild-type V592 bacterial clumps were cultured in 100 mL of Czapek-Dox liquid medium for 3 days and then filtered through four layers of gauze to collect spores. Meanwhile, wild-type V592 tissue cultured on PDA and BMM solid media for 2 and 20 days, respectively, was gently scraped with a sterilized glass slide to obtain hyphae and microsclerotia. The obtained spores, hyphae, and microsclerotia were quickly frozen in liquid nitrogen and then subjected to RNA extraction and cDNA synthesis according to 2.2.3. qPCR reactions were prepared using SYBR Select Master Mix, using the internal reference gene β-tubulin (DQ266153). Each reaction was repeated three times. Data were processed and analyzed using the 2-ΔΔCt method and SPSS 26.0 software. The results are shown in Figure 2. Figure 1 shown.

[0034] The results showed that the expression level of VdCel6B gene was highest in microsclerotia and lower in spores and hyphae, indicating that the GH6 cellulase VdCel6B gene may play a certain role in the spores, hyphae and microsclerotia of Verticillium dahliae.

[0035] Example 2: This example measures the expression of the Verticillium dahliae GH6 cellulase VdCel6B gene at different times of cotton root induction, as follows: Several seeds of Junmian No. 1 with full grains were selected, the seed coats removed, and the seeds were treated with 0.1% HgCl2 for 3 min on a clean bench. The seeds were then washed three times with sterile water and placed on sterilized filter paper to dry the surface moisture. Tweezers were burned with an alcohol lamp until the temperature dropped, and the seeds were picked up and placed in tissue culture bottles containing 50 mL of MS solid medium, with about 4 to 5 seeds per bottle. The seeds were placed in a 28°C incubator in the dark for 7 days, and the seedlings were supported once during the period.

[0036] On a clean bench, the wild-type V592 bacterial suspension that had been shaken at 26°C for 3 days was filtered through four layers of gauze into a 50 mL centrifuge tube and centrifuged at 8000 r / min at 4°C for 10 min. The bacteria were resuspended in Czapek-Dox liquid medium and evenly distributed into conical flasks containing 100 mL Czapek-Dox liquid medium. Cotton roots cultured in MS solid medium were inoculated into each conical flask and cultured at 26°C and 200 r / min for 8 h, 12 h, 24 h, 36 h, 48 h, and 60 h, respectively. V592 bacterial suspension without cotton root induction at different times was used as a control. The induced bacterial suspension was collected and quickly frozen in liquid nitrogen for RNA extraction and cDNA synthesis. The SYBR Select Master The qPCR reaction system was prepared using the PCR Mix, and the internal reference gene was β-tubulin (DQ266153). Each reaction was repeated three times. The data were processed and analyzed using the 2-△△Ct method and SPSS 26.0 software. The results are shown in the figure. Figure 2 shown.

[0037] The results showed that the expression of the cellulase VdCel6B gene was continuously upregulated with the increase of induction time, with the highest expression level at 36h of induction, upregulated by 347.3 times. This indicates that the VdCel6B gene plays an important role in the early stage of Verticillium dahliae infection of the host.

[0038] Example 3: This example analyzes the expression of the Verticillium dahliae GH6 cellulase VdCel6B gene induced by different substrates, as follows: 0.1 g of soluble starch, microcrystalline cellulose, and sodium carboxymethyl cellulose were added to 100 mL of Czapek-Dox liquid medium, respectively. After high-temperature sterilization, the wild-type V592 bacterial suspension was inoculated and cultured at 26°C and 200 r / min for 48 h. The bacterial suspension was collected and quickly frozen in liquid nitrogen before RNA extraction and cDNA synthesis. The qPCR reaction system was prepared according to SYBR Select Master Mix. The internal reference gene was β-tubulin (DQ266153). Each reaction was repeated three times. The data were processed and analyzed for significance using the 2-△△Ct method and SPSS26.0 software. The results are shown in Figure 2. Figure 3 shown.

[0039] The results showed that the expression level of VdCel6B increased significantly under the induction of CMC and FPA, indicating that during the interaction between Verticillium dahliae and the host, the cellulase gene VdCel6B has a certain effect on the host's cellulose.

[0040] Example 4: 1. Study on the ability of VdCel6B protein to inhibit plant resistance. To explore whether VdCel6 protein affects plant immune response, the specific experimental method is as follows: (1) Construction of a vector for transient expression of the VdCel6B gene: Using the cDNA of V592 as a template and amplifying with specific primers for the target gene, the PCR product was recovered according to the instructions of the PCR product recovery kit (OMEGA) and ligated to the 1300-221-35S-6×Myc transient expression vector that had been linearized with the endonuclease BamHI (TaKaRa) using homologous recombination enzyme (ClonExpressⅡ One Step Cloning Kit, Vazyme). The ligation system consisted of 1 μL 5×CE II Buffer, 1 μL Exnase II, 1 μL 1300-221-35S-6×Myc, 1 μL PCR recovery product, and 6 μL ddH2O. The mixture was gently mixed and placed in a PCR instrument (Thermo Fisher Scientific) for reaction at 37°C for 30 min.

[0041] Heat shock transformation: Thaw the DH5α competent medium stored in a -80°C refrigerator on ice. After 20 minutes, slowly transfer the ligation product to the thawed DH5α competent medium, gently mix evenly, and continue to stand on ice for 30 minutes; place the centrifuge tube containing the mixed solution in a 42°C incubation box for incubation. After 50 seconds, add 400 μL LB liquid medium in a sterile environment and shake at 26°C and 200 r / min for 45 minutes; spread the shaken bacterial liquid on LB solid medium containing Kanna; place it in a 37°C incubator for 12 hours. After a single colony grows, pick a single colony for PCR and Sanger sequencing, and extract the plasmid from the confirmed positive colony according to the instructions of the plasmid mini-extraction kit (Tiangen).

[0042] Electroporation transformation: Place the competent Agrobacterium and electroporation cup stored in a -80 ℃ refrigerator on ice for 15 min; aspirate 2 μL of plasmid and slowly add it to 100 μL of competent Agrobacterium and place it on ice for 20 min; transfer the mixture to an electroporation cup and perform electroporation at 1800 V; in a sterile environment, add 500 μL of LB liquid medium to the electroporation cup, then transfer all the solution in the electroporation cup to a new centrifuge tube and shake at 28 ℃ for 1 h; spread the shaken bacterial solution on LB solid medium containing Kanna and Rif; after 2 days, pick a single colony for PCR verification; shake the successfully verified single colony in LB liquid medium containing Kanna and Rif to obtain Agrobacterium bacterial solution containing the target gene plasmid and store it in a -80 ℃ refrigerator for later use.

[0043] (2) Transient expression of VdCel6B gene in Nicotiana benthamiana: The Agrobacterium tumefaciens culture containing the target gene plasmid stored in a -80 ℃ refrigerator was thawed on ice, and then inoculated with a sterile toothpick on a solid LB plate containing 50 μg / mL Kanna and 100 μg / mL Rif; after 2 days, a single colony was picked and transferred to 500 μL LB liquid culture medium for shaking culture at 26 ℃, 200 r / min, and 16 h; 200 μL of the freshly shaken Agrobacterium culture was transferred to a 50 mL centrifuge tube containing 25 mL LB liquid culture medium containing 150 μM AS for culture; when the culture liquid was shaken to orange, it was collected at 4 ℃, 5000 r / min; the supernatant was discarded, and the precipitated bacteria were resuspended in Agrobacterium infection tobacco buffer, and the OD was calculated. 600 After adjusting to 1.0, place it at 28°C and let it stand for 2 hours. After 2 hours, use a 1 mL syringe to draw an appropriate amount of Agrobacterium liquid and inject it on the back of the tobacco leaf. The injection area is a circular spot with a diameter of 1 cm. Figure 4 As shown in Figure A, first inject Agrobacterium suspension containing the VdCel6B gene into positions 2 and 3 with a 1 mL syringe. After moisturizing and dark treatment for 24 h, inject BAX Agrobacterium suspension into position 3. Inject BAX and 1300-221-35S-6×Myc Agrobacterium suspension into positions 1 and 4 as positive and negative controls, respectively. After one week, observe the necrosis of the tobacco leaves and take photos to record the results. Figure 4 As shown in B.

[0044] The results showed that six days after inoculation with BAX, tobacco leaves expressing BAX alone showed significant cell necrosis. However, when BAX and VdCel6B were co-expressed, the necrosis symptoms were significantly alleviated. This suggests that VdCel6B does not function as an effector, but can suppress the immune response induced by BAX.

[0045] 2. Determination of the expression of related defense genes: To determine whether VdCel6B stimulates the expression of some defense-related genes in plants, the expression levels of the MTI (Microbe-associated molecular patterns-triggered immunity)-related gene NbAcre31, the pathogenesis-related gene NbPR4, and the jasmonic acid biosynthesis key enzyme gene NbLOX were detected. The specific methods are as follows: Tobacco leaves were injected and infected according to the above method. RNA was extracted from the different treated tobacco leaves at 0, 12, 24, and 48 hours after infection according to the instructions of the RNA extraction kit (Beijing Quanshijin Biological). cDNA was then synthesized using a PCR instrument (Thermo Fisher Scientific) at 42°C for 15 minutes. The expression levels of tobacco defense-related genes (NbAcre31, NbLOX, and NbPR4) were detected by qRT-PCR. The results are shown in Figure 2. Figure 5 shown.

[0046] Results showed that after BAX injection alone, the expression levels of NbAcre31, NbLOX, and NbPR4 increased over time, reaching peak expression at 48 hours. When BAX and the VdCel6B cellulase gene were co-infected in tobacco plants for 48 hours, the expression levels of NbAcre31, NbLOX, and NbPR4 decreased significantly, by 2.86-, 3.36-, and 5.18-fold, respectively. Following injection alone of the VdCel6B cellulase gene and a suspension of Agrobacterium transiently expressing the empty vector 1300-221-35S-6×MyC, the expression levels of NbAcre31, NbLOX, and NbPR4 were very low and did not change over time. These results further demonstrate that the VdCel6B protein can suppress the immune response induced by BAX, suggesting that VdCel6B plays a virulence role in Verticillium dahliae infection by suppressing plant immunity.

[0047] Example 5: This example provides a method for constructing a VdCel6B knockout mutant strain of Verticillium dahliae (ΔVdCel6B). Primers were designed based on the upstream and downstream homology arms of the VdCel6B gene (nucleotide sequence shown in SEQ ID NO: 1), and a knockout vector was constructed. Wild-type strain V592 was used as the initial strain to construct mutant strains. VdCel6B knockout mutant strains of Verticillium dahliae (ΔVdCel6B-1 and ΔVdCel6B-2) were obtained.

[0048] The specific construction process is as follows: (1) Amplification of the homology arms of the target gene: Two pairs of primers were designed using the upstream and downstream homology arms of the VdCel6B gene. The genomic DNA of the deciduous strain V592 was used as a template. The upstream and downstream homology arms of the VdCel6B gene were amplified using I-5 2× High-Fidelity Master Mix high-fidelity DNA polymerase. Primers VdCel6B-sf and VdCel6B-sr amplified the upstream homology arm of the VdCel6B gene, and primers VdCel6B-xf and VdCel6B-xr amplified the downstream homology arm of the VdCel6B gene. PCR reaction system: 25 μL of I-5 2× High-Fidelity Master Mix, 1 μL each of VdCel6B-s(x)-f / VdCel6B-s(x)-r, and 1 μL of DNA were added to a 0.2 mL PCR tube and the volume was made up to 50 μL with ddH2O. The PCR reaction procedure was as follows: preheat at 98°C for 1 minute, melt at 98°C for 15 seconds, anneal at 60°C for 15 seconds, extend at 72°C for 15 seconds, hold at 72°C for 5 minutes, and terminate at 20°C for 2 minutes. 30 cycles were repeated from the melt to the extension phase. 3–5 μL of PCR product was electrophoresed on a 1% agarose gel containing Goldenview, visualized under a UV-light imager, and photographed. The remaining PCR product with the correct band was purified using the OMEGA Biotech Gel Extraction Kit and the concentration was determined.

[0049] Among them, the upstream and downstream homology arm primers are as follows: VdCel6B-sf: CTTGCTGAGGTCTTAATTAATTTTCACACTCCGGAAGACTGC (as shown in SEQ ID NO: 2); VdCel6B-sr:AGTGCTGAGGCATTAATTAACATCTTGATCGCTTGCGCTG (as shown in SEQ ID NO: 3); VdCel6B-xf: CCCGCTGAGGACTTAATTAATAGGTAGGGCCTGGCAAGTTT (as shown in SEQ ID NO: 4); VdCel6B-xr: CTCGCTGAGGGTTTAATTAAGTGGTATAGTCCCCTTGTCGGTT (as shown in SEQ ID NO:5).

[0050] (2) The knockout vector used in this example is pGKO-HPT. The vector plasmid was linearized with PacⅠ. The system is as follows: 5 μL of PacⅠ, 35 μL of vector plasmid, 5 μL of 1×Cutsmart, ddH2O is added to 50 μL, and the enzyme digestion is constant temperature in a 37 ℃ water bath for 10-12 hours. The next day, 3~5 μL of PCR product was taken for gel electrophoresis detection on a 1% agarose gel electrophoresis added with Goldenview. The enzyme digestion band was observed under a UV gel imager. The target fragment was carefully cut out and the linearized vector fragment was purified using the Gel Extraction Kit steps of OMEGA Bio Company. After gel electrophoresis verification again, the purified vector fragment was packaged and its concentration was determined. It was stored in a -20 ℃ refrigerator for use to avoid repeated freezing and thawing.

[0051] (3) In-fusion cloning: The upstream and downstream homology arms of the target gene obtained after amplification and purification and the vector fragment obtained after linearization and purification were ligated with In-fusion enzyme. The system is as follows: 3 μL of the purified products of the upstream and downstream homology arms of the target gene, 1 μL of 5×CE Multis Buffer and Exnase Multis, and 2 μL of the linearized vector. The above solution was placed in a 37°C water bath for 30 minutes, placed on ice for subsequent experiments or temporarily stored in a -20°C refrigerator, and heat-shocked to transform E. coli and extract the recombinant plasmid.

[0052] (4) Agrobacterium-mediated genetic transformation: Electroporation of Agrobacterium: Take out the recombinant plasmid and Agrobacterium competent cells from the -20 ℃ refrigerator and -80 ℃ refrigerator respectively, and quickly thaw them on ice; take out 1 μL of the recombinant plasmid and add it to the Agrobacterium competent cells, and place it on ice for 10 minutes; wipe off the water on the wall of the sterilized and pre-cooled electroporation cup, add the mixed solution and place it in the electroporation instrument for instantaneous electroporation; add 500 μL of LB liquid culture medium without any antibiotics, pipette to mix and absorb the mixed solution in the electroporation cup, place it in a 1.5 mL centrifuge tube, and shake it at 200 rpm in a 28 ℃ shaker for 45 minutes; centrifuge briefly, discard 500 μL of supernatant, use a pipette to fully mix the remaining bacterial solution, evenly spread the bacterial solution on LB solid culture medium containing Kan and Rif antibiotics in a clean bench, and place it in a 28 ℃ constant temperature incubator for dark culture for 2~3 days. Positive transformants were screened by PCR, and the correct colonies were shaken to obtain Agrobacterium culture. 100 μL of Agrobacterium culture was added to 10 mL of IMAS (containing Kan) liquid medium and shaken at 200 rpm at 28°C until the OD 600The value was about 0.5. The collected conidia of Verticillium dahliae were thawed on ice in advance, and the conidia of Verticillium dahliae and Agrobacterium were mixed evenly in a ratio of 1:1. 200 μL of the mixture was evenly spread on the sterilized IMAS solid medium, and repeated 3 times. The plate coated with only the conidia of Verticillium dahliae was used as the positive control, and the plate coated with only the bacterial solution of the recombinant plasmid of Agrobacterium was used as the negative control. After 48 h, the filter paper was peeled off from the IMAS solid medium and placed on a PDA (containing HygB + Cef + Car + F2dU) plate, and cultured in the dark at 26 °C for 5-7 d. After the transformants grew, a single fungal colony was picked on the clean bench, streaked and inoculated on the PDA (containing Cef + HygB) medium, and cultured in the dark at 26 °C for 10 The plates were then incubated for approximately 14 days, during which the fungal growth was observed. Only knockout transformants that underwent homologous recombination grew on the resistant plates, while false-positive transformants did not. Once positive transformants emerged, single spores were isolated and subsequently tested. Ultimately, two knockout transformants were obtained.

[0053] Example 6: This example provides a method for constructing a VdCel6B gene complementation mutant EC-VdCel6B of Verticillium dahliae, as follows: Using the Verticillium dahliae mutant strain ΔVdCel6B constructed in Example 5 as the starting strain, a complementary mutant of the Verticillium dahliae VdCel6B gene (EC-VdCel6B) was obtained. The vector used was p1300-Neo-oLiC-Cas9-TtrpC. The vector was linearized with XbaI and BamHI. A 50 µL XbaI and BamHI double digestion system was prepared: 20 µL of p1300-Neo-oLiC-Cas9-TtrpC, 1 µL of XbaI, 1 µL of BamHI, 2.5 µL of 1×M buffer, and 25.5 µL of ddHO. Digestion was performed overnight at 37°C, and the desired band was recovered from the gel the next day. The complementary recombinant plasmid was constructed using the ClonExpress®II One Step Cloning Kit. The p1300-Neo-oLiC-Cas9-TtrpC and VdCel6B genes were ligated using Exnase II. The single-fragment ligation system for p1300-NeO-LiC-Cas9-TtrpC was as follows: 2 μL of 5×CE II buffer, 200 ng of p1300-Neo-oLiC-Cas9-TtrpC, 80 ng of the target gene fragment, 1 μL of Exnase II, and up to 10 μL of ddH2O. The ligation was carried out at 37°C for 30 min.

[0054] The remaining methods are the same as those for knockout. The difference from the acquisition of knockout positive transformants is that the acquisition of knockout mutants is to use 1.0×10 conidia of wild type V592 of Verticillium dahliae to 6 conidia / mL and Agrobacterium containing the knockout vector were mixed in equal proportions, and the positive transformants of the complementary mutants were obtained by mixing 1.0×10 conidia of the VdCel6B knockout mutant 6 conidia / mL is mixed with Agrobacterium containing complementary vector in equal proportions; secondly, the first screening culture medium of positive transformants of different complementary mutants of resistance screening culture medium is PDA+HygB+Cef+Tim+G418, and the second screening culture medium is PDA+Cef+G418.

[0055] Example 7: Determination of Colony Growth Rate: The VdCel6B gene-knockout mutant of Verticillium dahliae prepared in Example 5, the VdCel6B gene-complemented mutant prepared in Example 6, and wild-type strain V592 were cultured. Mycelium was inoculated in the center of a PDA culture medium and incubated in the dark at 22°C. Colony diameters of all strains were measured on days 5 and 9 after inoculation, and the average colony growth rate was calculated according to the following formula.

[0056] The average growth rate of the colony = (colony growth speed = (average colony growth diameter on the 9th day - average colony growth diameter on the 5th day) / 4).

[0057] Three replicates were set for each strain, and the colony morphology was recorded by taking photos on the 15th day.

[0058] Mycelial morphology observation: Different strains of Verticillium dahliae were streaked on PDA plates, and sterilized coverslips were inserted obliquely into the streaked areas. The plates were cultured in the dark at 22°C for 3 days, and the coverslips were removed to observe the mycelial growth under a microscope. Figure 6 There was no significant difference in the growth rates of the VdCel6B gene knockout mutants △Cel6A-1 and △Cel6A-2 and the complemented mutants EC-Cel6A-1 and EC-Cel6A-2, as well as the growth rate of the wild-type strain V592, indicating that the GH6 cellulase VdCel6B gene does not affect the growth rate of Verticillium dahliae.

[0059] Example 8: Determination of Microsclerotia Quantity: The VdCel6B gene knockout mutant of Verticillium dahliae prepared in Example 5, the VdCel6B gene complemented mutant prepared in Example 6, and wild-type strain V592 were cultured to obtain bacterial cakes. Approximately 10 bacterial cakes were punched out of each strain using a microporator and inoculated into Czapek liquid medium (containing Kan) and incubated in a shaker at 200 rpm at 26°C for 3-5 days. Conidia were collected by filtration and the conidia concentration was adjusted to 1.0×106 CFU / mL, draw 100 μL and spread evenly on MM plate (NaNO3 2g, KH2PO4 1g, MgSO4·7H2O 0.5g, KCl 0.5g, citric acid 10mg, ZnSO4·7H2O 10mg, FeSO4·7H2O 10mg, NH4Fe(SO4)2·12H2O 2.6mg, CuSO4·7H2O 0.5mg, NnSO4·H2O 0.1mg, H3BO3 0.1mg, Na2MoO4·2H2O 0.1mg, glucose 2g, 1.5 agar, add distilled water to 1L. 113℃, autoclave for 20min), culture in the dark at 22℃ for 15 d, take pictures and observe. The results are as follows. Figure 7 As shown, scrape the culture on the cellophane and weigh it, and record its wet weight. Then, place the microsclerotia at room temperature for 48 h to dry, weigh it on a balance, and record its dry weight data.

[0060] The results showed that the endocellulase knockout mutant VdCel6B could produce microsclerotia, indicating that VdCel6B is not a key gene for microsclerotia formation in Verticillium dahliae.

[0061] Example 9: In order to clarify whether VdCel6B gene knockout affects the conidia formation of Verticillium dahliae, the specific determination method is as follows: The concentration was 1.0×10 6 CFU / mL of the knockout mutant (the strain constructed in Example 5), the complementation strain (the strain constructed in Example 6), and V592 were inoculated into Czapek-Dox liquid medium, shaken at 26°C and 200 rpm for 5 days, and spores were isolated. 6 100 μL of a spore suspension containing 100 CFU / mL was inoculated into Czapek medium (containing kan). Three biological replicates were set up for each strain. The culture was shaken at 200 rpm in a 26°C shaker. 1 mL of the bacterial suspension was aspirated every 24 hours. The spore concentration was measured using a hemocytometer for 7 consecutive days and the data were recorded. The results are shown in the figure below. Figure 8 shown.

[0062] The results showed that starting from the third day, the conidia production of the VdCel6B knockout mutant strain was significantly lower than that of the wild-type strain V592. On the seventh day, the conidia production of the VdCel6B gene knockout mutant was 0.80 and 0.79 times that of the wild-type strain V592. There was no significant difference in the conidia production between the complement strain EC-VdCel6B and the wild-type strain, indicating that the GH6 cellulase gene is involved in regulating the conidia production ability of Verticillium dahliae.

[0063] The conidia of the mutant was observed under a microscope. The results were as follows: Figure 9 As shown in the results, it was found that the morphology of the conidia of the VdCel6B knockout mutant was not significantly different from that of V592, indicating that the reduced conidia production of the VdCel6B mutant was not related to the conidia.

[0064] Example 10: To clarify the effect of VdCel6B gene knockout on the pathogenicity of Verticillium dahliae, the pathogenicity of the VdCel6B gene knockout mutant to cotton was determined using the wild-type strain V592 and the complemented strain as controls. The pathogenicity determination method is as follows: The knockout mutants, complemented strains, and V592 constructed above were inoculated into Czapek-Dox liquid medium at 26°C and shaken at 200 rpm for 5 days. After the fifth true leaf of the cotton seedlings grew, 200 mL of 1.0 × 10 7 CFU / mL of bacterial solution, each strain was replicated in 3 hydroponic boxes (a total of 36 cotton seedlings). Observe every day after inoculation. Figure 10 As shown in A, the disease index is counted every three days from the onset of disease, generally until one month after onset. The disease grading scale is: Grade 0: No disease; Grade 1: 1-2 cotyledons diseased; Grade 2: 1 true leaf diseased; Grade 3: 2 true leaves diseased; Grade 4: 3 or more true leaves diseased. The disease index is calculated using the following formula.

[0065] Disease index = [Σnumber of diseased plants at each level × level / (total number of plants × highest disease level)] × 100; The disease index is the average value of three biological experiments repeated. Figure 10 As shown in B.

[0066] The results showed that the VdCel6B knockout mutant exhibited reduced pathogenicity compared to the wild-type strain V592. On the 26th day after inoculation, the disease index of the wild-type strain V592 was 97.92, while that of the VdCel6B knockout mutant was lower than that of V592, indicating that cellulase genes are involved in the pathogenicity of Verticillium dahliae.

[0067] Example 11: To analyze whether the reduction in pathogenicity of Verticillium dahliae caused by VdCel6B gene knockout is related to its ability to penetrate the host, a cellophane penetration test was performed on each knockout mutant strain using V592 as a control. The specific method is as follows: On the poured MM basic medium, spread a piece of sterilized cellophane paper that is roughly the same size as the culture dish. Use a toothpick to pick up the mycelium and inoculate it into the center of the cellophane paper. Culture for 3 days and then remove the cellophane paper. Let the strain grow for another 7 days and observe whether colonies can grow on the culture dish. Set up 3 replicates for each strain. The results are as follows: Figure 11 shown.

[0068] The results showed that the mutant strain of the GH6 cellulase VdCel6B gene was able to penetrate cellophane and grow normally on the culture medium, indicating that knocking out the VdCel6B gene had no effect on the penetration ability of Verticillium dahliae.

[0069] Example 12: Determination of cellulase activity of VdCel6B knockout mutants. In order to clarify the effect of the VdCel6B gene on cellulase activity, the specific experimental method is as follows: mycelia of different strains were picked with a sterile toothpick and inoculated into Czapek solid medium with sodium carboxymethyl cellulose as the sole carbon source (NaNO3 2 g / L, KCl 0.5 g / L, K2HPO4 1 g / L, FeSO4 0.01 g / L, MgSO4·7H2O 0.5 g / L, sodium carboxymethyl cellulose 5 g / L, agar 15 g / L). After culturing in the dark at 26°C for 15 days, the cells were stained with 1 mg / mL Congo red solution. After 10 minutes, the Congo red solution was discarded, and the cells were rinsed three times with 1 mol / L NaCl solution. After standing for 3 minutes, the size of the transparent zone produced by the colonies was measured and recorded, as shown in FIG. Figure 12 Data were processed and analyzed using SPSS 26.0 software. The results showed that the clearing zone produced by the VdCel6B knockout mutant was significantly smaller than that of the wild-type strain V592, indicating that the VdCel6B protein can degrade cellulose and has cellulase activity.

[0070] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. Use of the Verticillium dahliae GH6 cellulase VdCel6B gene in inhibiting Verticillium dahliae infection of plants, characterized in that: The nucleotide sequence of the VdCel6B gene is shown in the sequence listing SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The plants include cotton.

3. The use according to claim 1, characterized in that: The VdCel6B gene exerts its pathogenic effect by degrading plant cell walls through cellulase and inhibiting plant immune response.

4. Application of the Verticillium dahliae GH6 cellulase VdCel6B gene in promoting the growth and development of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdCel6B gene is shown in the sequence listing SEQ ID NO.

1.

5. The use of the Verticillium dahliae GH6 cellulase VdCel6B gene in influencing the pathogenicity of Verticillium dahliae, characterized in that: The nucleotide sequence of the VdCel6B gene is shown in the sequence listing SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The pathogenicity includes at least one of disease index, hyphae penetration ability and host colonization ability.

7. Application of the Verticillium dahliae GH6 cellulase VdCel6B gene in influencing plant resistance, characterized in that: The nucleotide sequence of the VdCel6B gene is shown in the sequence listing SEQ ID NO.

1.

8. The use according to claim 7, characterized in that: The plants include cotton.

9. The use according to claim 7, characterized in that: The plant resistance includes at least one of a plant necrosis response and the ability to express a disease resistance gene.

10. The use according to claim 9, characterized in that: The disease resistance gene includes at least one of NbAcre31, NbLOX and NbPR4.

Images