Construction and application of lymphatic vessel expression KLF6 recombinant adeno-associated virus for reducing lung blood pressure

Abstract

The invention discloses construction and application of a lymphatic vessel expression KLF6 recombinant adeno-associated virus for reducing lung blood pressure. According to the invention, the recombinant adeno-associated virus (AAV lungX-PDPNpromoter-hKLF6) of lymphatic vessel overexpression KLF6 is constructed by using an AAV lungX serotype and a PDPN specific promoter, and the pulmonary artery pressure is reduced by improving the function of the lymphatic vessel. Compared with the prior art, the rAAV vector provided by the invention has the advantages of higher targeting property, stronger expression persistence and low immunogenicity, can provide a stable and lasting treatment effect, and overcomes the defects of pulmonary arterial hypertension gene therapy in the aspects of targeting property and safety.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the construction and application of a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels for reducing pulmonary blood pressure. Background Art

[0002] Pulmonary hypertension (PH) is a fatal cardiovascular disease, which is mainly manifested by increased pulmonary circulation resistance, leading to complications such as pulmonary vascular remodeling and right ventricular hypertrophy. Existing drugs are mainly based on endogenous vascular structural cells such as vascular endothelial cells and vascular smooth muscle cells. Although these drugs can relieve some symptoms, they cannot completely inhibit pulmonary vascular remodeling and are often accompanied by side effects and drug resistance.

[0003] In addition to the traditionally believed vascular system, the research team of this invention has confirmed that the lymphatic system also plays an important role in driving the pathological process of pulmonary hypertension. Pulmonary lymphatic vessels are involved in the transport of body fluids and immune cells, thus playing a key role in maintaining vascular permeability in the lungs, reducing edema, and promoting inflammation repair. Under the condition of pulmonary hypertension, the obstruction of lymphatic function aggravates the damage and reconstruction of pulmonary blood vessels, further worsening the disease. Therefore, studying the functional regulation targets of lymphatic vessels has become a new research direction for the treatment of pulmonary hypertension.

[0004] KLF6 (Kruppel-like factor 6) is a member of the Kruppel-like factor family (KLFs), a family of zinc finger-containing transcription factors. KLF6 activates the expression of multiple genes involved in vascular repair, remodeling, and angiogenesis by directly binding to the promoters of target genes. Given the extensive regulatory role of KLF6, there have been some reports of an important role for KLF6 in the vascular endothelium. KLF6 plays a complex and dual role in vascular endothelial pathology. For example, KLF6 can upregulate the expression of membrane metalloproteinase 14 (MMP14), which targets endothelial growth factor (endoglin), thereby promoting angiogenesis and repair. However, sustained activation of KLF6 also promotes apoptosis resistance and the development of vascular proliferative lesions, which may be related to the pathological process of pulmonary hypertension. In addition, KLF6 is involved in the regulation of other genes related to vascular remodeling, such as activin receptor-like kinase 1 (ALK1) and components of the TGF-β signaling pathway. The regulation of these genes helps to regulate immune cell infiltration during vascular inflammation and repair. In summary, the role of KLF6 in the vascular endothelium includes both positive effects in promoting vascular repair and negative effects in promoting vascular inflammatory responses.

[0005] Although the role of KLF6 in the vascular system has been reported, its role in the lymphatic system is little known. There is currently no research on the prevention and treatment of pulmonary hypertension by regulating the function of pulmonary lymphatic vessels, nor is there any report on the development of a targeted gene delivery system for pulmonary lymphatic vessels to regulate the function of the pulmonary lymphatic system and prevent and treat pulmonary hypertension by targeted delivery of specific genes. Summary of the invention

[0006] The functional regulation of pulmonary lymphatic vessels has long been neglected in the current treatment of pulmonary hypertension. The technical problem to be solved by the present invention is how to effectively treat pulmonary hypertension by regulating the function of pulmonary lymphatic vessels. In order to solve the above problems, the present invention provides a novel and effective gene therapy drug, a preparation method and application of a recombinant Kruppel-like transcription factor 6 (KLF6) gene carried by adeno-associated virus (AAV lungX) as a vector and a lymphatic vessel-specific promoter (PDPN).

[0007] The research team of the present invention found that pulmonary lymphatic dysfunction is another key mechanism driving the development of pulmonary hypertension, and lymphatic drainage disorders can aggravate the development of pulmonary hypertension. KLF6 is a key target for regulating pulmonary lymphatic function. Its loss leads to pulmonary lymphatic dysfunction and aggravates pulmonary hypertension. KLF6 in lymphatic vessels can promote lymphatic absorption function by regulating the connection morphology of lymphatic endothelial cells, so it has important application prospects in gene therapy of pulmonary hypertension. By constructing a recombinant adeno-associated virus (rAAV) that specifically expresses KLF6 in pulmonary lymphatic vessels, lymphatic function is promoted to reduce pulmonary artery pressure.

[0008] The first object of the present invention is to provide a method for constructing a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure, comprising the following steps:

[0009] 1) Obtaining human hKLF6 gene fragment;

[0010] 2) Obtaining the human PDPN promoter sequence;

[0011] 3) Construction of PDPN promoter -hKLF6 fragment;

[0012] 4) Construction of pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid;

[0013] 5) AAV lungX-PDPN promoter - Packaging, purification and concentration of hKLF6.

[0014] Preferably, step 1) specifically comprises: using human genomic DNA as a template, using primers hKLF6 F: 5'-GGCAACAGACCTGCCTAGAG-3' and hKLF6 R: 5'-CTCCCGAGCCAGAATGATTTT-3' to perform PCR amplification to obtain the hKLF6 fragment.

[0015] Preferably, step 2) specifically includes: using human genomic DNA as a template, using primers PDPN F: 5'-AACCAGCGAAGACCGCTATAA-3' and PDPN R: 5'-CGAATGCCTGTTACACTGTTGA-3' to perform PCR amplification to obtain the PDPN promoter fragment.

[0016] Preferably, step 3) is specifically as follows: using human genomic DNA as a template, using primers PDPN promoter -hKLF6 F:5'-CCAGGAACCAGCGAAGACCGC-3' and PDPN promoter -hKLF6 R:5'-GTCGGGATCCTCGTGCCTCCGAATAA-3'PCR amplification to obtain PDPN promoter -hKLF6 fragment.

[0017] The second object of the present invention is to provide a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that lowers pulmonary blood pressure. The recombinant adeno-associated virus is prepared according to the above-mentioned construction method.

[0018] The third object of the present invention is to provide the use of the above-mentioned recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that lowers pulmonary blood pressure in the preparation of drugs for preventing and treating pulmonary hypertension.

[0019] The fourth object of the present invention is to provide a drug for preventing and treating pulmonary hypertension, which contains a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure as an active ingredient.

[0020] Preferably, the drug further comprises a pharmaceutically acceptable carrier.

[0021] Preferably, the dosage form of the drug is an injection.

[0022] Preferably, the injection includes injection solution and lyophilized powder injection.

[0023] The present invention discovered for the first time that lymphatic endothelial cell KLF6 plays an important role in promoting pulmonary lymphatic fluid absorption, immune cell transport and lowering pulmonary blood pressure. The expression of KLF6 helps the pulmonary lymphatic vessels maintain a highly absorptive connection morphology, maintain normal lymphatic absorption function, and prevent the formation of a pulmonary vascular inflammatory microenvironment to lower pulmonary blood pressure. PDPN is a podoplanin promoter, which is considered to be the most specific promoter for human pulmonary lymphatic endothelium and contributes to the lymphatic vessel-specific expression of KLF6. AAV lung X is a serotype that is widely used in lung gene therapy, has good targeted expression, and the expression time can reach more than 9 months. The present invention uses AAV lungX PDPN promoter -hKLF6 as a gene therapy drug, a single intravenous injection into mice can achieve AAV vector-mediated pulmonary lymphatic KLF6 gene transduction, promote the formation of highly absorptive endothelial cell junction structures in the pulmonary lymphatics, promote pulmonary lymphatic function and lower pulmonary blood pressure, and can last for a long time without obvious toxic side effects.

[0024] The present invention uses AAV as a vector to carry the recombinant KLF6 gene and adopts the PDPN lymphatic endothelial-specific promoter to achieve cell-specific treatment, solving the problem that traditional pulmonary hypertension drugs fail to target pulmonary lymphatic vessels. The present invention adopts the AAVlungX serotype, which has high efficiency in lung tissue infection and has the advantages of lasting effect in lowering pulmonary blood pressure, and is suitable for long-term treatment of pulmonary hypertension.

[0025] The present invention solves the shortcomings of the existing technology in terms of lymphatic targeting and persistence by specifically expressing KLF6 in pulmonary lymphatic vessels. It is expected that the recombinant adeno-associated virus can significantly improve the function of pulmonary lymphatic vessels and reduce pulmonary artery pressure, thereby providing a more effective and safe treatment plan for patients with pulmonary hypertension. In addition, the implementation of this technology will expand new ideas for the application of gene therapy in lung diseases and has good clinical transformation potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 AAV lungX-PDPN promoter -hKLF6 overexpresses KLF6 specifically in lung lymphatic vessels (red VEGFR3 marker).

[0027] Figure 2 AAV lungX-PDPN promoter -The effect of hKLF6 on pulmonary lymphatic endothelial cell junctions and inflammatory cells. A: Promotes the transformation of pulmonary lymphatic endothelial cell junctions from a continuous zipper with low absorption to a discontinuous button with high absorption (red VEGFR3 marks lymphatic vessels, green VE-cadherin marks cell junctions), B: Reduces the accumulation of macrophages around pulmonary lymphatic vessels (red IBA1).

[0028] Figure 3 AAV lungX-PDPN promoter -hKLF6 can effectively improve hypoxia-induced pulmonary hypertension. A: reduce right ventricular systolic pressure, B: reduce right ventricular hypertrophy. DETAILED DESCRIPTION

[0029] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0030] Example 1: AAV lungX-PDPN promoter -hKLF6 construct

[0031] 1. Obtain human Kruppel-like transcription factor 6 (hKLF6) gene fragment A

[0032] 1) The protein expression region was determined based on the NM_001160124 sequence, and primers for amplifying the hKLF6 protein expression region were designed and synthesized. The primer sequences are as follows: hKLF6 F: 5'-GGCAACAGACCTGCCTAGAG-3' and hKLF6 R: 5'-CTCCCGAGCCAGAATGATTTT-3'.

[0033] 2) Amplify target gene fragment: 10×Pfu Buffer (with Mg 2+ )5μL; dNTP (2.5mM each) 4μL; primer mixture (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double distilled water 35.75μL. Gently blow to mix, centrifuge briefly, and place in a PCR instrument for reaction. The reaction conditions are: 94℃3min; 94℃30s, 55℃30s, 72℃3min (30Cycles); 72℃10min; 4℃∞. The hKLF6 fragment was amplified, and its size was: 726bp. The specific nucleotide sequence is shown in SEQ ID NO.1, as follows:

[0034] >SEQ ID NO.1

[0035] .

[0036] 2. Obtaining human PDPN promoter sequence B

[0037] 1) Based on the promoter sequence of NM_001006625, primers for amplifying the promoter region of PDPN were designed and synthesized. The primer sequences were as follows: PDPN F: 5'-AACCAGCGAAGACCGCTATAA-3' and PDPN R: 5'-CGAATGCCTGTTACACTGTTGA-3'.

[0038] 2) Amplify target gene fragment: 10×Pfu Buffer (with Mg 2+)5μL; dNTP (2.5mM each) 4μL; primer mixture (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double distilled water 35.75μL. Gently blow to mix, centrifuge briefly, and place in a PCR instrument for reaction. The reaction conditions are: 94℃3min; 94℃30s, 55℃30s, 72℃1min (30Cycles); 72℃10min; 4℃∞. The PDPN promoter fragment was amplified, and its size was: 357bp. The specific nucleotide sequence is shown in SEQ ID NO.2, as follows:

[0039] >SEQ ID NO.2

[0040] ATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTC AAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGCCCTAA.

[0041] 3. Constructing PDPN promoter -hKLF6 fragment

[0042] The two products are mixed, denatured and annealed, and the bases of fragment A and fragment B are partially complementary to form a hybrid chain. Design and synthesize the amplification, and introduce protection bases and restriction sites at the same time. The amplification primers are: PDPN promoter -hKLF6 F:5'-CCAGGAACCAGCGAAGACCGC-3' and PDPN promoter -hKLF6 R:5'-GTCGGGATCCTCGTGCCTCCGAATAA-3'; PCR reaction system: 10×Pfu Buffer (with Mg 2+)5μL; dNTP (2.5mM each) 4μL; primer mixture (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double distilled water 35.75μL. Gently blow to mix, centrifuge briefly, and place in a PCR instrument for reaction. Set the temperature gradient PCR, the reaction program is: 94℃3min; 94℃30s, 50-65℃30s, 72℃3.5min (30Cycles); 72℃10min; 4℃∞. Amplify and obtain PDPN promoter -hKLF6 fragment size: 1083bp, the specific nucleotide sequence is shown in SEQ ID NO.3, specifically as follows:

[0043] >SEQ ID NO.3

[0044]

[0045] 4. Construction of pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid

[0046] Purify fragment C. Prepare 50μL enzyme digestion system: including 23μL double distilled water, 5μL 10× enzyme digestion buffer, 20μL purified target fragment C (200ng / μL), 1μL BamHI (20U / μL), 1μL EcoRI (20U / μL). Add them to the system in sequence, gently blow to mix, centrifuge briefly, and place at 37℃ for 2h. Prepare 50μL AAV vector transfer plasmid pAAV enzyme digestion system: including 41μL double distilled water, 5μL 10× enzyme digestion buffer, 2μL AAV vector plasmid (1μg / μL), 1μL BamHI (20U / μL), 1μL EcoRI (20U / μL). Add them to the system in sequence, gently blow to mix, centrifuge briefly, and place at 37℃ for 2h. The fragments and vector digestion products were subjected to agarose gel electrophoresis to recover the target bands. The sizes of the recovered fragments were 3006 bp and 2989 bp, respectively.

[0047] Connect fragment C and vector enzyme digestion recovery product: prepare 10 μL of connection system, including double distilled water (filled to 10 μL), 1 μL of 10× DNA ligase buffer, and a molar ratio of fragment C enzyme digestion recovery product to vector enzyme digestion recovery product of 2:1, and place at 16°C for connection overnight.

[0048] Transformation plasmid: Thaw 1 tube of competent cells on ice; Take 100 μL competent cells and add about 20 ng of plasmid DNA, mix gently with a pipette, and place on ice for 30 minutes; Place the centrifuge tube in a 42°C water bath and heat shock for 45 seconds. During the process, stabilize the centrifuge tube without shaking; Quickly transfer the centrifuge tube to ice and place it for 2 minutes; Add 300 μL LB medium or SOC medium, and culture at 37°C with gentle shaking for 1 hour; Take an appropriate volume and evenly spread it on the LB plate containing antibiotics; Invert the culture dish and culture at 37°C overnight. Pick a single colony, amplify and extract plasmid DNA, use BamHI and EcoRI double enzyme digestion, run agarose gel electrophoresis to determine that the insert fragment size is 3006bp, and construct pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid. Design sequencing primers to identify the sequence of the inserted fragment of the recombinant plasmid: 1-GAGAAGACTGAA; 2-TGTCTTCAGGGC; 3-TCGGGACACA; 4-CCAAATAGACCTG; 5-GGAGATGGCAACTT; 6-CCTGGAGAACTAT.

[0049] 5. AAV lungX-PDPN promoter- Packaging, purification and concentration of hKLF6

[0050] Plasmid preparation: Transfer the constructed AAV vector plasmid (pAAV lungX-PDPN promoter -hKLF6), recombinant capsid packaging plasmid (pAAV lungX) and adenovirus Helper plasmid (pAdDeltaF6) were amplified and purified, and the OD260 / 280 should be around 1.8. pAAV lungX contains Rep and Cap, flanked by two 145-base inverted terminal repeats (ITR); pAdDeltaF6 contains E4, E2a and VA, which mediate the replication of AAV.

[0051] AAV virus packaging: Resuscitate AAV-293 cells and culture them in large quantities in a 15 cm culture dish. When the cell confluence reaches 70-80%, use liposome transfection to transfect AAV-293 cells with the above plasmids. Plasmid usage: pAAVlungX-PDPN promoter -hKLF6 6μg, pAAV lungX 10μg, and auxiliary plasmid pAdDeltaF6 12μg were used for transfection. After transfection, the culture medium in the dish was replaced with fresh cell culture medium (high-glucose DMEM medium containing 10% fetal bovine serum) and cultured for 66 to 72 hours.

[0052] Concentration of AAV virus: Collect the supernatant culture medium and cells together in a 15mL centrifuge tube, and centrifuge at 500×g for 3min to separate the cells and supernatant. Store the supernatant separately and resuspend the cells in 1mL PBS. Repeat the cell suspension in liquid nitrogen and a 37°C water bath for 3 to 4 times, with each freeze-thaw process lasting about 10min. Remove cell debris by high-speed centrifugation, transfer the centrifugal supernatant to a new centrifuge tube and filter using a 0.22μm filter membrane.

[0053] Purification and concentration of AAV virus: 5% (1.031 g / cm 3 ), 15% (1.085 g / cm 3 ), 25% (1.085 g / cm 3 ), 40% (1.215 g / cm 3 ), 54% (1.291 g / cm 3) of iodixanol solution. Slowly add the virus supernatant to the density gradient centrifugation medium and use an ultracentrifuge at 36,0000×g, 16°C, for centrifugation for 2 hours. Recover the 40% layer solution. Use Millipore ultrafiltration tubes for concentration, centrifuge at 3500rpm for 30min, and repeatedly blow the virus particles with 500μL PBS solution, and store them in aliquots in a -80°C refrigerator. Determination of virus titer: The number of AAV virus particles is determined by using quantitative PCR to detect the genome copy number of the AAV vector.

[0054] Determination titer>10 13 vg / mL.

[0055] 6. AAV lungX-PDPN promoter - Targeted detection of hKLF6

[0056] The use of recombinant adeno-associated virus (rAAV) as a vector combined with a specific promoter can ensure the specific expression of the KLF6 gene in the pulmonary lymphatic vessels, enhancing the targeting and safety of the treatment. Figure 1 As shown, compared with the conventional KLF6 overexpression construction method (such as AAV9-KLF6), the present invention uses a recombinant adeno-associated virus (AAV lungX-PDPN) modified with AAV lungX combined with PDPN promoter. promoter -hKLF6), which can overexpress KLF6 specifically in pulmonary lymphatic vessels (red VEGFR3 marker).

[0057] Example 2: AAV lungX-PDPN promoter -Application of hKLF6 in the study of lowering pulmonary blood pressure

[0058] Recombinant AAV (AAV lungX-PDPN promoter -hKLF6) intravenous injection: 4-week-old mice from the same littermate were randomly injected with control virus (AAV lungX-Control) and lymphatic vessel overexpression KLF6 virus (AAV lungX-PDPN promoter -hKLF6), 8 mice in each group, each mouse was anesthetized with pentobarbital (dose of 50 mg / g body weight), the mouse tail blood vessels were fully exposed with a surgical lamp, and a 31G disposable insulin syringe was used to penetrate the blood vessels at 20°, and the injection dose was 5×10 11 Virus titer. The entire operation was completed under sterile laminar flow conditions at the operating room level. Daily observation after surgery confirmed that there was no obvious wound infection.

[0059] Establishment of pulmonary hypertension mouse model: We used the classic hypoxia-induced pulmonary hypertension mouse model. Specifically, 4 weeks after injection of control virus and lymphatic overexpression KLF6 virus, we placed mice in a hypoxic (10% O2+90% N2) chamber with a 12 / 12-hour light / dark cycle for 4 weeks. The oxygen chamber was opened once a week for about 20 minutes to replace clean cages and replenish food and water.

[0060] For the measurement of right ventricular systolic pressure (RVSP), mice were anesthetized with 1% sodium pentobarbital, and a transverse abdominal port was opened to expose the mouse diaphragm. A 22G needle connected to a pressure sensor was then inserted into the right ventricle, and the stable right ventricular pressure waveform was recorded. The right ventricular systolic pressure (RVSP) was calculated by averaging the peak value.

[0061] Measurement of average thickness of the right ventricle: The mice after pressure measurement were sampled. The heart was fixed, dehydrated, transparentized with xylene, and immersed in wax, and then the heart cross-section was sliced ​​using a paraffin slicer (Leica). The right ventricle at the level of the left ventricular mitral valve was selected, and the ventricular septum should be of approximately the same size. The slices were stained with hematoxylin and eosin (HE) to evaluate the histological morphology of the heart. Subsequently, the stitched heart cross-sectional panoramic images were taken with a Tissue Fax panoramic confocal microscope for subsequent analysis. The average thickness of the right ventricle was calculated by the following method: the right ventricle at the level of the left ventricular mitral valve was selected, and the ventricular septum should be of approximately the same size. The overall right ventricular cross-sectional area and length were measured by Image J, and the average thickness of the right ventricle was obtained by the total area of ​​the right ventricle / right ventricular length.

[0062] Lung tissue immunofluorescence: The lung lobes of the mice after pressure measurement were removed. The lung tissue was fixed on ice with 4% paraformaldehyde for 1 hour, and then penetrated with methanol at -20°C for 20 minutes. Then, the samples were equilibrated in 30% sucrose at 4°C overnight and embedded in OCT. Then, 100 μm lung tissue sections were cut with a cryostat. The lung frozen sections were incubated with 5% H2O2 for 5 minutes to remove autofluorescence, and then blocked with blocking buffer (5% donkey serum, 3% BSA, 0.1% Triton X-100 dissolved in PBS) at room temperature for 1 hour. When staining, the primary antibody (such as VE-cadherin for cell connection and VEGFR3 for lymphatic vessels) was incubated at 4°C overnight, and the fluorescently labeled secondary antibody and DAPI were incubated at room temperature for 1 hour, and washed with sufficient PBS after each incubation. After sealing, confocal fluorescence images of lung sections were obtained using a confocal microscope (Nikon C2) for subsequent analysis. For the analysis of cell connections, a blinded double-person method was used to independently count the numbers, and Image J was used to manually circle the sum of the lengths of zipper-like connections and button-like connections to calculate the percentage of (zipper-like connection length) / (sum of zipper-like connections + button-like connection length) as an evaluation index of lymphatic vessel absorption function.

[0063] like Figure 2 As shown, the recombinant virus overexpressing KLF6 in lymphatic vessels (AAV lungX-PDPN promoter -hKLF6), which can effectively transform the lymphatic endothelial cell connection from a low-absorption zipper-like connection to a high-absorption button-like connection (A, red VEGFR3 marks lymphatic vessels, green VE-cadherin marks cell connections), thereby promoting the function of pulmonary lymphatic vessels to transport inflammatory cells, so the accumulation of macrophages (red IBA1) around pulmonary lymphatic vessels is significantly reduced (B). This result shows that by promoting the function of pulmonary lymphatic vessels, improving fluid drainage and reducing lung inflammation, pulmonary artery pressure can be reduced. This mechanism not only helps to relieve the symptoms of pulmonary hypertension, but also may reverse the pathological process.

[0064] like Figure 3 As shown, the recombinant virus overexpressing KLF6 in lymphatic vessels (AAV lungX-PDPN promoter -hKLF6), which can effectively improve hypoxia-induced pulmonary hypertension, including decreased right ventricular systolic pressure (A) and improved right ventricular hypertrophy (B).

[0065] In summary, the technical solution of the present invention provides an innovative and effective solution for the treatment of pulmonary hypertension by combining the advantages of efficient gene expression, targeted delivery and safety, and has relatively important clinical value.

[0066] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A method for constructing a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure, characterized in that: The following steps are involved: 1) Obtaining human hKLF6 gene fragment; 2) Obtaining the human PDPN promoter sequence; 3) Construction of PDPN promoter -hKLF6 fragment; 4) Construction of pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid; 5) AAV lungX-PDPN promoter - Packaging, purification and concentration of hKLF6.

2. The construction method according to claim 1, characterized in that: Step 1) specifically includes: using human genomic DNA as a template, using primers hKLF6 F: 5'-GGCAACAGACCTGCCTAGAG-3' and hKLF6 R: 5'-CTCCCGAGCCAGAATGATTTT-3' was used for PCR amplification to obtain the hKLF6 fragment.

3. The construction method according to claim 1, characterized in that: Step 2) is as follows: human genomic DNA is used as a template, and primers PDPN F: 5'-AACCAGCGAAGACCGCTATAA-3' and PDPN R: 5'-CGAATGCCTGTTACACTGTTGA-3' was used for PCR amplification to obtain the PDPN promoter fragment.

4. The construction method according to claim 1, characterized in that: Step 3) is as follows: using human genomic DNA as a template, using primers PDPN promoter -hKLF6 F:5'-CCAGGAACCAGCGAAGACCGC-3' and PDPN promoter -hKLF6 R:5'-GTCGGGATCCTCGTGCCTCCGAATAA-3' was obtained by PCR amplification PDPN promoter -hKLF6 fragment.

5. A recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure, prepared according to the construction method according to any one of claims 1 to 4.

6. Use of the recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure as claimed in claim 5 in the preparation of a drug for preventing and treating pulmonary hypertension.

7. A drug for preventing and treating pulmonary hypertension, characterized in that: The drug contains as an active ingredient the recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure as claimed in claim 5.

8. The drug according to claim 7, characterized in that The medicine further comprises a pharmaceutically acceptable carrier.

9. The drug according to claim 7, characterized in that The dosage form of the medicine is injection.

10. The drug according to claim 9, characterized in that The injection includes injection solution and freeze-dried powder injection.

Images