Method for preventing and controlling heavy metal accumulation in arabidopsis thaliana and guaranteeing safe agricultural use of wastewater and sludge by AT2G23440.1 gene

Abstract

The invention discloses application of an AT2G23440.1 gene in preventing and controlling heavy metal accumulation in arabidopsis thaliana and a method for promoting growth of arabidopsis thaliana. The AT2G23440.1 gene with the nucleotide sequence shown as SEQ ID NO: 1 in arabidopsis thaliana is over-expressed, so that the growth of the arabidopsis thaliana can be promoted. According to the invention, an efficient, safe and environment-friendly sludge culture medium application technology can be developed by utilizing the positive regulation effect of the AT2G23440.1 gene in the adversity stress response process of an arabidopsis thaliana plant, combining with a modern genetic engineering technology, screening an AT2G23440.1 gene and / or a protein high-expression plant coded by the AT2G23440.1 gene, and cooperating with the use of an activated sludge culture medium after composting. The method not only provides a new thought for sludge resource utilization, but also provides technical support for green, safe and sustainable development of agricultural production.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of AT2G23440.1 gene in controlling heavy metal accumulation in Arabidopsis thaliana and a method for ensuring safe agricultural use of wastewater sludge. Background Art

[0002] With the growth of the global population and the acceleration of urbanization, the amount of sludge generated by urban sewage treatment plants has increased dramatically, and the resulting sludge disposal problem also needs to be solved urgently. Sludge is rich in a large amount of organic matter, nutrients and trace elements, and has a high resource utilization value, but it also contains harmful substances such as heavy metals, pathogenic microorganisms and organic pollutants. If it is not properly treated and directly used in the production process, it will further cause secondary pollution to the soil, groundwater and other ecological systems. Therefore, during the disposal and resource utilization of sludge, attention should be paid to reducing its negative impact on the ecological environment. At present, the main ways to utilize sludge resources include land utilization, composting, sludge bricks and energy utilization. Among them, sludge composting is considered to have a high potential for agricultural application because of its excellent characteristics of increasing soil organic matter, improving soil structure and improving soil fertility. Under aerobic conditions, the organic matter in the sludge is decomposed by the action of mesophilic and thermophilic bacteria and converted into fertilizer that can be used by plants. Although this process can kill most infectious bacteria such as pathogenic microorganisms, there are still some problems and challenges in the practical application of compost products, such as heavy metal residues, organic pollutants and nutrient loss (Geng et al., 2020, Environment Pollution, 266 (2), 115375; Buta et al., 2021, Ecotoxicology and Environmental Safety, 214, 112070), which endangers crop growth and food security. Therefore, when sludge is used in agriculture, it still needs to meet the relevant national implementation standards: "Agricultural Sludge Pollutant Control Standard (GB4284-2018)", "Agricultural Industry Standard of the People's Republic of China (NYT525-2021)", etc. To this end, it is of great practical application value to develop a technology that ensures the safe use of activated sludge, blocks the migration of heavy metals from sludge to plants, and improves its synergistic effect in the agricultural production process.

[0003] At present, a large number of studies have proposed methods to improve crop growth and prevent the accumulation of heavy metals in plants, including physical and chemical remediation of contaminated soil, microbial reduction and control technology, and the addition of exogenous substances (chelating agents, biochar, nanomaterials, plant growth regulators, etc.). For example, by inoculating specific microorganisms, arbuscular mycorrhizal fungi (AMF), it can not only promote the absorption of phosphorus (P) by plants, but also significantly inhibit the accumulation of heavy metals such as cadmium (Cd), lead (Pb), copper (Cu), and arsenic (As) in plants (Riaz et al., 2021, Journal of Hazardous Materials, 402, 123919); exogenous addition of plant hormone abscisic acid (ABA) can increase the potassium ion content in xylem sap (Chen et al., 2006, Plant and Cell Physiology, 47(1), 1-13), 0.4μmol L -1 ABA treatment can reduce the heavy metal contents of Cd, Zn and Ni in the aerial parts and roots of Arabidopsis thaliana by 22%, 62%, 60% and 27%, 39% and 25%, respectively (Zhu et al., 2024, Journal of Hazardous Materials, 23, 134718). However, the above measures all involve the addition of exogenous substances or interfere with the existing ecological environment. Therefore, seeking green, safe and efficient in-situ reduction and control measures has gradually become a promising technical direction.

[0004] With the advancement of molecular biological methods, by exploring and regulating genes for heavy metal absorption, transport and distribution, such as OsNRAMP5, OsHMA3 and CAL1, it is possible to effectively prevent the accumulation of heavy metals in plants, promote the growth and development of plants under adverse stress, enhance their stress resistance, and avoid causing changes in the physical and chemical properties of the soil. Therefore, compared with traditional physical and chemical methods, such as adding specific bacterial agents and chemical agents, molecular genetics technology is gradually considered to be an effective way to alleviate plant growth stress and prevent the accumulation of heavy metals. It can not only provide a long-lasting and stable treatment effect, but also avoid the high application cost of traditional technologies and the generation of secondary pollution. In addition, considering that activated sludge contains rich nutrients, while preventing the accumulation of heavy metals, promoting plant nutrient absorption through gene regulation has important practical significance for realizing the resource utilization of activated sludge and the safety of agricultural products. Summary of the invention

[0005] The invention provides application of AT2G23440.1 gene in controlling heavy metal accumulation in Arabidopsis thaliana and a method for ensuring safe agricultural use of wastewater sludge.

[0006] [1] Application of the AT2G23440.1 gene to control heavy metal accumulation in Arabidopsis thaliana, the nucleotide sequence of the AT2G23440.1 gene is shown in SEQ ID NO: 1.

[0007] [2] Application of the protein encoded by the AT2G23440.1 gene to prevent heavy metal accumulation in Arabidopsis thaliana. The amino acid sequence of the protein encoded by the AT2G23440.1 gene is shown in SEQ ID NO: 2.

[0008] [3] A method for preventing and controlling heavy metal accumulation in Arabidopsis thaliana, comprising: overexpressing the AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1.

[0009] [4] The application of the AT2G23440.1 gene in Arabidopsis breeding is to obtain Arabidopsis strains that inhibit heavy metal accumulation by screening Arabidopsis plants that overexpress the AT2G23440.1 gene with a nucleotide sequence such as SEQ ID NO: 1.

[0010] [5] The application of the protein encoded by the AT2G23440.1 gene in Arabidopsis breeding is to obtain Arabidopsis strains that inhibit heavy metal accumulation by screening Arabidopsis plants with high expression levels of the protein encoded by the AT2G23440.1 gene with an amino acid sequence as shown in SEQ ID NO: 2.

[0011] [6] A method for constructing a transgenic Arabidopsis thaliana that blocks heavy metal accumulation, comprising: overexpressing the AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1.

[0012] [7] A method for promoting the growth of Arabidopsis thaliana, comprising: overexpressing the AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1.

[0013] [8] A method for ensuring safe agricultural use of wastewater sludge, comprising:

[0014] Planting Arabidopsis thaliana overexpressing the AT2G23440.1 gene whose nucleotide sequence is shown in SEQ ID NO: 1 on a cultivation medium;

[0015] The cultivation substrate includes compost products and soil samples;

[0016] The preparation method of the compost product comprises: mixing activated sludge and sawdust, fermenting at 50-60° C. for 13-15 days, and sieving to remove incompletely decomposed large particles after fermentation to obtain a uniform and fine compost product.

[0017] By using Arabidopsis thaliana with overexpressed AT2G23440.1 gene as shown in nucleotide sequence SEQ ID NO: 1, safe application of wastewater activated sludge synergistic cultivation matrix can be guaranteed and the growth of Arabidopsis thaliana can be promoted.

[0018] The activated sludge may be municipal sludge, and the water content may be 50 wt % to 60 wt %.

[0019] The activated sludge and sawdust can be mixed in a volume ratio of 2.5 to 3.5:1 (eg, 3:1, etc.).

[0020] After fermentation is completed, it can be passed through a 10-mesh sieve.

[0021] The mass ratio of the compost product to the soil sample may be 2 to 8:100.

[0022] The soil sample may be a mixture of perlite and soil particles with a particle size less than 100 mesh. Further, the volume ratio of the soil particles to the perlite may be 1:1.

[0023] The present invention found that under the condition of adding 4% composted activated sludge (i.e., the mass ratio of compost product to soil sample is 4:100), overexpression of AT2G23440.1 gene can further improve the growth of Arabidopsis plants, increase biomass and chlorophyll content, and significantly increase the nutrient content of nitrogen (N), phosphorus (P) and potassium (K) in plants. At the same time, under the condition of applying composted activated sludge in the cultivation medium, the content of heavy metals such as Cd, Cr, Ni and Hg in Arabidopsis plants overexpressing AT2G23440.1 gene is significantly reduced compared with wild-type Arabidopsis plants. The above results show that Arabidopsis plants overexpressing AT2G23440.1 gene not only promote the absorption of nutrients in activated sludge, but also can prevent the accumulation of heavy metal content in Arabidopsis plants, which plays an important role in the safe and efficient use of activated sludge in agricultural production.

[0024] The present invention aims to provide a new technology, by screening Arabidopsis plants with high expression of the protein encoded by the AT2G23440.1 gene with an amino acid sequence as shown in SEQ ID NO: 2, to ensure the safety of activated sludge as a cultivation medium and optimize the resource utilization value of activated sludge as a cultivation medium.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] 1) Compared with wild-type Arabidopsis, the biomass of Arabidopsis plants overexpressing AT2G23440.1 gene increased by 14.47%-36.84% and the chlorophyll content increased by 28.30%-54.71% after adding composted activated sludge cultivation medium. This shows that the present invention can optimize the growth and photosynthetic activity of Arabidopsis plants under the condition of applying activated sludge, and increase crop yield.

[0027] 2) Using the present invention, compared with wild-type Arabidopsis, after adding composted activated sludge cultivation medium, the key nutrient contents N, P and K of AT2G23440.1 gene overexpressing Arabidopsis plants increased by 11.59%-13.77%, 22.22%-40.74% and 15.52%-22.41%, respectively, which shows that the present invention can improve the nutrient substances of Arabidopsis under activated sludge treatment conditions.

[0028] 3) Using the present invention, compared with wild-type Arabidopsis, after adding composted activated sludge cultivation medium, the heavy metal contents of Cd, Pb, Ni and Hg in AT2G23440.1 gene overexpressing Arabidopsis plants were reduced by 57.89%-63.16%, 12.63%-16.84%, 12.62%-18.22% and 8.22%-16.44%, respectively, indicating that the present invention can improve the safety of activated sludge in agricultural use.

[0029] In summary, the inventors have found through extensive research that the present invention can utilize the positive regulatory effect of the AT2G23440.1 gene in the stress response process of Arabidopsis plants, combine modern genetic engineering technology, screen for plants with high expression of the AT2G23440.1 gene and / or its encoded protein, and use the activated sludge cultivation matrix after composting to develop an efficient, safe, and environmentally friendly sludge cultivation matrix application technology. This not only provides a new idea for the resource utilization of sludge, but also provides technical support for ensuring the green, safe and sustainable development of agricultural production. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The operating methods in the following examples where no specific conditions are indicated are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0031] The test materials are model plants of Arabidopsis thaliana, including Colombia-0 wild type (Col-0) and AT2G23440.1 gene overexpression mutants with nucleotide sequences as shown in SEQ ID NO: 1. Col-0 was purchased from the Arabidopsis seed bank (https: / / www.arabidopsis.org / index.jsp). Overexpression transgenic plants were constructed by the applicant. The test soil was collected from the surface soil (0-20 cm) of wasteland in Sandun Town, Xihu District, Hangzhou City, Zhejiang Province, China, and was naturally air-dried for use.

[0032] Soil sample preparation: After the test soil was coarsely ground, gravel larger than 2 mm was first removed using a 10-mesh (1.5 mm) sieve, and then soil particles were further screened using a 0.15 mm (100-mesh) sieve. The screened soil particles were mixed evenly with perlite in a 1:1 volume ratio and used as soil samples for subsequent tests. The pots used in the experiment had a pore size of 12.5 cm and a height of 11 cm, and the weight of each pot soil sample was 300 g.

[0033] Wastewater sludge pretreatment and compost cultivation medium preparation: First, the municipal domestic wastewater sludge is dehydrated and pretreated to reduce its water content to 50wt% to 60wt%, and sawdust is selected as the compost auxiliary material. The sludge and auxiliary materials are mixed in a volume ratio of 3:1 and loaded into a fermentation tank, and fermented at 50-60℃ for 2 weeks. After the fermentation is completed, the composted sludge is sieved with a 10-mesh sieve to remove large particles that are not completely decomposed, and a uniform and fine compost product is obtained. The compost product is mixed with the above-mentioned soil sample (300g) in a ratio of 0, 2%, 4%, and 8%, respectively, and placed in a pot as a cultivation medium for use, and the corresponding ones are recorded as the control group, 2% sludge experimental group, 4% sludge experimental group, and 8% sludge experimental group.

[0034] Construction of AT2G23440.1 gene overexpression plant with nucleotide sequence as shown in SEQ ID NO: 1: a. Using wild-type Arabidopsis thaliana whole genome cDNA as template, design primer sequences: F: GAGCTCGGTACCCGGGGATCCATGGCGACGATTAATGTTTA (SEQ ID NO: 3); R: TCGCCCTTGCTCACCATGTCGACTTAATTATGTACGGAATG (SEQ ID NO: 4), and amplify the target gene fragment. b. After the above PCR product is detected by 1.2% agarose gel electrophoresis, it is recovered by TaKaRa gel recovery kit (CAT: 9762). c. The plant expression vector pCAMBIA1300 containing 2×35s promoter is linearized using restriction endonucleases from NEB Biotechnology Company. After the linearized product is detected by 1.2% agarose gel electrophoresis, it is recovered and purified according to TaKaRa gel recovery kit. d. Use the Norwegian multi-fragment homologous recombination reagent (CAT: 113) to connect the target fragment to the linearized pCAMBIA1300. e. Identification of the recombinant plasmid. The recombinant plasmid was transformed into the competent E. coli DH5α by heat shock method, and was spread on LB solid medium containing kanamycin (50μg / mL) and cultured at 37°C. After 14-16h, a single clone was selected for single colony PCR identification. The specific identification primers are as follows: F: AAGGTGGCACCTACAAATGC (SEQ ID NO: 5); R: GTCCAATACCGGGGCTATGA (SEQ ID NO: 6). The PCR reaction procedure is the same as above. The E. coli strains tested positive were sent to a biological company for sequencing. The nucleotide sequence of the AT2G23440.1 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2. f. Expansion and extraction of the recombinant plasmid. The single colony that was successfully sequenced was selected and expanded in LB liquid medium containing kanamycin resistance (50 μg / mL) for plasmid extraction. The plasmid extraction was performed according to the product instructions of TaKaRa DNA small-scale extraction kit (CAT: 9760). g. Transformation of recombinant plasmid into Agrobacterium. The plasmid extracted in the previous step was transformed into Agrobacterium GV3101 competent state by heat shock method, and spread on LB solid medium containing kanamycin (50 μg / mL) and rifampicin (50 μg / mL) and cultured at 28°C. After 36-48 hours, a single clone was selected for single colony PCR, and the Agrobacterium strain that tested positive was expanded in LB liquid medium containing kanamycin (50 μg / mL) and rifampicin (50 μg / mL) resistance to an OD value of 0.6-0.8. h. Obtain AT2G23440.1 gene overexpression plants from inflorescences by Agrobacterium infiltration method.Prepare the infiltration solution: 10mM MgCl2, 5% sucrose solution and a polysorbate surfactant with a final concentration of 0.02%. Suspend the Agrobacterium in the previous step in 200mL of the infiltration solution and infiltrate the Arabidopsis inflorescence. i. Positive plant screening process: The seeds are screened in a solid culture medium containing hygromycin B resistance. After the homozygous plants are screened according to Mendel's law of inheritance, the expression of post-translationally modified short peptides is measured by qRT-PCR to determine the overexpression effect. Two mutant strains OESPMPs#3 and OESPMPs#8 with expression levels of 500% and 800% of the wild-type plant expression levels are obtained.

[0035] Plant culture: Select healthy wild-type and AT2G23440.1 gene overexpressing plant seeds, disinfect the seed surface with 25% sodium hypochlorite, place in a 4°C refrigerator for 48 hours for vernalization, and spread on nylon gauze placed on a sponge soaked in Hoagland's culture medium for germination. The conditions for artificial climate chamber culture are as follows: light intensity 150-200 μmol photons m -2 s -1 , relative humidity 70%-80%, photoperiod 12h / 12h, temperature 25℃. After 2 weeks of seed germination, the uniformly growing seedlings were transplanted into the pre-mixed composted activated sludge cultivation medium, 4 plants per pot, and 3 replicates per treatment group.

[0036] Sample harvesting and index determination: After 4 weeks, the chlorophyll content of plant leaves was determined by acetone method (Table 1). The plants were separated from the soil and harvested. The soil adhering to the root surface was washed with tap water. The plant tissues were divided into glass weighing bottles, placed in an oven to kill green, and then dried at 80°C to constant weight. The dried samples were weighed and the biomass was recorded. The dried samples were further digested with high-grade pure HNO3 at 180°C until the solution was clear. The digestion solution was fixed to 20mL and then filtered through a 0.22μm filter membrane. The Cd, Pb, Ni and Hg contents in the digestion solution were determined by microwave plasma atomic emission spectrometer ICP-MS (7700, Agilent Technologies, USA). The accumulation and increase percentage of Cd, Pb, Ni and Hg in individual Arabidopsis plants were calculated.

[0037] Table 1 shows the effect of overexpression of the AT2G23440.1 gene on plant biomass and chlorophyll content under sludge treatment. The plants were separated from the soil and harvested, the soil adhering to the root surface was washed with tap water, the plant tissues were divided into glass weighing bottles, and the fresh weight (FW) was weighed and recorded using a 1 / 10,000 electronic balance (accuracy 0.0001g). After 0.2g of chlorophyll from Arabidopsis leaves was extracted with 80% acetone, the absorbance of the extract was recorded at wavelengths of 645nm and 663nm using a spectrophotometer (SP-1920, Shanghai, China). The chlorophyll concentration was calculated using the following formula: Chlorophyll = 18.71×A 645 +7.15×A 663 The results showed that sewage sludge addition promoted the growth of Arabidopsis thaliana, increased its chlorophyll content, and improved its photosynthetic activity.

[0038] Table 1

[0039]

[0040] Table 2 shows the effect of overexpression of AT2G23440.1 gene on heavy metal accumulation in plants under sludge treatment. The plants treated for 4 weeks were harvested, dried in an electric constant temperature drying oven at 65°C until constant weight, weighed with an electronic balance, and the dry weight (DW) of the plants was recorded. The Arabidopsis plants were digested with nitric acid, and the obtained digestate was subjected to inductively coupled plasma mass spectrometry (ICP-MS) for metal ion detection. The results showed that under the treatment condition of 4% sludge (the mass ratio of compost product and soil sample was 4:100), compared with the wild-type plants, overexpression of AT2G23440.1 gene can effectively prevent the accumulation of heavy metals in plants, among which the contents of heavy metal ions of Cd, Pb, Ni and Hg were reduced by 57.89%-63.16%, 12.63%-16.84%, 12.62%-18.22% and 8.22%-16.44%, respectively.

[0041] Table 2

[0042]

[0043] Table 3 shows the effect of overexpression of AT2G23440.1 gene on the nitrogen, phosphorus and potassium nutrient content of plants under different concentrations of sludge treatment. The plants treated for 4 weeks were harvested, dried in an electric constant temperature drying oven at 65°C to a constant weight, weighed with an electronic balance, and the plant dry weight (DW) was recorded. After digestion with concentrated sulfuric acid-hydrogen peroxide, the plant nitrogen content was determined using a B324 fully automatic Kjeldahl nitrogen analyzer, and the phosphorus content was measured using a molybdenum antimony colorimetric method. The Arabidopsis plants were digested with nitric acid, and the resulting digestion solution was subjected to potassium ion detection by an inductively coupled plasma mass spectrometer (ICP-MS). The results showed that under activated sludge treatment, overexpression of the AT2G23440.1 gene could not only prevent the accumulation of heavy metal ions in plants, but also significantly improve the nutrient status in plants. The nitrogen, phosphorus and potassium nutrients were increased by 11.59%-13.77%, 22.22%-40.74% and 15.52%-22.41% respectively compared with the wild-type plants.

[0044] Table 3

[0045]

[0046] The AT2G23440.1 gene overexpression Arabidopsis was replaced with the AT2G23440.1 gene loss-of-function mutant, which was constructed by the Crisper-Cas9 method and the splicing site was determined by gene sequencing. First, the primer online design tool CRISPER-P was used to design the guide sgRNA1 of the AT2G23440.1 gene: TTAATTAGTACGGAATG (SEQ ID NO: 7); sgRNA2: TTAATTAGTACGGAATG (SEQ ID NO: 8). It was further cloned into the pKIR1.1 plasmid vector by homologous recombination, and the rest of the transformation and Agrobacterium tumefaciens dipping methods were the same as above to obtain the AT2G23440.1 gene loss-of-function mutant spmps5-62. The plant culture and index determination methods were the same as above, and the results obtained are shown in Table 4 below.

[0047] Table 4 shows the effect of AT2G23440.1 gene functional loss on heavy metal accumulation in plants treated with sludge. The plants treated for 4 weeks were harvested, dried in an electric constant temperature drying oven at 65°C until constant weight, weighed with an electronic balance, and the dry weight (DW) of the plants was recorded. The Arabidopsis plants were digested with nitric acid, and the obtained digestate was subjected to inductively coupled plasma mass spectrometry (ICP-MS) for metal ion detection. The results showed that under 4% sludge treatment conditions, compared with wild-type plants, AT2G23440.1 gene functional loss caused the content of Cd, Pb, Ni and Hg heavy metal ions in plants to increase by 142.11%, 197.89%, 120.56% and 156.16%, respectively, further indicating the positive regulatory role of AT2G23440.1 gene in controlling the accumulation of heavy metals in plants.

[0048] Table 4

[0049]

[0050] According to the above method, after the AT2G23440.1 gene overexpression plants were treated with 4% sludge, 25 μM SPMPs (Small post-translationally modified peptides) downstream signal biosynthesis inhibitor Fluridone (CAS: 59756-60-4) was sprayed on the leaves of Arabidopsis thaliana, and the changes in heavy metal content in the plants OESPMPs#8+Fluridone were measured. The results showed (Table 5) that spraying the biosynthesis inhibitor weakened the heavy metal control effect of AT2G23440.1 gene overexpression, proving that AT2G23440.1 gene controls heavy metal accumulation by inducing the activity of downstream biological signal substances.

[0051] Table 5

[0052]

[0053] In summary, the present invention provides a new technology for the safe application of activated sludge synergistic cultivation matrix based on regulating the activity of post-translationally modified short peptides (AT2G23440.1 gene), which can effectively improve the sludge treatment effect, ensure its safe agricultural use, and significantly increase crop yields. It has broad application prospects and economic value.

[0054] In addition, it should be understood that after reading the above description of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Application of AT2G23440.1 gene to control heavy metal accumulation in Arabidopsis thaliana, characterized in that: The nucleotide sequence of the AT2G23440.1 gene is shown in SEQ ID NO:

1.

2. Application of the protein encoded by AT2G23440.1 gene to control the accumulation of heavy metals in Arabidopsis thaliana, characterized in that: The amino acid sequence of the protein encoded by the AT2G23440.1 gene is shown in SEQ ID NO:

2.

3. A method for controlling the accumulation of heavy metals in Arabidopsis thaliana, characterized in that: include: The AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1 is overexpressed.

4. Application of AT2G23440.1 gene in Arabidopsis breeding, characterized in that: The Arabidopsis strains that control heavy metal accumulation are obtained by screening Arabidopsis plants that overexpress the AT2G23440.1 gene with a nucleotide sequence as shown in SEQ ID NO:

1.

5. Application of the protein encoded by AT2G23440.1 gene in Arabidopsis breeding, characterized in that: By screening Arabidopsis plants with high expression of the protein encoded by the AT2G23440.1 gene whose amino acid sequence is shown in SEQ ID NO: 2, an Arabidopsis strain capable of preventing and controlling heavy metal accumulation is obtained.

6. A method for constructing a transgenic Arabidopsis thaliana for controlling heavy metal accumulation, characterized in that: include: The AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1 is overexpressed.

7. A method for promoting the growth of Arabidopsis thaliana, characterized in that: include: The AT2G23440.1 gene in Arabidopsis thaliana whose nucleotide sequence is shown in SEQ ID NO: 1 is overexpressed.

8. A method for ensuring safe agricultural use of wastewater sludge, characterized in that: include: Planting Arabidopsis thaliana overexpressing the AT2G23440.1 gene whose nucleotide sequence is shown in SEQ ID NO: 1 on a cultivation medium; The cultivation substrate includes compost products and soil samples; The preparation method of the compost product comprises: mixing activated sludge and sawdust, fermenting at 50-60° C. for 13-15 days, and sieving to remove incompletely decomposed large particles after fermentation to obtain a uniform and fine compost product.

9. The method for ensuring safe agricultural use of wastewater sludge according to claim 8, characterized in that: The activated sludge is municipal sludge with a water content of 50wt% to 60wt%; The activated sludge and sawdust are mixed in a volume ratio of 2.5 to 3.5:1; After fermentation is completed, pass through a 10-mesh sieve; The mass ratio of compost product to soil sample is 2 to 8:100; The soil sample was a mixture of perlite and soil particles with a particle size less than 100 mesh; the volume ratio of soil particles to perlite was 1:1.

Images