Construction and application of a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels for reducing pulmonary blood pressure
By specifically expressing KLF6 in pulmonary lymphatic vessels with a recombinant adeno-associated virus, the lack of lymphatic vessel targeting and persistence in the treatment of pulmonary hypertension was solved, significant reduction in pulmonary artery pressure and functional recovery were achieved, providing a safe and effective treatment option.
Patent Information
- Application Number
- CN202411857831.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-12-17
AI Technical Summary
Existing drugs are unable to effectively target and regulate the function of pulmonary lymphatic vessels, resulting in poor therapeutic effects and side effects for pulmonary hypertension, and there is a lack of gene delivery systems targeting pulmonary lymphatic vessels.
The recombinant adeno-associated virus AAV lungX was used to carry the KLF6 gene, and the PDPN promoter was used to achieve pulmonary lymphatic vessel-specific expression, thereby promoting the recovery of lymphatic vessel function.
It significantly reduces pulmonary artery pressure, improves pulmonary lymphatic function, provides lasting therapeutic effects without obvious toxic side effects, and expands the application of gene therapy in lung diseases.
Smart Images

Figure CN119685400B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the construction and application of a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels for lowering pulmonary blood pressure. Background Art
[0002] Pulmonary hypertension (PH) is a life-threatening cardiovascular disease characterized by increased pulmonary circulatory resistance, leading to complications such as pulmonary vascular remodeling and right ventricular hypertrophy. Existing drugs primarily target endogenous vascular structural cells, such as endothelial cells and vascular smooth muscle cells. While these drugs can alleviate some symptoms, they cannot completely inhibit pulmonary vascular remodeling and are often associated with side effects and drug resistance.
[0003] In addition to the traditionally recognized vascular system, the research team of this invention has confirmed that the lymphatic system also plays an important role in driving the pathological process of pulmonary hypertension. Pulmonary lymphatic vessels are involved in the transport of body fluids and immune cells, thereby playing a key role in maintaining vascular permeability in the lungs, reducing edema, and promoting inflammation repair. In the state of pulmonary hypertension, impaired lymphatic function exacerbates pulmonary vascular damage and remodeling, further worsening the disease. Therefore, studying the functional regulation targets of lymphatic vessels has become a new research direction for the treatment of pulmonary hypertension.
[0004] KLF6 (Kruppel-like factor 6) is a member of the Kruppel-like factor family (KLFs), a family of zinc-finger transcription factors. KLF6 activates the expression of multiple genes involved in vascular repair, remodeling, and angiogenesis by directly binding to the promoters of target genes. Given its extensive regulatory role, KLF6 has been reported to play a crucial role in the vascular endothelium. KLF6 plays a complex and dual role in vascular endothelial pathologies. For example, KLF6 upregulates the expression of membrane metalloproteinase 14 (MMP14), which targets endothelial growth factor (endoglin), thereby promoting angiogenesis and repair. However, sustained KLF6 activation also promotes apoptosis resistance and the development of proliferative vascular lesions, which may be relevant to the pathology of pulmonary arterial hypertension. Furthermore, KLF6 is involved in the regulation of other genes involved in vascular remodeling, such as activin receptor-like kinase 1 (ALK1) and components of the TGF-β signaling pathway. Regulation of these genes contributes to the regulation of immune cell infiltration during vascular inflammation and repair. In summary, the effects of KLF6 on the vascular endothelium include both positive effects in promoting vascular repair and negative effects in promoting vascular inflammatory responses.
[0005] Although the role of KLF6 in the vascular system has been reported, its role in the lymphatic system is less well understood. Currently, there are no studies investigating the prevention and treatment of pulmonary hypertension by regulating pulmonary lymphatic function, nor are there reports on the development of targeted gene delivery systems for the pulmonary lymphatics to regulate pulmonary lymphatic function and prevent and treat pulmonary hypertension through the targeted delivery of specific genes. Summary of the Invention
[0006] Functional regulation of pulmonary lymphatic vessels has long been neglected in the current treatment of pulmonary hypertension. The technical problem addressed by the present invention is how to effectively treat pulmonary hypertension by regulating pulmonary lymphatic vessel function. To address this issue, the present invention provides a novel and effective gene therapy drug, including methods for preparing and using a recombinant Kruppel-like transcription factor 6 (KLF6) gene, carried by an adeno-associated virus (AAV lungX) and a lymphatic vessel-specific promoter (PDPN).
[0007] The research team of the present invention found that pulmonary lymphatic dysfunction is another key mechanism driving the development of pulmonary hypertension, and lymphatic drainage disorders will aggravate the development of pulmonary hypertension. KLF6 is a key target for regulating pulmonary lymphatic function. Its loss leads to pulmonary lymphatic dysfunction and aggravates pulmonary hypertension. KLF6 in lymphatic vessels can promote lymphatic absorption function by regulating the connection morphology of lymphatic endothelial cells, and therefore has important application prospects in gene therapy for pulmonary hypertension. By constructing a recombinant adeno-associated virus (rAAV) that specifically expresses KLF6 in pulmonary lymphatic vessels, lymphatic function is promoted to reduce pulmonary artery pressure.
[0008] The first object of the present invention is to provide a method for constructing a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure, comprising the following steps:
[0009] 1) Obtaining human hKLF6 gene fragment;
[0010] 2) Obtaining the human PDPN promoter sequence;
[0011] 3) Building PDPN promoter -hKLF6 fragment;
[0012] 4) Construction of pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid;
[0013] 5) AAV lungX-PDPN promoter - Packaging, purification and concentration of hKLF6.
[0014] Preferably, step 1) specifically comprises: using human genomic DNA as a template, using primers hKLF6 F: 5'-GGCAACAGACCTGCCTAGAG-3' and hKLF6 R: 5'-CTCCCGAGCCAGAATGATTTT-3' to perform PCR amplification to obtain the hKLF6 fragment.
[0015] Preferably, step 2) specifically comprises: using human genomic DNA as a template, using primers PDPN F: 5'-AACCAGCGAAGACCGCTATAA-3' and PDPN R: 5'-CGAATGCCTGTTACACTGTTGA-3' to perform PCR amplification to obtain the PDPN promoter fragment.
[0016] Preferably, step 3) is specifically as follows: using human genomic DNA as a template, using primers PDPN promoter -hKLF6 F:5'-CCAGGAACCAGCGAAGACCGC-3' and PDPN promoter -hKLF6 R:5'-GTCGGGATCCTCGTGCCTCCGAATAA-3' was used to obtain PDPN by PCR amplification promoter -hKLF6 fragment.
[0017] The second object of the present invention is to provide a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels for lowering pulmonary blood pressure. The recombinant adeno-associated virus is prepared according to the above-mentioned construction method.
[0018] The third object of the present invention is to provide the use of the above-mentioned recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that lowers pulmonary blood pressure in the preparation of drugs for preventing and treating pulmonary hypertension.
[0019] The fourth object of the present invention is to provide a drug for preventing and treating pulmonary hypertension, which contains a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure as an active ingredient.
[0020] Preferably, the drug further comprises a pharmaceutically acceptable carrier.
[0021] Preferably, the dosage form of the drug is an injection.
[0022] Preferably, the injection includes injection solution and lyophilized powder injection.
[0023] The present invention discovered for the first time that KLF6 in lymphatic endothelial cells plays an important role in promoting fluid absorption in pulmonary lymphatic vessels, immune cell transport and lowering pulmonary blood pressure. The expression of KLF6 helps pulmonary lymphatic vessels maintain a highly absorptive connection morphology, maintains normal lymphatic absorption function, and prevents the formation of a pulmonary vascular inflammatory microenvironment to lower pulmonary blood pressure. PDPN is a podoplanin promoter, which is considered to be the most specific promoter of human pulmonary lymphatic endothelium and contributes to the lymphatic vessel-specific expression of KLF6. AAV lung X is a serotype that is widely used in lung gene therapy, has good targeted expression, and the expression time can reach more than 9 months. The present invention uses AAV lungX PDPN promoter -hKLF6 as a gene therapy drug, a single intravenous injection into mice can achieve AAV vector-mediated KLF6 gene transduction in the pulmonary lymphatic vessels, promote the formation of highly absorptive endothelial cell junction structures in the pulmonary lymphatic vessels, promote pulmonary lymphatic vessel function and lower pulmonary blood pressure, and can last for a long time without obvious toxic side effects.
[0024] This invention utilizes AAV as a vector to carry the recombinant KLF6 gene and employs a PDPN lymphatic endothelial-specific promoter to achieve cell-specific therapy, addressing the problem of traditional pulmonary hypertension drugs failing to target pulmonary lymphatic vessels. This invention utilizes the AAVlungX serotype, which is highly effective in infecting lung tissue and offers a long-lasting effect in lowering pulmonary blood pressure, making it suitable for the long-term treatment of pulmonary hypertension.
[0025] This invention addresses the shortcomings of existing technologies in terms of lymphatic targeting and persistence by specifically expressing KLF6 in pulmonary lymphatic vessels. This recombinant adeno-associated virus is expected to significantly improve pulmonary lymphatic function and reduce pulmonary artery pressure, thereby providing a more effective and safer treatment option for patients with pulmonary hypertension. Furthermore, the implementation of this technology will open up new avenues for the application of gene therapy in lung diseases and has great potential for clinical translation. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 AAV lungX-PDPN promoter -hKLF6 overexpresses KLF6 specifically in lung lymphatic vessels (red VEGFR3 marker).
[0027] Figure 2 AAV lungX-PDPN promoter Effects of hKLF6 administration on pulmonary lymphatic endothelial cell junctions and inflammatory cells. A: Promotes the transition of pulmonary lymphatic endothelial cell junctions from a low-absorption continuous zipper-like structure to a highly absorbable discontinuous button-like structure (red VEGFR3 marks lymphatic vessels, green VE-cadherin marks cell junctions). B: Reduces the accumulation of macrophages around pulmonary lymphatic vessels (red IBA1).
[0028] Figure 3 AAV lungX-PDPN promoter -hKLF6 administration effectively improves hypoxia-induced pulmonary hypertension. A: Reduces right ventricular systolic pressure; B: Reduces right ventricular hypertrophy. DETAILED DESCRIPTION
[0029] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0030] Example 1: AAV lungX-PDPN promoter -hKLF6 construct
[0031] 1. Obtain human Kruppel-like transcription factor 6 (hKLF6) gene fragment A
[0032] 1) Based on the sequence of NM_001160124, the protein expression region was identified, and primers were designed and synthesized to amplify the hKLF6 protein expression region. The primer sequences are as follows: hKLF6 F: 5'-GGCAACAGACCTGCCTAGAG-3' and hKLF6 R: 5'-CTCCCGAGCCAGAATGATTTT-3'.
[0033] 2) Amplify target gene fragment: 10×Pfu Buffer (with Mg 2+ ) 5μL; dNTPs (2.5mM each) 4μL; primer mix (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double-distilled water 35.75μL. Gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction. Reaction conditions: 94°C for 3min; 94°C for 30s, 55°C for 30s, 72°C for 3min (30 cycles); 72°C for 10min; 4°C for ∞. The hKLF6 fragment amplified was 726bp in size. The specific nucleotide sequence is shown in SEQ ID NO. 1 and is as follows:
[0034] >SEQ ID NO.1
[0035] .
[0036] 2. Obtain human PDPN promoter sequence B
[0037] 1) Based on the promoter sequence of NM_001006625, primers were designed and synthesized to amplify the PDPN promoter region. The primer sequences are as follows: PDPN F: 5'-AACCAGCGAAGACCGCTATAA-3' and PDPN R: 5'-CGAATGCCTGTTACACTGTTGA-3'.
[0038] 2) Amplify target gene fragment: 10×Pfu Buffer (with Mg 2+) 5μL; dNTPs (2.5mM each) 4μL; primer mix (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double-distilled water 35.75μL. Gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction. Reaction conditions: 94°C for 3 minutes; 94°C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute (30 cycles); 72°C for 10 minutes; 4°C for ∞. The PDPN promoter fragment amplified was 357bp in size. The specific nucleotide sequence is shown in SEQ ID NO. 2 and is as follows:
[0039] >SEQ ID NO.2
[0040] ATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTC AAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGTTGTGGTTATGCGAAAAATGTCGGGAAGGCCCTAA.
[0041] 3. Building PDPN promoter -hKLF6 fragment
[0042] The two products are mixed, denatured and annealed, and the bases of fragments A and B are partially complementary to form a hybrid chain. Design and synthesize the amplification, and introduce protection bases and enzyme cutting sites. The amplification primers are: PDPN promoter -hKLF6 F:5'-CCAGGAACCAGCGAAGACCGC-3' and PDPN promoter -hKLF6 R:5'-GTCGGGATCCTCGTGCCTCCGAATAA-3'; PCR reaction system: 10× Pfu Buffer (with Mg 2+) 5μL; dNTPs (2.5mM each) 4μL; primer mix (0.8μM) 4μL; Pfu DNA polymerase (5U / μL) 0.25μL; template: human genomic DNA (10ng / μL) 1μL; double-distilled water 35.75μL. Gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction. Set the temperature gradient PCR reaction program as follows: 94°C for 3min; 94°C for 30s, 50-65°C for 30s, 72°C for 3.5min (30 cycles); 72°C for 10min; 4°C for ∞. PDPN was amplified. promoter The hKLF6 fragment is 1083 bp in size, and its nucleotide sequence is shown in SEQ ID NO. 3, as follows:
[0043] >SEQ ID NO.3
[0044]
[0045] 4. Construction of pAAV lungX-PDPN promoter -hKLF6 recombinant plasmid
[0046] Purify fragment C. Prepare 50 μL of enzyme digestion system: including 23 μL of double-distilled water, 5 μL of 10× enzyme digestion buffer, 20 μL of purified target fragment C (200 ng / μL), 1 μL of BamHI (20 U / μL), and 1 μL of EcoRI (20 U / μL). Add them to the system in sequence, gently pipette to mix, briefly centrifuge, and incubate at 37°C for 2 hours. Prepare 50 μL of AAV vector transfer plasmid pAAV enzyme digestion system: including 41 μL of double-distilled water, 5 μL of 10× enzyme digestion buffer, 2 μL of AAV vector plasmid (1 μg / μL), 1 μL of BamHI (20 U / μL), and 1 μL of EcoRI (20 U / μL). Add them to the system in sequence, gently pipette to mix, briefly centrifuge, and incubate at 37°C for 2 hours. The fragment and vector digestion products were subjected to agarose gel electrophoresis to recover the target bands. The sizes of the recovered fragments were 3006 bp and 2989 bp, respectively.
[0047] Connect fragment C and vector enzyme digestion recovery product: prepare 10 μL of ligation system, including double-distilled water (fill to 10 μL), 1 μL of 10× DNA ligase buffer, and a molar ratio of fragment C enzyme digestion recovery product to vector enzyme digestion recovery product of 2:1. Incubate at 16°C for ligation overnight.
[0048] Transformation plasmid: Place 1 tube of competent cells on ice to melt; take 100 μL of competent cells and add about 20 ng of plasmid DNA, mix gently with a pipette, and place on ice for 30 minutes; place the centrifuge tube in a 42°C water bath and heat shock for 45 seconds. During the process, stabilize the centrifuge tube and do not shake it; quickly transfer the centrifuge tube to ice and place it for 2 minutes; add 300 μL of LB medium or SOC medium and culture it at 37°C with gentle shaking for 1 hour; take an appropriate volume and evenly spread it on the LB plate containing antibiotics; invert the culture dish and culture it at 37°C overnight. Pick a single colony, amplify and extract the plasmid DNA, use BamHI and EcoRI double enzyme digestion, run agarose gel electrophoresis to determine the insert size is 3006bp, and construct pAAV lungX-PDPN. promoter -hKLF6 recombinant plasmid. Sequencing primers were designed to identify the insert sequence of the recombinant plasmid: 1-GAGAAGACTGAA; 2-TGTCTTCAGGGC; 3-TCGGGACACA; 4-CCAAATAGACCTG; 5-GGAGATGGCAACTT; 6-CCTGGAGAACTAT.
[0049] 5. AAV lungX-PDPN promoter- Packaging, purification and concentration of hKLF6
[0050] Plasmid preparation: The constructed AAV vector transfer plasmid (pAAV lungX-PDPN promoter Amplify and purify the recombinant capsid packaging plasmid (pAAV lungX) and adenovirus helper plasmid (pAdDeltaF6) to an OD260 / 280 of approximately 1.8. pAAV lungX contains Rep and Cap, flanked by two 145-base inverted terminal repeats (ITRs); pAdDeltaF6 contains E4, E2a, and VA, which mediate AAV replication.
[0051] AAV virus packaging: Resuscitate AAV-293 cells and culture them in large quantities in 15cm culture dishes. When the cell confluence reaches 70-80%, transfect the AAV-293 cells with the above plasmids using lipofectamine transfection. Plasmid dosage: pAAVlungX-PDPN promoter -hKLF6 6μg, pAAV lungX 10μg, and helper plasmid pAdDeltaF6 12μg were transfected. After transfection, the culture medium in the dish was replaced with fresh cell culture medium (high-glucose DMEM medium containing 10% fetal bovine serum) and cultured for 66-72 hours.
[0052] To concentrate AAV virus: Collect the supernatant culture medium and cells in a 15 mL centrifuge tube and centrifuge at 500 × g for 3 min to separate the cells and supernatant. Store the supernatant separately and resuspend the cells in 1 mL of PBS. Thaw the cell suspension three to four times in liquid nitrogen and a 37°C water bath, each freeze-thaw cycle lasting approximately 10 min. Remove cell debris by high-speed centrifugation. Transfer the supernatant to a fresh tube and filter through a 0.22 μm filter.
[0053] Purification and concentration of AAV virus: 5% (1.031 g / cm 3 ), 15% (1.085g / cm 3 ), 25% (1.085g / cm 3 ), 40% (1.215g / cm 3 ), 54% (1.291g / cm 3) iodixanol solution. The viral supernatant was slowly added to the density gradient centrifugation medium and centrifuged at 36,0000×g, 16°C for 2 hours using an ultracentrifuge. The 40% layer solution was recovered. Concentrated using a Millipore ultrafiltration tube, centrifuged at 3500rpm for 30min, the virus particles were repeatedly pipetted with 500μL PBS solution, and then aliquoted and stored in a -80°C refrigerator. Determination of virus titer: The number of AAV virus particles was determined by quantitative PCR to detect the genome copy number of the AAV vector.
[0054] Titer>10 13 vg / mL.
[0055] 6. AAV lungX-PDPN promoter - Targeted detection of hKLF6
[0056] Using recombinant adeno-associated virus (rAAV) as a vector, combined with a specific promoter, can ensure the specific expression of the KLF6 gene in the pulmonary lymphatic vessels, enhancing the targeting and safety of the treatment. Figure 1 As shown, compared with the conventional KLF6 overexpression construction method (such as AAV9-KLF6), the present invention uses AAV lungX combined with PDPN promoter modified recombinant adeno-associated virus (AAV lungX-PDPN promoter -hKLF6), which can overexpress KLF6 specifically in pulmonary lymphatic vessels (red VEGFR3 marker).
[0057] Example 2: AAV lungX-PDPN promoter -Application of hKLF6 in the study of lowering pulmonary blood pressure
[0058] Recombinant AAV (AAV lungX-PDPN promoter -hKLF6) intravenous injection: 4-week-old mice from the same littermate were randomly injected with control virus (AAV lungX-Control) and lymphatic vessel overexpression KLF6 virus (AAV lungX-PDPN) promoter -hKLF6), 8 mice in each group, each mouse was anesthetized with pentobarbital (dose of 50 mg / g body weight), the tail blood vessels of the mice were fully exposed with an operating light, and a 31G disposable insulin syringe was used to penetrate the blood vessels at 20 degrees, and the injection dose was 5×10 11 Virus titer. The entire procedure was performed under operating room-grade sterile laminar flow conditions. Daily postoperative observation confirmed no obvious wound infection.
[0059] Establishing a mouse model of pulmonary hypertension: We used a classic mouse model of hypoxia-induced pulmonary hypertension. Specifically, after injection of control virus and lymphatic overexpression of KLF6 virus for 4 weeks, we placed the mice in a hypoxic (10% O2+90% N2) chamber, where the light / dark cycle of the hypoxic chamber was 12 / 12 hours, for 4 weeks. The oxygen chamber was opened once a week for about 20 minutes to change the clean cage and replenish food and water.
[0060] Right Ventricle Systolic pressure (RVSP) measurement, mice were anesthetized with 1% sodium pentobarbital and the abdominal transverse interface was opened to expose the diaphragm of the mouse, then a 22G needle connected with a pressure sensor was inserted into the right ventricle, and the stable right ventricular pressure waveform was recorded, and the right ventricular systolic pressure (RVSP) was calculated by the average peak value.
[0061] Right ventricular average thickness measurement: The mice were taken after the pressure measurement. The heart was fixed, dehydrated, xylene transparent, and immersed in wax, then the heart cross-section was cut by a paraffin microtome (Leica), the right ventricle at the level of the left ventricular mitral valve was selected, and the interventricular septum should have approximately the same size, and the slice was stained with hematoxylin and eosin (HE) to evaluate the histological morphology of the heart. Then the Tissue Fax panoramic confocal microscope was used to take the panoramic picture of the heart cross-section for subsequent analysis, and the average thickness of the right ventricle was calculated by the following method: the right ventricle at the level of the left ventricular mitral valve was selected, and the interventricular septum should have approximately the same size, the cross-sectional area and length of the whole right ventricle were measured by Image J, and the average thickness of the right ventricle was obtained by the total area of the right ventricle / right ventricular length.
[0062] Lung Tissue Immunofluorescence: Lung lobes were removed from mice undergoing manometry. Lung tissue was fixed with 4% paraformaldehyde on ice for 1 hour, followed by permeabilization with methanol at -20°C for 20 minutes. Samples were then equilibrated in 30% sucrose at 4°C overnight and embedded in OCT. 100 μm lung tissue sections were then cut using a cryostat. Lung cryosections were incubated with 5% H₂O₂ for 5 minutes to eliminate autofluorescence and then blocked with blocking buffer (5% donkey serum, 3% BSA, 0.1% Triton X-100 in PBS) for 1 hour at room temperature. For staining, primary antibodies (e.g., VE-cadherin for cell junctions and VEGFR3 for lymphatic vessels) were incubated overnight at 4°C, followed by fluorescently labeled secondary antibodies and DAPI for 1 hour at room temperature. Each incubation was followed by ample washing with PBS. After mounting, confocal fluorescence images of lung sections were acquired using a confocal microscope (Nikon C2) for subsequent analysis. For the analysis of cell junctions, a blinded double-person method was used to independently count the numbers. The sum of the lengths of zipper-like junctions and button-like junctions was manually circled using Image J to calculate the percentage of (zipper-like junction length) / (sum of zipper-like junctions + button-like junction length) as an evaluation index of lymphatic vessel absorption function.
[0063] like Figure 2 As shown, the recombinant KLF6-related virus (AAV lungX-PDPN) overexpressing KLF6 in lymphatic vessels promoter -hKLF6) can effectively transform lymphatic endothelial cell junctions from low-absorption zipper-like junctions to highly absorbable button-like junctions (A, red VEGFR3 marks lymphatic vessels, green VE-cadherin marks cell junctions), thereby promoting the transport of inflammatory cells by pulmonary lymphatic vessels. As a result, the accumulation of macrophages (red IBA1) around pulmonary lymphatic vessels is significantly reduced (B). This result suggests that by promoting the function of pulmonary lymphatic vessels, improving fluid drainage and reducing lung inflammation, pulmonary artery pressure can be reduced. This mechanism not only helps alleviate the symptoms of pulmonary hypertension but also may reverse the pathological process.
[0064] like Figure 3 As shown, the recombinant KLF6-related virus (AAV lungX-PDPN) overexpressing KLF6 in lymphatic vessels promoter -hKLF6), can effectively improve hypoxia-induced pulmonary hypertension, including a decrease in right ventricular systolic pressure (A) and improvement in right ventricular hypertrophy (B).
[0065] In summary, the technical solution of the present invention provides an innovative and effective solution for the treatment of pulmonary hypertension by combining efficient gene expression, targeted delivery and safety advantages, and has relatively important clinical value.
[0066] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be construed as limiting the present invention, and the scope of protection of the present invention should be determined by the scope defined in the claims. Persons skilled in the art will appreciate that improvements and modifications may be made without departing from the spirit and scope of the present invention, and such improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for constructing a recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure, characterized in that: The following steps are involved: 1) Obtaining human hKLF6 gene fragment; 2) Obtaining the human PDPN promoter sequence; 3) Building PDPN promoter -hKLF6 fragment; 4) Construction of pAAVlungX-PDPN promoter -hKLF6 recombinant plasmid; 5) AAV lungX-PDPN promoter - Packaging, purification and concentration of hKLF6.
2. A recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that lowers pulmonary blood pressure, obtained by the construction method according to claim 1.
3. Use of the recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure according to claim 2 in the preparation of a drug for preventing and treating pulmonary hypertension.
4. A drug for preventing and treating pulmonary hypertension, characterized in that: The medicine comprises as an active ingredient the recombinant adeno-associated virus expressing KLF6 in lymphatic vessels that reduces pulmonary blood pressure as claimed in claim 2.
5. The drug according to claim 4, characterized in that The medicine further comprises a pharmaceutically acceptable carrier.
6. The drug according to claim 4, characterized in that The dosage form of the medicine is injection.
7. The drug according to claim 6, characterized in that The injection includes injection solution and freeze-dried powder injection.
Citation Information
Patent Citations
Construction method and application of recombinant adeno-associated virus for reducing intraocular pressure and expressing NRP1
CN116254237A