MCD-mediated DNA plasmid plant transient transformation system and application thereof

Abstract

The invention discloses an MCD (microcytidine monophosphate) mediated DNA (deoxyribonucleic acid) plasmid plant instantaneous transformation system and application thereof. The transformation system is a solution containing the following components: MCD nanometer, plasmid DNA, Tween-20 and MES Buffer. The transformation system can be used for researching various functional genomes, including verification of gene functions, protein interaction and regulation, omics research and genome editing under biological and abiotic stress in wheat, and can promote wheat functional genome research. By utilizing the system, instantaneous transformation can be realized in some plants which are difficult to realize constitutive transgenosis; the method can be used for functional verification of stress tolerance genes of wheat or other crops, and functional genome research of wheat or other crops is greatly accelerated; the method can be applied to a bioreactor for in-vivo expression of related proteins; or for efficient gene knockout, DNA-free genetically modified plants can be produced.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and relates to a new system for accelerating wheat gene function research and its application in wheat research; specifically, it relates to an MCD-mediated DNA plasmid efficient instantaneous plant transformation system and its application. Background Art

[0002] Nanoparticles (NPs) have been widely used in various fields of science and technology, including physics, chemistry, materials science, life science, diagnosis and treatment of human diseases, and medicine. At the same time, its application on plants, especially in modern agricultural technology, has also received increasing attention. Increasing evidence shows that NPs can play a role as potential regulators or mediators in various biological processes, especially in the regulation of important agronomic traits. They include: physiological, biochemical and molecular regulation of plant growth and development and crop biofortification; uptake of macro- and micro-essential elements; mitigation of biotic and abiotic stresses; and applications in agriculture and food technology, including: nanofertilizers and biostimulants for plant growth promotion; promoters for improving the quality and shelf life of postharvest fruits and vegetables; elicitors for improving secondary metabolites; and nanopesticides and herbicides for protecting plants and improving crop productivity. Therefore, nanoparticles have broad application prospects in sustainable agriculture and agro-processing industries.

[0003] Importantly, NPs can mediate CRISPR / Cas or other genome editing systems in plants without transgenic integration, which has the potential to produce DNA-free genetically modified plants, thereby avoiding the restrictions of GMO regulatory policies. Unlike most nanoparticles, carbon dots (CDs) can be degraded to produce carbon dioxide and water. MCD is a process in which two graphite rods are placed in parallel in ultrapure water, and a 25v-30v DC voltage is applied on both sides. After electrolysis for several weeks, one of the graphites is completely corroded, the solvent is centrifuged to obtain the supernatant, and then the supernatant is dialyzed with a 2500da cellulose filter membrane deionized water for 1-3 days to obtain a carbon dot (CD) solution, which makes it a rising star and environmentally friendly nanoparticle for application in plants, especially in agricultural ecosystems. In fact, MCDs have been reported to play a role in regulating plant growth and development, resistance to biotic and abiotic stresses; biosensors; regulation of gene expression and enzyme activity, and delivery silencing of gene overexpression or nucleic acids. This greatly expands the application of MCDs or other NPs in molecular biology and functional genomics research and bioengineering to improve desired agronomic traits in plants, such as abiotic or biotic resistance, crop yield and quality.

[0004] Transformation of plants relies on other transformable species or varieties, or on transient transformation using chloroplasts or tobacco leaves, or on VIGS-mediated transformation, thus limiting the progress of functional genomic studies. Emerging species-independent NP-mediated transient transformation allows verification of gene function in the same material, thus tending to facilitate functional genomic studies in plants, especially for these species that present great challenges in constitutive genetic transformation. However, most NP-mediated nucleic acid delivery is performed in specific tissues or plastids, such as roots, callus, leaves or chloroplasts, or specific regions of leaf tissue, and the transformation efficiency is variable. Therefore, any NP-mediated efficient delivery system for whole plants or seedlings with uniformly transformed nucleic acids is urgently needed and deserves more investment.

[0005] The invention patent has developed an MCD-mediated DNA plasmid plant transient transformation system, which is used to efficiently and transiently transform wheat seeds with DNA plasmids, and obtains complete germination wheat seedlings with transformation DNA plasmids. This shows that the system is a good platform for various functional genomic studies, including verification of gene functions under biotic and abiotic stresses in wheat, protein interactions and regulation, omics research and genome editing, thus greatly promoting the study of wheat functional genomics. Summary of the invention

[0006] The present invention aims to provide a MCD-mediated DNA plasmid efficient instantaneous plant transformation system and its application. The transformation system can be applied to the agricultural field, biological breeding and scientific research.

[0007] The purpose of the present invention can be achieved through the following technical solutions:

[0008] In a first aspect, the present invention claims protection for a MCD-mediated DNA plasmid plant transformation system, which is a solution comprising the following components: MCD nano, plasmid DNA, Tween-20 and MES Buffer.

[0009] Furthermore, the final concentrations of the components in the transformation system are: 0.01-0.1 mg / mL MCD nanoparticles, 0.1%-1% (v / v) Tween-20, 5-10 ng / uL plasmid DNA and 5-20 mM MES Buffer pH 5.8.

[0010] Preferably, the final concentrations of the components in the transformation system are: 0.01-0.1 mg / mL MCD nanoparticles, 0.2%-0.8% (v / v) Tween-20, 5-10 ng / uL plasmid DNA and 5-15 mM MES Buffer pH 5.8.

[0011] Further preferably, the final concentrations of the components in the transformation system are: 0.01-0.05 mg / mL MCD nanoparticles, 0.5% (v / v) Tween-20, 5-10 ng / uL plasmid DNA and 10 mM MES Buffer pH 5.8.

[0012] More preferably, the final concentrations of the components in the transformation system are: 0.01-0.03 mg / mL MCD nanoparticles, 0.5% (v / v) Tween-20, 5-10 ng / uL plasmid DNA and 10 mM MES Buffer pH 5.8.

[0013] Further, the plasmid DNA is a recombinant plasmid or a non-recombinant plasmid. The plasmid DNA described in the technical solution of the present invention can be a plasmid DNA extracted from various expression vectors, is not limited to a recombinant vector, and can also be an empty vector with a label. For different purposes, different vectors are used. For example: to verify gene function, interaction, etc., it is necessary to use a recombinant vector inserted with the target gene.

[0014] Further, after mixing the components in the conversion system, the mixture is placed in a water bath at 30-37° C. for 20-40 minutes, and gently mixed every 10-15 minutes to obtain a reaction system. Preferably, the mixture is placed in a water bath at 37° C. for 30 minutes.

[0015] Furthermore, the plasmid DNA can be used for single plasmid transformation or multi-plasmid co-transformation. When the plasmid DNA is used for multi-plasmid co-transformation, the concentration of each plasmid is evenly distributed so that the total final concentration of each plasmid is 5-10 ng / u L.

[0016] Further, the MCD nano solution is prepared according to the following method:

[0017] (1) Two high-purity graphite rods are placed in parallel in ultrapure water, and a DC voltage of 15V-30V is applied on both sides. After electrolysis for 3-5 weeks, the obtained solution is centrifuged to recover the supernatant, and then dialyzed in deionized water for 1-3 days using a 2500Da cellulose filter membrane to obtain a carbon dot solution (CDs solution);

[0018] (2) Add N-methyl-N-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) to a carbon dot solution with a concentration of 0.5-1.5 mg / ml to activate the carboxyl group for 1.5-3 hours, then add a PEI600 aqueous solution with a concentration of 3-7 mg / ml, react for 3-5 hours, and then dialyze the solution for 1-3 days to obtain an MCD nano solution.

[0019] Furthermore, 30-50 mg of N-methyl-N-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) was added to 5-15 ml of a 0.5-1.5 mg / ml carbon dot solution, and after the reaction, 5 ml of a 3-7 mg / ml PEI600 aqueous solution was added to react.

[0020] In a specific embodiment of the present invention, the specific preparation process of the MCD nano solution is:

[0021] (1) Two high-purity graphite rods were placed in parallel in ultrapure water, and a 20 V DC voltage was applied on both sides. After 4 weeks of electrolysis, the obtained solution was centrifuged to recover the supernatant, and then dialyzed in deionized water with a 2500 Da cellulose filter membrane for 2 days to obtain a carbon dot solution (CDs solution);

[0022] (2) Add 30-50 mg N-methyl-N-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) to 10 ml of 1.0 mg / ml carbon dot solution to activate the carboxyl group for 2 hours, then add 5 mL of 5 mg / ml PEI600 aqueous solution for treatment. After 4 hours of reaction, the solution was dialyzed for 2 days to obtain the modified CD (MCD) nano solution. Finally, the MCD particle size was detected using a FEI / PhilipsTecnai G2 F20 transmission electron microscope to obtain a transmission electron microscope (TEM) image. The synthesized MCDs can be stable for more than 6 months at 4-8°C.

[0023] In a second aspect, the present invention seeks to protect the use of the above transformation system in the efficient transient transformation of plants by DNA plasmids.

[0024] In a third aspect, the present invention seeks to protect a method for efficient transient transformation of plants with DNA plasmids mediated by MCD, wherein plant materials are immersed in the above-mentioned transformation system to perform transient transformation of plants with DNA plasmids.

[0025] The process of instantaneous transformation of plants by the DNA plasmid is as follows: soak the plant material to be transformed in the transformation system, overnight at 4°C; incubate again at 37°C for 30 minutes, then take it out and put it in a vacuum pump to evacuate (600 MPa) for 5 minutes, slowly restore to normal atmospheric pressure, and then repeat the evacuation; and again overnight at 4°C.

[0026] In the technical solution described in the present invention, the plant is a dicotyledon or a monocotyledon; preferably, the monocotyledon is corn, wheat or rice; the dicotyledon is cotton, soybean, peanut, sunflower, sweet potato, potato, apple, tobacco, mint or melon.

[0027] In the technical solution of the present invention, the DNA plasmid transiently transformed plant is at least one of a plant cell line, a plant protoplast, a plant tissue, a plant organ and a plant body. The plant tissue may be a plant callus, but is not limited thereto. The plant organ may be a plant vegetative organ or a reproductive organ (such as a plant seed).

[0028] In a specific embodiment of the present invention, the transformation system of the present invention is used to efficiently and instantaneously transform wheat seeds with DNA plasmids, and complete germinating wheat seedlings with transformation DNA plasmids are obtained. Various functional genomic studies are conducted, including verification of gene functions under biotic and abiotic stresses in wheat, protein interactions and regulation, omics studies and genome editing, thereby greatly promoting the study of wheat functional genomics.

[0029] The room temperature described in the present invention is 25±10° C., but is not limited thereto.

[0030] Compared with Patent 2020103731269, this patent has the following innovations: (1) This patent is simple to operate, and directly soaks the seeds to obtain a more uniformly expressed signal; (2) Compared with the coating method in the prior art, this patent can reduce damage to plant leaves; The prior art has conducted research on plants such as rice and Arabidopsis, and this patent has achieved a breakthrough in many types of wheat that are difficult to genetically modify.

[0031] Beneficial effects of the present invention:

[0032] This invention reports for the first time the establishment and application of a new system for accelerating the study of wheat gene function, which can be used to deliver DNA, RNA, protein, etc. into plant cells, and is widely used, such as protein interaction, regulatory relationship, enhancer and inducible enhancer, promoter verification, and functional verification of biological and non-biological related genes. This shows that the system is a good platform for various functional genomic studies, omics studies, etc., thereby greatly promoting the functional genomic research of wheat, and ultimately helping to ensure the national wheat yield and quality safety. Secondly, carbon dot (CD) nanoparticles can be degraded to produce carbon dioxide and water, which makes it a rising star and environmentally friendly nanoparticle used in plants, especially agricultural ecosystems. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Modified carbon dot nanoparticles mediated transient transformation of wheat seeds;

[0034] Among them, A is the 35s-luc in vivo imaging of various wheat varieties; B is the GFP signal display; C is the Gus result display.

[0035] Figure 2 Protein interaction verification;

[0036] Among them, A is the YFP signal display diagram; B is the COIP result display diagram; Figure C is the luc interaction result display diagram. Figure 3 Enhancer and inducible enhancer validation;

[0037] Figure 3 Enhancer and inducible enhancer validation; Among them, A is the enhancer verification result diagram; B is the GFP signal before and after induction of the inducible enhancer; C is the relative expression level of the gene before and after induction.

[0038] Figure 4 Verification of regulatory relationships;

[0039] Among them, A is the regulatory relationship verification result diagram; B is the regulatory relationship carrier construction model diagram.

[0040] Figure 5 Functional verification of powdery mildew resistance and heat tolerance genes in wheat;

[0041] Among them, A is the functional verification of the powdery mildew resistance gene; B is the protein expression detection; C is the powdery mildew hyphae staining; D is the functional verification of the heat-resistant gene in Chinese spring.

[0042] Figure 6 This is the germination and growth of wheat before and after nano-MCD treatment. DETAILED DESCRIPTION

[0043] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0045] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0046] Example 1 MCD-mediated DNA plasmid plant transformation system

[0047] 1. Preparation of MCD nano solution:

[0048] (1) Two high-purity graphite rods were placed in parallel in 1L ultrapure water, and a 20V DC voltage was applied on both sides. After 4 weeks of electrolysis, the obtained solution was centrifuged to recover the supernatant, which was then loaded into a cellulose filter membrane (2500Da) and dialyzed in deionized water for 2 days to obtain a carbon dot solution (CDs solution);

[0049] (2) 30-50 mg of N-methyl-N-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was added to 10 ml of 1.0 mg / ml carbon dot solution to activate the carboxyl group for 2 hours, and then 5 mL of 5 mg / ml PEI600 aqueous solution was added to produce modified CD (MCD). After 4 hours of reaction, the solution was dialyzed for 2 days to obtain a modified CD (MCD) nano solution (0.7 mg / mL). Finally, the MCD particle size was detected using a FEI / Philips Tecnai G2 F20 transmission electron microscope to obtain a transmission electron microscope (TEM) image. The synthesized MCDs can be stable for more than 6 months at 4-8°C.

[0050] 2. Preparation of MCD-mediated DNA plasmid plant transformation system

[0051] The components of the transformation system are shown in Table 1.

[0052] Table 1 MCD-mediated DNA plasmid plant transformation system

[0053] Buffer Final concentration MCD Nano 0.014mg / mL Tween-20 0.5%(v / v) plasmid DNA 10ng / uL 200mM MES Buffer pH 5.8 10mM

[0054] Measure each component of the transformation system, add miliQ H2O (18Ω) to the fixed volume; then, incubate in a 37℃ water bath for 30min (gently mix every 15min) to obtain the reaction system. If multiple plasmids are transformed together, the final plasmid concentration must be evenly distributed and the final concentration of all plasmids must be maintained at 10ng / uL.

[0055] Example 2 Modified carbon dot nanoparticles mediated transient transformation of wheat seeds

[0056] (1) The reaction system was prepared according to the method described in Example 1. The plasmid DNAs were 35s-EN-luciferase vector, GFP-tagged vector pCAMBIA1305, and GUS-tagged vector pCAMBIA1300.

[0057] The construction method of the 35s-EN-luciferase vector is as follows: using the luciferase vector as a skeleton, double-digesting the vector with PstI and SpeI enzymes, and then connecting the following gene fragments to the vector by homologous recombination.

[0058] Primer F: CTGCAGAAGATGCCTCTGCC

[0059] Primer R: ACTAGTGGTCTTGCGAAGGATA)

[0060] Gene fragment:

[0061] AAGATGCCTCTGCCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGT

[0062] GGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGACATCTCC ACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACC.

[0063] (2) Select wheat seeds with a good germination rate, wait for the reaction system to return to room temperature, soak the seeds in the reaction system, and place them in a 4°C refrigerator overnight.

[0064] (3) The next day, take out the tube and place it in a 37°C water bath to incubate it again for 30 min. Then take it out and place it in a vacuum pump to evacuate the air (600 MPa) for 5 min. Slowly restore the pressure to normal and then repeat the evacuation.

[0065] (4) Place in a 4°C refrigerator again overnight.

[0066] (5) Take out the seeds, rinse them several times with sterilized water, and place them on two layers of moistened filter paper to germinate.

[0067] (6) After germination, plant the seeds in nutrient soil and then grow them in an incubator at 22°C for 5 days.

[0068] (7) If the transformed plasmid is a LUC vector, the LUC signal can be observed by spraying 1 mM fluorescein sodium salt and then placing the cell in a living imager (see Figure 1 A). If the transformed plasmid contains a GFP tag, a relatively uniform GFP signal can be observed under a laser confocal microscope by taking plant leaves (see Figure 1 B). If the transformed plasmid contains a GUS tag, the GUS signal can be observed in the seeds using a GUS staining kit (see Figure 1 C).

[0069] Example 3 Verification of protein interaction relationship (i) Construction of BIFC, LUC, and COIP vectors, and plasmid extraction.

[0070] The detailed process of each vector construction is as follows:

[0071] (1) BIFC vectors using pxy106(nYFP) and pxy104(cYFP). The full-length CDS of Rf2b and PRE6 were cloned into the binary yellow fluorescent protein (YFP) BiFC vectors pXY104(cYFP) and pXY106(nYFP) to generate the recombinant plasmids Rf2b-cYFP and PRE6-nYFP, respectively.

[0072] Rf2b and PRE6 refer to the published literature Profiling of H3K4me3 and H3K27me3 and Their Roles in Gene Subfunctionalization in Allotetraploid Cotton (2021). The primer sequences used in the vector construction process are as follows:

[0073] PRE6-106 F:atcgaggacgccggcggatccATGTCAGGCAGAAGATCACG

[0074] PRE6-106 R:caggtcgactctagaggatccTTATTGCATAAGTAAACTCCT

[0075] RF2b-104F: attacaggtacccggggatccATGCAGGATCCACCAAGTCTG

[0076] RF2b-104R:gccgtcgactctagaggatccTAATGTTCCACTACTTTCAC.

[0077] (2) COIP uses pCAMBIA1305-FLAG and PWMB110-HIS vectors to clone the full-length CDS of TaSG and SIP2, SIP3, and SIP4 into pCAMBIA1305-FLAG and PWMB110-HIS to generate recombinant plasmids TaSG-1305-FLAG, SIP2-110-HIS, SIP3-110-HIS, and SIP4-110-HIS, respectively. The primer sequences used in the vector construction process are as follows:

[0078] Tasg+his+110_F:caggtcgactctagaggatccATGGAGGCGCCGCCGG

[0079] Tasg+his+110_R:

[0080] gagctcggtacccggggatccGTGATGGTGATGGTGATGGCTCCCAGCATGGGCG

[0081] SIP2-1305-F: ttggagaggacagccgtcgacATGAGCCAAGAGGACTCGACG

[0082] SIP2-1305-R:gctcaccatgttaacgtcgacCTGCCTTAAGCTCTGCAAAATATACT

[0083] SIP3-1305-F:ttggagaggacagccgtcgacATGGCTCCGATCAAGATCGG

[0084] SIP3-1305-R: gctcaccatgttaacgtcgacCTTGGAGCTGTGCATGTGACG

[0085] SIP4-1305-F: ttggagaggacagccgtcgacATGTTTGTCTGTGGTGTCAATGAGA

[0086] SIP4-1305-R:gctcaccatgttaacgtcgacTTTTGCACATAATCTCTTGAACTGG.

[0087] PWMB110 uses the BamH1 restriction site, and pCAMBIA1305 uses the Sal1 Hpa1 double restriction site.

[0088] (3) LUC Vectors The full-length CDSs of TaSG and SIP2, SIP3, and SIP4 were cloned into pCAMBIA1300-cluc and pCAMBIA1300-nluc using pCAMBIA1305-nLUC and pCAMBIA1300-cLUC vectors to generate recombinant plasmids NLUC-TaSG, CLUC-SIP2, CLUC-SIP3, and CLUC-SIP4, respectively.

[0089] The primer sequences used in the vector construction process are as follows:

[0090] NLUC-TaSG-FGACGAGCTCGGTACCATGGAGGCGCCGCC

[0091] NLUC-TaSG-R CGAGATCTGGTCGACCTAGCTCCCAGCATGGGC

[0092] CLUC-SIP2-F TCCCGGGGCGGTACCATGAGCCAAGAGGACTCGAC

[0093] CLUC-SIP2-R GCTCTGCAGGTCGACCTACTGCCTTAAGCTCTGCAAA

[0094] CLUC-SIP3-F TCCCGGGGCGGTACCATGGCTCCGATCAAGATCG

[0095] CLUC-SIP3-R GCTCTGCAGGTCGACTTACTTGGAGCTGTGCATGTGA

[0096] CLUC-SIP4-F TCCCGGGGCGGTACCATGTTTGTCTGTGGTGTCAATGAG

[0097] CLUC-SIP4-R GCTCTGCAGGTCGACCTATTTTGCACATAATCTCTTGAAC

[0098] NLUC uses the Sac1 restriction site, and CLUC uses the KPn1 restriction site.

[0099] (2) The reaction system was prepared according to the method described in Example 1. At this time, two paired plasmids, Rf2b-cYFP and PRE6-nYFP, NLUC-TaSG and CLUC-SIP2, NLUC-TaSG and CLUC-SIP3, and NLUC-TaSG and CLUC-SIP4, were added. Therefore, the final concentration of each plasmid was changed to 5 ng / u L, and then incubated in a 37°C water bath for 30 min.

[0100] (3) The seeds were placed in the reaction system and then soaked in a refrigerator at 4°C. The specific method was the same as in Example 2. Three replicates were performed for each reaction. Nanoplasmid-free, single plasmid-transformed, and empty-transformed leaves were used as controls.

[0101] (4) In leaves co-transformed with the dual plasmids Rf2b-cYFP and PRE6-nYFP, the BIFC vector can be observed under a laser confocal microscope to produce an obvious yellow fluorescent signal (see Figure 2 A). Leaves co-transformed with LUC vectors containing two genes, NLUC-TaSG and CLUC-SIP2, NLUC-TaSG and CLUC-SIP3, and NLUC-TaSG and CLUC-SIP4, showed obvious LUC signals in the live imaging instrument after spraying with 1 mM luciferin sodium salt, while no signal was observed in leaves transformed with a single plasmid or in the control. (See Figure 2 C).

[0102] Plants transformed with the COIP vector need to have their leaves harvested after 5-6 days. After protein extraction and purification, Western Blot experiments are performed using antibodies with different labels. The detailed steps are as follows:

[0103] 1) The two interacting genes are constructed separately onto two vectors driven by strong promoters and with different tags; the specific construction method is the same as described in step (a) of implementation case 3.

[0104] 2) According to the above method, the two plasmids were co-transformed into the plants at the same time, and then the leaves of the plants were collected after 5-6 days of growth.

[0105] 3) The plant leaves were quickly frozen with liquid nitrogen and then ground into powder.

[0106] 4) Prepare protein extraction buffer, the formula is as follows:

[0107]

[0108] 4) Take 2 ml of powder from each sample and place it in a 15 ml centrifuge tube, then add 3 ml of protein extraction buffer and mix well.

[0109] 5) Place on ice for 10 min and centrifuge at 12600 rpm at 4°C for 10 min.

[0110] 6) Take the supernatant into a new centrifuge tube and repeat the centrifugation twice. Add 5ul HIS antibody and FLAG antibody to different samples respectively and place them in a rotating rack at 4℃ overnight.

[0111] 7) Take out 20ul of the corresponding antibody beads, wash twice with PBST solution containing 0.01% (v / v) Tween-20, then add to the protein extraction solution and incubate at room temperature for 4h.

[0112] 8) Collect the beads using a magnetic stand, then add 50ul PBST, 10ul 5× protein loading buffer, and 5ul β-mercaptoethanol and mix well.

[0113] 9) Boil at 100℃ for 10 min, and quickly place on ice for 15 min. Then proceed with the subsequent Western Blot experiment, using different and same antibodies as in step 6 for incubation and development (see Figure 2 B).

[0114] Example 4 Enhancer and Inducible Enhancer Verification

[0115] (1) The gene enhancer was constructed into the enhancer verification vector Pjit163-Mini35S-GFP, and then 35s and mini35s were used as positive and negative controls.

[0116] The details are as follows: Pjit163-Mini35S-GFP is used as the backbone vector, and the enhancer DNA sequence is inserted between the KpnI and SacI restriction sites of the transient expression vector to obtain the Pjit163-Mini35S+enhancer-GFP recombinant plasmid. The primer sequences used in the vector construction process are as follows:

[0117] CSPMIE+163-F:gtgccaagctaattcgagctcACAACAGTCGTGATGCCTCCC

[0118] CSPMIE+163-R:gaagggtcttgcgaaggtaccGTGTCAAAGTCACAGGGTACCTTTT

[0119] Enhancer DNA sequence:

[0120] ACAACAGTCGTGATGCCTCCCTACAAGTCCCTCCATTACTCTGATATTTTTCTTGACAATT

[0121] TTGCAAATGAGCACACGATCTACCTTGTAAACAAATATGAGTACATAAAGACTGGAAAAGGTACCCTGTGACTTTGAC.

[0122] (2) The transformation method is the same as in Example 2.

[0123] (3) Then, by comparing the signal strength with that of mini35s, it can be determined whether the sequence is an enhancer (see Figure 3 A).

[0124] (4) If the enhancer is stress-induced, the strength of the signal before and after treatment can be observed by artificially creating stress (see Figure 3 B) to determine whether the sequence is induced. RT-QPCR can also be used to detect changes in gene relative expression (see Figure 3 C).

[0125] Example 5 Verification of regulatory relationship

[0126] The genes Rf2b and PRE6 were constructed into two vectors, p Green II 62-SK and p Green II 0800-LUC, respectively. The regulatory relationship between the two can be verified by the change in the intensity of the LUC signal. For example, in the transcription activation verification, when the two plasmids were co-transformed, the LUC signal was significantly enhanced (see Figure 4A, wherein Control-CDP is a nanosystem without gene (including water, Tween-20, cdp); the specific steps are:

[0127] 1) Gene Rf2b and PRE6 were constructed into p Green II 62-SK (62-SK) and p Green II

[0128] 0800-LUC (0800-LUC) vector: The full-length CDS of Rf2b and PRE6 genes (Profiling of H3K4me3 and H3K27me3 and Their Roles in Gene Subfunctionalization in Allotetraploid Cotton (2021)) were cloned into p Green II 62-SK and p Green II 0800-LUC vectors to generate recombinant plasmids Rf2b-62-SK and PRE6-0800-LUC (as Figure 4 B). The primer sequences used in the vector construction process are as follows:

[0129] PRE6-0800 F:ggtcgacggtatcgataagcttTCATTGTACCTTAATTAACTC

[0130] PRE6-0800 R:gcaggaattcgatatcaagcttAGGGTTTCGAGTCTACTCCGAA

[0131] RF2b-62SKF: atcccccgggctgcaggaattcATGCAGGATCCACCAAGTCTG

[0132] RF2b-62SKR: cgataagcttgatatcgaattcTCATAATGTTCCACTACTTTC.

[0133] 2) The plasmid was transformed into wheat using the same transformation method as in Example 2.

[0134] 3) At the same time, leaves that were transformed alone or without transformation were used as controls, and each was repeated 3 times.

[0135] 4) After 4-5 days of growth, cut the first leaf of the wheat and spray it with 1 mM fluorescein sodium salt.

[0136] 5) Under the in vivo imaging device, the strength comparison of the LUC signal when two target genes are co-transformed and the signal when the empty vector is transformed can be seen to determine whether it is transcriptional activation or transcriptional inhibition.

[0137] Example 5 Verification of the Function of Powdery Mildew Resistance and Heat Tolerance Genes in Wheat

[0138] Constructing related overexpression vectors and using this system to transform into wheat can quickly verify the functions of related genes, which greatly accelerates the research on wheat functional genomics. Specific steps:

[0139] 1) Construction of gene overexpression vector: The complete CDS of the known powdery mildew resistance gene PM21 (Pm21 from Haynaldia villosa encodes a CC-NBS-LRR that confers powdery mildew resistance in wheat) and the complete CDS of the gene NLR1 of unknown function (202311522838.2) were cloned into the pCAMBIA1305 vector to generate recombinant plasmids 1305-PM21 and 1305-NLR1, respectively.

[0140] The complete CDS of the unknown function genes HSF1 and HSR2 were cloned into the pWMB110 vector to generate recombinant plasmids 110-HSF1 and 110-HSF2, respectively. The primer sequences used in the vector construction process are as follows:

[0141] HSF2-F:CCCACCGTCTCCCTCATT

[0142] HSF2-R:GTTCTTCAGCTTCTACTCCCTACC

[0143] HSF1-F:TCTCCACGCTACGCTATCC

[0144] HSF1-R: CCACATACAACTTGCTTCTTTC

[0145] Using PWMB110 as the backbone, the fragments were cut with BamH1 and connected by homologous recombination.

[0146] 2) The plasmid is transformed into wheat using the same transformation method as in Example 2; if the vector carries hygromycin resistance, screening can be performed using an aqueous solution of hygromycin at an appropriate concentration.

[0147] 3) After the selected wheat has grown for 4-5 days, artificial adversity can be created to observe the phenotype.

[0148] 4) If the gene is a wheat powdery mildew resistance gene, it can be determined whether the gene has disease resistance by using a known disease resistance gene, such as PM21, as a control and then observing the phenotype 6-7 days after inoculation (see Figure 5 A), if the vector has a tag. Protein expression can also be verified by Western Blot experiment (see Figure 5 B). You can also dye the white powder hyphae and observe the growth rate of the hyphae under a microscope. (See Figure 5 C)

[0149] 5) If the gene is a wheat heat-resistant gene, the gene function can also be determined by observing the phenotype through heat treatment (see Figure 5 D).

[0150] Example 6 MCD is an environmentally friendly carbon dot nanoparticle.

[0151] To study whether MCD carbon dot nanoparticles have a significant effect on plant germination and subsequent growth, we used wheat Fielder as the research material and compared three treatments: ck (water), MCD only, and MCD+plasmid. We found that MCD did not significantly affect wheat seed germination and subsequent wheat growth. (See Figure 6 ) This shows that MCD nanoparticles prepared using degradable carbon dots are more environmentally friendly compared to nanoparticles prepared from metals.

Claims

1. A MCD-mediated DNA plasmid plant transformation system, characterized in that: The transformation system is a solution containing the following components: MCD nanoparticles, plasmid DNA, Tween-20 and MES Buffer.

2. The transformation system according to claim 1, characterized in that The final concentrations of the components in the transformation system are: 0.01-0.1 mg / mL MCD nanoparticles, 0.1%-1% Tween-20, 5-10 ng / uL plasmid DNA and 5-20 mM MES Buffer pH 5.

8.

3. The plant transformation system according to claim 1 or 2, characterized in that: The plasmid DNA is a recombinant plasmid or a non-recombinant plasmid.

4. The transformation system according to claim 1 or 2, characterized in that After mixing the components in the transformation system, place them in a water bath at 30-37°C for 20-40 minutes, gently mixing every 10-15 minutes to obtain a reaction system.

5. The transformation system according to claim 1, 2 or 3, characterized in that: When the plasmid DNA is used for co-transformation of multiple plasmids, the concentration of each plasmid is evenly distributed so that the total final concentration of each plasmid is 5-10 ng / u L.

6. The transformation system according to claim 1 or 2, characterized in that The MCD nanoparticles are prepared according to the following method: (1) Two high-purity graphite rods are placed in parallel in ultrapure water, and a DC voltage of 15V-30V is applied on both sides. After electrolysis for 3-5 weeks, the obtained solution is centrifuged to recover the supernatant, and then dialyzed in deionized water for 1-3 days using a 2500Da cellulose filter membrane to obtain a carbon dot solution (CDs solution); (2) Add N-methyl-N-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) to a carbon dot solution with a concentration of 0.5-1.5 mg / ml to activate the carboxyl group for 1.5-3 hours, then add a PEI600 aqueous solution with a concentration of 3-7 mg / ml, react for 3-5 hours, and dialyze the solution for 1-3 days to obtain a MCD nanoparticle solution.

7. Use of the transformation system according to any one of claims 1 to 6 in the efficient transient transformation of plants with DNA plasmids.

8. A method for efficient transient transformation of plants by DNA plasmids mediated by MCD, characterized in that: The plant material is immersed in the transformation system described in any one of claims 1 to 6 to perform DNA plasmid transient transformation of the plant.

9. The use according to claim 7, the method according to claim 8, characterized in that: The plant is a dicotyledon or a monocotyledon; preferably, the monocotyledon is corn, wheat or rice; the dicotyledon is cotton, soybean, peanut, sweet potato, potato, cucumber, highland barley, alfalfa, wheatgrass, tobacco, Chinese cabbage or melon.

10. The use according to claim 7, the method according to claim 8, characterized in that: The DNA plasmid transiently transforms the plant into at least one of a plant cell line, a plant protoplast, a plant tissue, a plant organ and a plant body.

Images