Lentivirus packaging system and application thereof

Abstract

The invention provides a lentivirus packaging system and application thereof. Based on an existing lentivirus four-plasmid packaging system, a packaging element vpx-motif of VPX is added into a packaging plasmid pMDLg, a VPX expression plasmid pVPX is constructed, and the VPX expression plasmid pVPX and existing lentivirus plasmid vectors including pRSV, pMD2. G and pCDH-EF1-GFP-kana form a five-plasmid lentivirus packaging system. When lentivirus packaging is carried out, VPX is controllably introduced into the virus by adjusting the mass ratio of the five plasmids. The introduction of VPX in the invention does not cause reduction of virus titer. In addition, the macrophages and the dendritic cells are pretreated by dNTPs before transfection, so that the transfection efficiency of the lentivirus containing the VPX can be further improved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and immune cell therapy, and in particular, relates to a lentivirus packaging system and application thereof. Background Art

[0002] Lentivirus can package genetic material into the viral genome, and insert the genetic material into the host cell genome after the virus invades the host cell, thereby stabilizing inheritance. Therefore, lentivirus is widely used in gene therapy and is widely used in cell therapy and immune cell transformation. The modified lentivirus has a wide range of infection capabilities for cells expressing LDL (low-density lipoprotein) on the cell membrane. However, the viral transfection efficiency of cells that can specifically resist viral transfection or are sensitive to viruses (such as macrophages, dendritic cells, etc.) is very low, mainly for the following three reasons. First, because the highly expressed SAMHD-1 protein (SAM and HD domain-containing deoxynucleoside triphosphatetriphosphohydrolase 1) in such cells can degrade exogenous DNA, thereby reducing the efficiency of viral transfection of macrophages. Second, the cGAS-STING (cGAS: cyclic GMP-AMP Synthase; STING: Stimulator of interferon genes, interferon gene stimulator, cGAMP activated adaptor protein) signaling pathway in cells can be rapidly activated under the stimulation of exogenous DNA, further activating the NF-кB pathway to cause inflammation and stress response, and promote the cell to clear exogenous DNA. Third, the concentration of dNTPs in macrophages is about 20-50nM, which is the concentration of CD4 + The extremely low dNTPs concentration is 50 to 100 times lower than that in T cells (1-5 μM), which inhibits the reverse transcriptase activity in the lentivirus. The above reasons greatly reduce the efficiency of lentivirus transfection of macrophages.

[0003] Sunseri et al. demonstrated in JOURNAL OF VIROLOGY, 2011, p6263–6274 that VPX (viral protein X) from the simian virus SIV mac 239 can bind to SAMHD-1, causing SAMHD-1 to be degraded by proteases, thereby reducing the chance of DNA reverse transcribed from the lentiviral genome being degraded. Therefore, the introduction of VPX into lentivirus can effectively promote lentivirus transfection of macrophages, dendritic cells and other cells that highly express SAMHD-1.

[0004] In addition, VPX can also bind to STING in macrophages and dendritic cells, reducing the expression of related genes mediated by the cGAS-STING-NF-кB signaling pathway induced by STING protein, thereby reducing the stimulation of lentivirus and enhancing the efficiency of virus transfection in macrophages.

[0005] Sunseri et al. also demonstrated in JOURNAL OF VIROLOGY, 2011, p6263–6274 that lentivirus containing VPX has increased transfection efficiency in macrophages. By packaging VPX into lentiviral particles, the transfection efficiency of lentivirus in macrophages can be significantly improved.

[0006] The existing fourth-generation HIV-1 lentiviral packaging system consists of the following four plasmids: (1) a main plasmid containing the lentiviral long terminal repeat sequence (LTR) to which the target gene can be added according to research needs; (2) a plasmid pMDLg that expresses lentiviral replication-related enzymes; (3) a plasmid pRSV that expresses lentiviral regulatory proteins and viral packaging-related proteins; and (4) an auxiliary plasmid pMD2.G that expresses the vesicular stomatitis virus G protein (VSV-G). In this plasmid, VSV-G replaces the original lentiviral envelope protein Env, making the lentivirus transfectable into a wider range of cell types.

[0007] In order to improve the efficiency of lentivirus transfection of macrophages, Sunseri et al. modified the nucleic acid sequence encoding Gagp6 protein in lentivirus and introduced a packaging motif capable of packaging VPX at its C-terminus. After translation, Gag protein with VPX packaging motif (vpx-motif) can package VPX into the virus. Sunseri et al. also tried to replace the negative regulator nef gene in lentivirus with the vpx gene, thereby enhancing the transfection efficiency of the virus by expressing VPX. However, its transfection efficiency for macrophages is not yet suitable for large-scale cell drug production.

[0008] CN116463381A continues to use the existing four-plasmid lentiviral packaging system, and refers to the modification method of Gagp6 protein by Sunseri et al. By modifying Gagp6 protein and plasmid pMD2.G, the gene encoding VPX is added to the VSV-G envelope gene through T2A shearing peptide. The VPX-VSV-G fusion protein expressed in the virus can be packaged into the lentivirus by self-scission of T2A to produce free VPX, thereby protecting the DNA produced by viral reverse transcription from degradation. However, this design leads to a decrease in viral titer, and the viral titer is negatively correlated with the amount of VPX packaged into the virus. The more VPX in the virus, the more obvious the decrease in viral titer. The possible reason is that due to the efficiency problem of T2A shearing peptide shearing, a large amount of incompletely sheared VPX-VSV-G fusion protein is produced, resulting in VSV-G being packaged into the virus, so the amount of VSV-G on the surface of the virus is reduced, thereby reducing the biological titer of the virus.

[0009] In order to solve the problem of low efficiency of lentivirus transfection of macrophages, the present invention adds a separately constructed VPX expression plasmid pVPX to the lentivirus packaging system, and on this basis, simultaneously develops a five-plasmid transfection system and transfection method that significantly improves the efficiency of lentivirus transfection of macrophages. Summary of the invention

[0010] The purpose of the present invention is to provide a lentivirus packaging system and application thereof.

[0011] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a lentiviral packaging system, comprising the following five plasmids: pCDH-EF1-GFP-kana, pMDLg-vpxmotif, pMD2.G, pVPX and pRSV.

[0012] In the present invention, plasmids pCDH-EF1-GFP-kana, pMD2.G and pRSV are derived from HIV-1 type lentiviral packaging system, as described in Dull et al., Journal of Virology, 1998, 8463-71.

[0013] Plasmid pMDLg-vpx motif is a packaging plasmid capable of packaging VPX into virus, in which the nucleotide sequence encoding amino acids 459-473 of Gag protein in plasmid pMDLg is replaced with a nucleotide sequence encoding amino acids shown in SEQ ID NO: 1.

[0014] Plasmid pVPX is a plasmid expressing SIV mac 239 virus VPX (SEQ ID NO: 2) with pMD2.G plasmid as the backbone.

[0015] Preferably, the nucleotide sequence of plasmid pMDLg-vpx motif is shown as SEQ ID NO:13, and the nucleotide sequence of plasmid pVPX is shown as SEQ ID NO:14.

[0016] In the lentiviral packaging system, the mass ratio of plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX and pRSV is 4:(3-6):1:1:(1-3), and the preferred mass ratios are 4:3:1:1:3, 4:6:1:1:3, 4:3:1:1:3, and 4:6:1:1:3.

[0017] In a second aspect, the present invention provides any of the following applications of the lentiviral packaging system:

[0018] 1) For the preparation of cell therapy drugs;

[0019] 2) Used for the transformation of mononuclear cells and immune cells.

[0020] The immune cells include but are not limited to monocytes, macrophages, and dendritic cells.

[0021] In a third aspect, the present invention provides a method for improving macrophage transfection efficiency, the method comprising: after the macrophages are treated with dNTPs, transfection is performed using the lentiviral packaging system.

[0022] Further, 2.5-10 mM dNTPs (preferably the final concentration of each nucleotide is 2.5 mM) is added to the macrophage culture medium, and after incubation for 2-6 hours, the lentiviral packaging system is added to the culture medium at MOI=1-2 (preferably MOI=1 or 2) for transfection.

[0023] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0024] (I) The present invention is based on the original four-plasmid packaging system of lentivirus. By modifying the pMDLg plasmid, that is, adding the packaging element vpx-motif of VPX to the packaging plasmid pMDLg, and constructing a plasmid pVPX containing the VPX gene alone, it is avoided that the fusion protein produced by the co-expression of VPX and other genes affects the packaging of the lentivirus due to incomplete self-cleavage. The above two modified plasmids and the original lentivirus plasmid vectors: pRSV, pMD.2G, pCDH-EF1-GFP-kana form a five-plasmid lentivirus packaging system. When packaging the lentivirus, VPX is controllably introduced into the virus by adjusting the mass ratio of the five plasmids, and at the same time, the problem of decreased virus titer caused by the introduction of VPX in CN116463381A is solved.

[0025] (ii) The present invention uses dNTPs (deoxyribonucleoside triphosphates) to treat macrophages and dendritic cells before lentivirus transfection of macrophages, which can increase the transfection efficiency of lentivirus on macrophages and dendritic cells. When used in combination with a modified lentivirus containing VPX, the transfection efficiency can be increased by 3-4 times compared with the unmodified virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a picture of the pMDLg-vpxmotif plasmid in Example 1 of the present invention.

[0027] Figure 2 This is a picture of the auxiliary plasmid pVPX in Example 1 of the present invention.

[0028] Figure 3 This is a picture of the pMD2.G-vpx-VSV-G plasmid in Example 1 of the present invention.

[0029] Figure 4 This is a picture of the pMD2.G plasmid in Example 1 of the present invention.

[0030] Figure 5 This is a picture of the pCDH-EF1-GFP-kana plasmid in Example 2 of the present invention.

[0031] Figure 6 Schematic diagram of plasmid mass ratio when packaging viruses A, D, E, F, G, and H in Example 2 of the present invention

[0032] Figure 7 This is a picture of the titer detection results of viruses A, D, and E in Example 3 of the present invention.

[0033] Figure 8 This is a picture of the titer detection results of viruses A, E, F, G, and H in Example 3 of the present invention.

[0034] Fig. 9 This is a picture of the percentage of GFP-positive cells in THP-1 cells (Cell Bank of the Chinese Academy of Sciences, SCSP-567) treated with PMA (phorbol ester) transfected with viruses at different MOIs in Example 4 of the present invention.

[0035] Fig.10 This is a graph showing the physical titer p24 results of viruses A, E, F, G, and H in Example 5 of the present invention.

[0036] Fig.11 This is a graph showing the results of protein blotting experiments of viruses A, E, F, G, and H in Example 5 of the present invention.

[0037] Fig.12 This is a flow cytometry result diagram of the percentage of GFP-positive cells after virus A, E, F, G, and H transfected macrophages in Example 7 of the present invention.

[0038] Fig.13 This is a graph showing the average fluorescence intensity of GFP-positive cells after virus A, E, F, G, and H transfected macrophages in Example 7 of the present invention.

[0039] Fig.14 This is a graph showing the results of macrophage viability after macrophages were transfected with viruses A, E, F, G, and H in Example 7 of the present invention.

[0040] Fig.15 This is a flow cytometry result diagram of the percentage of GFP-positive cells after dendritic cells were transfected with viruses A, E, F, G, and H in Example 7 of the present invention.

[0041] Fig.16 This is a graph showing the average fluorescence intensity of GFP-positive cells after dendritic cells were transfected with viruses A, E, F, G, and H in Example 7 of the present invention.

[0042] Fig.17 This is a graph showing the percentage of GFP-positive cells in macrophages pre-treated with dNTPs transfected with lentivirus containing or not containing VPX under MOI=1 and MOI=2 conditions in Example 8 of the present invention.

[0043] Fig.18 This is the result of Western blotting experiment on the cleavage efficiency of cleavage peptide expressed by fusion of VPX and VSV-G. DETAILED DESCRIPTION

[0044] The present invention provides a modified lentiviral packaging system and a method for increasing the transfection efficiency of macrophages and dendritic cells, comprising the following steps:

[0045] (1) Construction of lentiviral packaging plasmids pMDLg-vpxmotif, pMD2.G-vpx-VSV-G, and additional plasmid pVPX vector.

[0046] (2) HEK293T cell (Chinese Academy of Sciences Cell Bank, Catalog No. SCSP-502) virus packaging and virus collection: Five plasmids were packaged into lentivirus according to different mass ratios. Lentivirus was collected after 48 hours.

[0047] (3) Protein extraction and western blot experiment of modified lentivirus and corresponding HEK293T cells: Viruses and corresponding HEK293T cells were collected, and proteins in the cells were extracted by ultrasonic disruption. Western blot experiment was performed together with the collected viruses.

[0048] (4) Virus titer determination: THP-1 cells were revived, and the virus collected in step (2) was graded diluted and then transfected with lentivirus. Flow cytometry was performed 48 hours later.

[0049] (5) Isolation of monocytes from peripheral blood and culture and transfection of monocytes, macrophages and dendritic cells.

[0050] (6) PMA (phorbol ester) treatment of THP-1 cells.

[0051] (7) dNTPs treatment of macrophages.

[0052] (8) Flow cytometry of virus-transfected macrophages and dendritic cells: 4 days after virus transfection, macrophages were digested with cell digestion solution, centrifuged and cell pellets were collected. The cells were resuspended in PBS and the positive rate and mean fluorescence intensity of virus transfection were detected by flow cytometry.

[0053] As a preferred technical solution of the present invention, in step (1), the pMDLg-vpx motif plasmid (SEQ ID NO: 13), the additional plasmid pVPX (SEQ ID NO: 14), and the pMD2.G-vpx-VSV-G plasmid are respectively as follows: Figure 1 , Figure 2 , Figure 3 The aa459-473 peptide segment in the Gag protein encoded by the original pMDLg plasmid was replaced with the amino acid sequence shown in SEQ ID NO: 1, i.e., the pMDLg-vpxmotif plasmid. The amino acid sequence of SIVmac 239VPX in the auxiliary plasmid pVPX is shown in SEQ ID NO: 2.

[0054] As a preferred technical solution of the present invention, the mass ratio of the four plasmids for lentiviral packaging in step (2), namely the main plasmid pCDH-EF1-GFP-kana plasmid ( Figure 5 ), pMDLg-vpxmotif, pMD2.G-vpx-VSV-G, and pRSV have a mass ratio of 4:3:1:1.

[0055] As a preferred technical solution of the present invention, the mass ratio of the five plasmids packaged by the lentivirus in step (2), i.e., the mass ratio of pCDH-EF1-GFP-kana plasmid, pMDLg-vpxmotif, pMD2.G, pRSV, and pVPX is 4:3:1:1:1 or 4:6:1:1:1 or 4:3:1:1:3 or 4:6:1:1:3.

[0056] As a preferred technical solution of the present invention, in step (3), the primary antibodies for detecting the target protein VPX, the viral internal reference protein p24, and the cellular internal reference protein GADPH are respectively: anti-flagrabbitpolyclonal antibody (Shanghai Biotech Co., Ltd., Catalog No.: AF0036), anti-HIV1 p24PolyclonalAntibody (Thermo Fisher Scientific Biotech Co., Ltd., Catalog No.: PA5-81773), and anti-GADPHrabbitpolyclonal antibody (Shanghai Biotech Co., Ltd., Catalog No.: AG0122).

[0057] As a preferred technical solution of the present invention, in step (4), THP-1 cells are suspended cells, no serum is used in the transfection process, and the titer is selected within a confidence range of 20% positive rate.

[0058] As a preferred technical solution of the present invention, the macrophage culture medium in step (5) is RPMI 1640 culture medium (Situofan Biotechnology Co., Ltd., Catalog No.: SH30255.01) with a final concentration of 10% FBS (fetal bovine serum, Gibco, Catalog No.: A5670701). Human colony stimulating factor GM-CSF (Suzhou Jinan Protein Technology Co., Ltd., Catalog No.: DC040) is added at a final concentration of 50 ng / mL. Lentivirus transfection is performed after 7 days of culture, and the GFP positivity rate is detected on the 4th day after transfection. For the culture of dendritic cells, 100 ng / mL IL-4 needs to be added separately.

[0059] As a preferred technical solution of the present invention, in step (6), THP-1 cells are treated with phorbol ester PMA (Merck, Darmstadt, Germany, catalog number: P8139) at a final concentration of 5 ng / mL for 24 hours.

[0060] As a preferred technical solution of the present invention, in step (7), the dNTPs treatment concentration is 2.5 mM-10 mM, the treatment time is 4 hours, and the final concentration of each nucleotide is 2.5 mM.

[0061] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0062] In the following examples, plasmids pCDH-EF1-GFP-kana, pMD2.G, and pRSV were purchased from Aonogen with catalog numbers HG-VMA0370, HG-VMA0648, and HG-VMA0374.

[0063] The primers involved in the following examples are:

[0064] VPXF:ATGTCAGATCCCAGGGAGAGAA(SEQ ID NO:3)

[0065] VPXR:TGCTAGTCCTGGAGGGGGAG(SEQ ID NO:4)

[0066] VPXmotifF:CTTTAGCTTCCTCAGATCACTCTT(SEQ ID NO:5)

[0067] VPXmotifR:GGTCGCTGCCAAAGAGTGATCTGA(SEQ ID NO:6)

[0068] pMDLgF:GACAAGGAACTGTATCCTTTAGCTTCC (SEQ ID NO:7)

[0069] pMDLgR: TTATTGTGACGAGGGGTCGCTG (SEQ ID NO:8)

[0070] pMD2.GF: CTTGTCGTCGTCGTCCTTGTAGTCCATCATAGTGTCAGAA (SEQ ID NO:9)

[0071] pMD2.G R1: CTCCCTCCAGGACTAGCATAACTCAAATCCTGCACAACAGATTCT (SEQ ID NO:10)

[0072] pMD2.GF: CTTGTCGTCGTCGTCCTTGTAGTCCATCATAGTGTCAGAA (SEQ ID NO: 11)

[0073] pMD2.G R2: GACCAAATCAACTTGTGATACCATGC (SEQ ID NO:12)

[0074] Example 1 Construction of lentiviral plasmid vectors pMDLg-vpx motif, pVPX, and pMD2.G-vpx-VSV-G

[0075] 1. VPX codon optimization. The optimization was completed by the Guangzhou Synthesis Department of Beijing Qingke Biotechnology Co., Ltd. The optimized vpx gene sequence was used to construct the vpx sequence-containing plasmids pMD2.G-vpx-VSV-G and pVPX. The optimized VPX amino acid sequence is consistent with the original SIVmac239VPX amino acid sequence, as shown in SEQ ID NO: 2.

[0076] 2. Small-scale preparation of plasmid. Prepare LB medium: NaCl 10g / L, tryptone 10g / L, yeast extract 5g / L. Sterilize with high-pressure steam at 121℃ for 20 minutes and set aside. Prepare 60mg / mL of kanamycin sulfate stock solution and add it to the sterilized LB medium prepared above at a ratio of 1:1000. Take 5mL of LB medium and place it in a 15mL centrifuge tube. Pick a single colony with an inoculation loop and inoculate it in 5mL LB. Shake the culture at 200rpm and 37℃ for 12 hours. Press The plasmid was extracted using the FastPure Plasmid Kit (Cat. No. DC201-01).

[0077] 3. Primer design and polymerase chain reaction

[0078] The sequences of the vpx gene primers vpx F / vpx R are shown in SEQ ID NO: 3-4.

[0079] The sequences of the VPX motif packaging element primers VPX motifF / VPXmotifR are shown in SEQ ID NOs: 5-6.

[0080] use The desired fragment was amplified using a high-fidelity kit (Phanta Max Super-Fidelity DNA Polymerase, Catalog No.: P505-d1) and then The gel recovery kit (FastPure GelDNAExtraction Kit, catalog number: DC301-01) was used for recovery and standby use.

[0081] The amplification procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 s, annealing at 56-72°C for 15 s, extension at 72°C for 30-60 s / kb, 35 cycles, and final extension at 72°C for 5 min. The PCR product was recovered and purified by agarose gel electrophoresis and resuspended in 30 μL TEbuffer for later use.

[0082] VPX motif packaging element fragments are obtained:

[0083] The protein sequence of the VPX motif packaging element is shown in SEQ ID NO:1. The required nucleic acid fragments are synthesized by annealing single-stranded primers, and the sequences of the single-stranded primers are shown in SEQ ID NO:5 and 6. The single-stranded DNA is dissolved in annealing buffer (10mM Tris pH 8.0, 50mMNaCl, 1mM EDTA) to a concentration of 1-5OD / 100μL. The two complementary single-stranded primers are mixed in equal molar numbers. Incubate at 94℃ for 2-5 minutes, then slowly cool to room temperature. Store at 4℃ for later use.

[0084] 4. Construction of lentiviral plasmid vectors pMDLg-vpxmotif, pMD2.G-vpx-VSV-G, and pVPX

[0085] (1) Construction of plasmid pMDLg-vpx motif

[0086] The plasmid pMDLg-vpx motif vector backbone was obtained by reverse PCR, and the primer sequences are shown in SEQ ID NO: 7 and 8. According to the product instructions of the seamless cloning kit (ClonExpress Ultra One Step Cloning Kit, Novogene, Cat. No. C112-01), the pMDLg vector fragment and the vpx-motif packaging element fragment were mixed and incubated for 15 minutes, and the product was transformed into Stbl3 competent Escherichia coli. The plasmid pMDLg-vpx motif map is shown in Figure 1 The nucleotide sequence of plasmid pMDLg-vpxmotif is shown in SEQ ID NO:13.

[0087] (2) Construction of plasmid pMD2.G-vpx-VSV-G

[0088] Plasmid pMD2.G-vpx-VSV-G retains all gene sequences of the original pMD.2G plasmid, and only inserts the vpx sequence with a flag tag linked by T2A cleavage peptide before VSV-G.

[0089] The pMD2.G vector was obtained by reverse PCR, and the primer sequences are shown in SEQ ID NO: 9 and 10. According to the product instructions of the seamless cloning kit (Novozyme, catalog number: C112-01), the pMDLg vector fragment and the vpx gene fragment were mixed and incubated. After incubation, Stbl3 competent Escherichia coli were transformed. The map of plasmid pMD2.G-vpx-VSV-G is shown in Figure 3 shown.

[0090] (3) Construction of plasmid pVPX

[0091] The vector backbone of the lentiviral plasmid vector pVPX is derived from pMD2.G, as shown in the figure Figure 4 As shown. The gene fragment between the CMV promoter and β-globin poly (A) of the pMD2.G plasmid was amplified as the vector backbone of the lentiviral plasmid pVPX. The primer sequences are shown in SEQ ID NO: 11 and 12. According to the seamless cloning kit (ClonExpress Ultra One Step Cloning Kit, Norwegian, catalog number: C112-01), the pMD2.G vector backbone fragment and the VPX gene fragment were mixed and incubated. After incubation, Stbl3 competent Escherichia coli was transformed. (Shanghai Biotech Co., Ltd., catalog number: D1081M). The nucleotide sequence of the plasmid pVPX is shown in SEQ ID NO: 14.

[0092] After the above plasmids are transformed, positive clones are selected, plasmids are extracted, preliminary enzyme digestion identification is performed, and then sequencing identification is performed, quality is mass-prepared, and strains are preserved.

[0093] Example 2 Lentivirus packaging

[0094] (1) HEK293T cells (Chinese Academy of Sciences Cell Bank, Catalog No.: SCSP-502) were revived and cultured to 70-80% confluence for lentiviral packaging. The steps are as follows: Opti-MEM medium (Gibco, Catalog No.: 51985091) was mixed with 1 mg / mL PEI (Polyethylenimine) 25k (Merck, Darmstadt, Germany, Catalog No.: 26658-46-8) to a final concentration of 0.27 mg / mL of PEI. After 20 minutes, the above mixture and the main plasmid pCDH-EF1-GFP-kana ( Figure 5 ), pMD2.G or pMD2.G-vpx-VSV-G, pMDLg or pMDLg-vpx-motif, and pRSV plasmids were mixed, and the total concentration of plasmids in the system was 0.09 μg / mL. The mass ratio of each plasmid in the lentiviral packaging system is as follows: Figure 6 As shown. Let stand for 20 minutes, add to DMEM medium containing 5% FBS (Situofan Biotechnology Co., Ltd., catalog number: SH30243.FS). Mix well, and replace the medium in the culture bottle with the above medium containing plasmid and PEI. After 6 hours, replace it with DMEM medium containing 10% FBS. After 48 hours, collect the cell culture medium and collect the virus after filtering through a 0.45μm filter membrane.

[0095] In virus titer detection, virus transfection of THP-1 cells, virus transfection of macrophages, and dendritic cells experiments:

[0096] Furthermore, the mass ratio of the main plasmids pCDH-EF1-GFP-kana, pMDLg, pMD2.G, and pRSV is 4:3:1:1, and the virus packaged in this ratio is named virus A; the mass ratio of the main plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G-vpx-VSV-G, and pRSV is 4:3:1:1, and the virus packaged in this ratio is named virus D; the mass ratio of the main plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX, and pRSV is 4:3:1:1:1, and the virus packaged in this ratio is named virus E.

[0097] VPX Western Blot Experiment:

[0098] Furthermore, the mass ratio of the main plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX, and pRSV plasmids was 4:6:1:1:1 and named virus F, or 4:3:1:1:3 and named virus G, or 4:6:1:1:3 and named virus H.

[0099] Example 3 Lentivirus titer detection

[0100] The cultured THP-1 cells (Cell Bank of the Chinese Academy of Sciences, SCSP-567) were replaced with RPMI 1640 medium containing 10% FBS at the final concentration one day before the virus titer test. The medium was replaced with serum-free RPMI 1640 medium the next day. The cells were counted and the cell concentration was adjusted to 0.5×10 6 cells / mL. 0.25×10 6 Cells were inoculated into a 48-well plate. 0.15 μL of protamine (stock concentration is 10 mg / mL) was added to each well. After mixing, the virus was added. After 6 hours, half of the amount of RPMI 1640 medium containing 30% FBS was added. After 48 hours of culture in a 37°C, 5% CO2 incubator, the GFP positive rate (FITC channel) was detected by flow cytometry.

[0101] In the virus verification experiment, the titers of A, D, and E viruses are as follows: Figure 7 shown.

[0102] The titers of viruses A, D, and E are: 5.16×10 7 TU / mL, 3.68×10 7 TU / mL, 4.12×10 7 TU / mL.

[0103] The titers of A, E, F, G, and H viruses in the VPX protein validation experiment are as follows: Figure 8 shown.

[0104] The titers of viruses A, E, F, G, and H were 10×10 7 TU / mL, 9.32×10 7 TU / mL, 8.72×10 7 TU / mL, 5.88×10 7 TU / mL, 5.32×10 7 TU / mL.

[0105] Example 4 Virus A, D, E transfected PMA-treated THP-1 cells

[0106] THP-1 cells were treated with RPMI 1640 medium containing 5 ng / mL PMA and 10% FBS overnight, and 24 hours later, the medium was replaced with RPMI 1640 medium without PMA and containing 10% FBS and continued to be cultured. Figure 7 The virus titer in the culture medium was used to calculate the amount of virus A, D, and E to be added under MOI=1 and MOI=2 transfection conditions. After the virus was transfected into THP-1 cells in serum-free RPMI 1640 medium for 6 hours, the medium containing the virus was replaced with RPMI 1640 medium containing 10% FBS. After 48 hours of incubation at 37°C and 5% CO2, the cells were digested and collected with digestion solution and subjected to flow cytometry.

[0107] The flow cytometry results are as follows Fig. 9 As shown. When MOI = 2, the transfection efficiency of virus A, D, and E on PMA-treated THP-1 cells was 35%, 63.4%, and 66.3%, respectively. This shows that the introduction of VPX into the virus can significantly improve the transfection efficiency of lentivirus on PMA-treated THP-1 cells. And compared with virus D, virus E can reduce the loss of virus titer when VPX is expressed alone instead of fused with VSV-G ( Figure 7 ).

[0108] Therefore, a five-plasmid packaging system (main plasmid pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX, and pRSV) was selected for subsequent experiments.

[0109] Example 5 VPX Western Blot Experiment

[0110] The p24 detection kit (Thermo Fisher Scientific, Cat. No. 632200) was used to detect the content of p24 capsid protein in virus A, E, F, G, and H. The p24 detection results are shown in Fig.10 Press Fig.10The p24 content was determined, and the same amount of p24 (300 ng) and the same volume (20 μL) were used for Western blotting. The expression of p24 and VPX was detected using anti-p24 and anti-flag antibodies. The results are shown in Fig.10 , Fig.11 As shown, VPX is expressed in viruses E, F, G, and H. Compared with viruses E and F, the VPX target bands in viruses G and H are more obvious. This indicates that doubling the amount of pVPX plasmid during virus packaging increases the amount of VPX packaged into the virus.

[0111] Example 6: Mononuclear cell extraction and culture

[0112] Transfer the peripheral blood collected in the anticoagulant tube to a centrifuge tube and centrifuge at 700g for 20 minutes. Use a pipette to carefully aspirate the upper serum. Heat the serum in a 56°C water bath for 20 minutes, then centrifuge at 3000g for 10 minutes, and take the supernatant for later use. Dilute the lower layer of blood cell fluid with PBS at a volume ratio of 1:1. Carefully add the blood cell dilution to the upper layer of lymph separation fluid (Shanghai Biyuntian Biotechnology Co., Ltd., catalog number: C0025-200). Follow the instructions for the lymph separation fluid to separate and count mononuclear cells. Use CD14 + Cells were sorted using the positive selection kit (Miltenyi Biotec, Cat. No. 130-050-201). The cells were washed once with PBS buffer and the supernatant was removed. The cell pellet was resuspended in RPMI1640 medium containing 10% autologous serum and GM-CSF at a final concentration of 50 ng / mL, and the cell density was adjusted to 1×10 6 Cells / mL. 0.25 mL of cells per well were seeded into 24-well plates. Cultured in a 37°C, 5% CO2 incubator for 7 days. The medium was changed on the 4th day and the cells that did not adhere to the wall were removed. For the culture of dendritic cells, 100 ng / mL of IL-4 was added.

[0113] Example 7: Transfection of Macrophages and Dendritic Cells with Modified Viruses

[0114] according to Figure 8 The virus titer was calculated to calculate the amount of virus required for virus A, E, F, G, and H under MOI = 0.5 and 1. The macrophages and dendritic cells cultured to the seventh day were rinsed once with serum-free RPMI 1640 medium and 0.25 mL of serum-free RPMI 1640 medium was added. 0.15 μL of 10 mg / mL protamine and virus were added to each well. Shake carefully to mix. Culture in a 37°C incubator for 6 hours, and after 6 hours, half the volume of RPMI 1640 medium containing 30% autologous serum was added. After continuing to culture for 4 days, cell digestion solution (Merck, Darmstadt, Germany, Catalog No.: A6964) was added for digestion. The digested cells were collected for flow cytometry.

[0115] For the culture of dendritic cells, 100 ng / mL IL-4 needs to be added.

[0116] The experimental results are as follows Fig.12 , Fig.13 , Fig.14 As shown. Figure 12-14 As shown, under the same MOI (MOI=0.5 or 1) transfection conditions, the modified lentivirus has little effect on the viability of the cells. In addition, under MOI=1, the transfection efficiency of virus H on macrophages is 1.5-2 times that of the original virus. And under the same MOI (MOI=0.5 or 1) transfection, the average fluorescence intensity of GFP in GFP-positive macrophages after virus G and H transfection is much higher than the average fluorescence intensity of the original virus transfection (8-10 times). This shows that the modified lentivirus increases the number of lentiviral copies in the cells. Similarly, when the modified virus was used to transfect dendritic cells cultured to day 7, at MOI=1, the transfection efficiency of virus H was twice that of virus A (18.1% vs 9%), as shown in Fig.15 The average fluorescence intensity of dendritic cells transfected with virus H is also about 8-10 times that of untransformed viruses A, E, and F. Fig.16 Compared with macrophages, the transfection efficiency of dendritic cells by modified viruses is improved, but under the same conditions, the transfection efficiency is only half of that of macrophages.

[0117] Example 8: Transfection of macrophages with modified virus H and dNTPs

[0118] The concentration of dNTPs in macrophages is about 20-50 nM, which is about the concentration of dividing CD4 + The concentration of dNTPs in T cells (1-5μM) is 50 to 100 times lower than that in T cells. This is because SAMHD-1 protein is highly expressed in macrophages, which degrades intracellular dNTPs (deoxyribonucleoside triphosphates) into dNs (deoxyribonucleosides). Since the concentration of dNTPs in macrophages is much lower than the Km value of reverse transcriptase in HIV-1 lentivirus, the transfection efficiency of lentivirus to macrophages is very low.

[0119] Add 2.5-10mM dNTPs to the culture medium of macrophages cultured on day 7. After 4 hours, replace the RPMI 1640 medium containing 10% autologous serum with serum-free RPMI 1640 medium, add virus H to the culture medium at MOI=1 or MOI=2, and add RPMI 1640 medium containing 10% autologous serum to terminate transfection after 6 hours. After culturing at 37°C for four days, detect the percentage of GFP-positive cells. Fig.17As shown, the addition of dNTPs can significantly increase the transfection efficiency of lentivirus in macrophages, increasing the viral transfection efficiency by 30-50%.

[0120] The present invention provides a modified lentivirus packaging system and a method for increasing the transfection efficiency of macrophages by using the system in combination with dNTPs. The vprmotif packaging element in the gag region of the lentivirus plasmid vector pMDLg is replaced with the VPX motif packaging element in SIVmac239, and a plasmid pVPX expressing VPX alone is constructed. When packaging the lentivirus, the amount of VPX in the virus can be adjusted by adjusting the ratio of the pVPX plasmid in the five-plasmid packaging system. In addition, before transfecting macrophages with lentivirus containing VPX, the macrophages are treated with dNTPs, and the transfection efficiency of the lentivirus to the macrophages can be increased by 3-4 times compared with the unmodified virus.

[0121] Example 9 Western blot experiment on cleavage efficiency of VPX and VSV-G fusion expression cleavage peptide

[0122] In the virus verification experiment, the titers of A, D, and E viruses are as follows: Figure 7 shown.

[0123] The titers of viruses A, D, and E are: 5.16×10 7 TU / mL, 3.68×10 7 TU / mL, 4.12×10 7 TU / mL. To understand the cleavage efficiency of the cleavage peptide in the fusion protein Flag-VPX-VSV-G, Western blotting experiments were performed on the above viruses, and anti-flag antibodies were used to detect the expression of VPX in viruses A, D, and E. The results are shown in Fig.18 As shown. No anti-flag positive band was detected in the unmodified virus A, and both viruses D and E had anti-flag positive bands at 35kDa. However, in addition to the target band at 35kDa, virus D also had more than one anti-flag positive protein band at 100-180kDa. The target protein Flag-VPX band size is about 32kDa, while the uncut protein band Flag-VPX-VSV-G band size is about 160kDa. This shows that VPX is expressed by fusion with VSV-G through the T2A cleavage peptide, and the virus may cause a certain loss of virus titer due to incomplete cleavage of the T2A cleavage peptide. Expressing VPX alone can overcome the problem of decreased virus titer caused by cleavage of the cleavage peptide.

[0124] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A lentiviral packaging system, characterized in that: Includes the following five plasmids: pCDH-EF1-GFP-kana, pMDLg-vpxmotif, pMD2.G, pVPX, and pRSV; Among them, plasmids pCDH-EF1-GFP-kana, pMD2.G, and pRSV are from the HIV-1 lentiviral packaging system; Plasmid pMDLg-vpx motif is a viral packaging plasmid capable of packaging VPX formed by replacing the nucleotide sequence encoding amino acids 459-473 of Gag protein in plasmid pMDLg with a nucleotide sequence encoding amino acids shown in SEQ ID NO: 1; Plasmid pVPX is an expression plasmid of SIV mac 239 virus VPX with pMD2.G plasmid as the backbone.

2. The lentiviral packaging system according to claim 1, characterized in that The nucleotide sequence of plasmid pMDLg-vpx motif is shown in SEQ ID NO:13, and the nucleotide sequence of plasmid pVPX is shown in SEQ ID NO:

14.

3. The lentiviral packaging system according to claim 1 or 2, characterized in that: The mass ratio of plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX and pRSV is 4:(3-6):1:1:(1-3).

4. The lentiviral packaging system according to claim 3, characterized in that: The mass ratios of plasmids pCDH-EF1-GFP-kana, pMDLg-vpx motif, pMD2.G, pVPX and pRSV are 4:3:1:1:3, 4:6:1:1:3, 4:3:1:1:3, 4:6:1:1:

3.

5. Any of the following uses of the lentiviral packaging system according to any one of claims 1 to 4: 1) For the preparation of cell therapy drugs; 2) Used for the transformation of mononuclear cells and immune cells.

6. The use according to claim 5, characterized in that: The immune cells include monocytes, macrophages, and dendritic cells.

7. A method for improving macrophage transfection efficiency, characterized in that: The method comprises: after pre-treatment with dNTPs, macrophages are transfected with the lentiviral packaging system according to any one of claims 1 to 4.

8. The method according to claim 7, characterized in that 2.5-10 mM dNTPs were added to the macrophage culture medium, and after incubation for 2-6 hours, the lentiviral packaging system was added to the culture medium at an MOI of 1-2 for transfection.

Images