Novel recombinant herpes simplex virus and application of novel recombinant herpes simplex virus to detection of leukocyte subpopulation with high TERT expression

Abstract

The invention relates to a novel recombinant herpes simplex virus and application of the novel recombinant herpes simplex virus to detection of a leukocyte subset with high TERT expression. Specifically, the invention relates to a recombinant herpes simplex virus, application of the recombinant herpes simplex virus in a method for detecting leukocytes expressing TERT in peripheral blood and / or evaluating the immune senescence state of human peripheral blood, and a method for detecting leukocytes expressing TERT in peripheral blood and / or evaluating the immune senescence state of human peripheral blood.

Description

Technical Field

[0001] The invention relates to a method for detecting a peripheral blood telomerase activity immune cell subpopulation, comprising a novel recombinant herpes simplex virus used for the detection, wherein the virus is characterized in that it targets a leukocyte subpopulation with high expression of TERT in CD45 positive leukocytes. Background Art

[0002] The proliferation capacity of immune cells decreases with age, which has a serious impact on the body's immune function and is also an important reason for the increase in the incidence of tumor diseases in the elderly. The proliferation of immune cells helps to enhance the activity of immune cells, thereby inducing effective anti-tumor immunity and inhibiting the progression of tumor diseases. Telomere shortening and decreased telomerase activity are important factors that significantly affect the proliferation and immune response function of immune cells, and are also prominent features of their aging. In T cells, the telomerase activity of terminally differentiated memory T cells decreases, and the cells enter a senescent state, while the telomere length and telomerase activity of natural T cells and activated T cells are at a high level (see Qian, Y., L. Yang and S. Cao, Telomeres and telomerase in T cells of tumor immunity. Cell Immunol, 2014. 289 (1-2): p. 63-9). In 85%-90% of tumor cells, telomere extension is achieved by activating telomerase, and the remaining 10%-15% is completed by the alternative lengthening of telomeres (ALT) pathway. Telomerase is a reverse transcriptase composed of an RNA template, a catalytic subunit, telomerase reverse transcriptase (TERT), and other related proteins. The RNA template is ubiquitously expressed in various human cells, but the TERT gene is strictly inhibited in most human somatic cells, resulting in telomerase silencing. Therefore, TERT is the rate-limiting determinant of telomerase activity.

[0003] Immune cells with high TERT expression have high telomerase activity and long telomere length, representing a subpopulation of immune cells with high proliferation potential, which plays an important role in enhancing immune response effects and maintaining immune memory function. Studies have shown that in centenarians, T cells have higher telomerase activity and stronger immune response functions. Enhancing telomerase activity can improve T cell function in the elderly. Many studies have found that shortened telomere length of immune cells is closely related to the prognosis of various infectious diseases and aging-related diseases, and immune cells with short telomeres are significantly associated with the incidence of malignant tumors. In lung cancer, Jeon et al. found that the telomerase activity of peripheral blood mononuclear cells of patients was significantly lower than that of healthy controls, and compared with people with high telomerase activity, people with low telomerase activity had a significantly increased risk of lung cancer (see Jeon, HS, et al., Telomerase activity and the risk of lung cancer. J Korean Med Sci, 2012. 27 (2): p. 141-5). Studies have shown that compared with young patients, the tumor immune microenvironment of elderly patients is in a more severe immunosuppressive state, which suggests that TERT-positive leukocytes may also reflect the immune aging state of the peripheral blood of tumor patients.

[0004] The concept of immunosenescence was first proposed by Walford in 1964 (see WALFORD, RL, THE IMMUNOLOGIC THEORY OF AGING. Gerontologist, 1964.4: p.195-7). Its core characteristics include the decline of the immune response ability of the immune system to exogenous and exogenous antigens, the loss of reactivity to new antigens, the weakening of immune protection, and the sluggish immune memory response. Existing methods for immune detection of aging are mainly based on cell cycle arrest, telomere shortening, senescence-associated secretory phenotype (SASP), SA-β-galactosidase activity, and a variety of immune cell surface markers. Senescent immune cells are detected by flow cytometry, fluorescence in situ hybridization (FISH), ddTRAP and other methods. However, there is currently no unified method for detecting TERT-positive immune cell subpopulations in human peripheral blood at home and abroad. The existing immune aging detection methods have certain limitations in clinical applications and lack uniformity and operability. Therefore, it is of great significance to explore a peripheral blood TERT-positive cell detection method that meets clinical needs.

[0005] Herpes simplex virus (HSV) can be used in tumor treatment based on its oncolytic properties. It can be improved by replacing tumor-specific promoters, removing neurotoxic ICP34.5 and ICP47 genes, and inserting fluorescent protein expression cassettes, so that HSV can effectively select HSV to replicate only in tumor cells without harming normal cells, thus achieving the labeling and detection of tumor cells. As an important part of resisting tumor diseases, the immune system will experience immune aging as people age. How to specifically label immune cells by modifying herpes simplex virus to achieve immune aging detection and evaluation is another key topic for technicians in this field.

[0006] Telomeres are special structures at the ends of eukaryotic chromosomes. Their function is to maintain the stability of chromosome structure, prevent chromosome end fusion, protect chromosome structural genes and avoid the loss of genetic information during replication. Telomerase is a reverse transcriptase composed of small molecule RNA and protein. It can use its own RNA as a template to synthesize telomeric DNA to make up for the telomeres that gradually shorten with cell mitosis. Telomerase has three main components: human telomerase RNA (human telomerase RNA, hTR), telomerase-associated protein (telomerase-associated protein, TP1 / TLP1), and human telomerase reverse transcriptase (human telomerase reverse transcriptase, hTERT). Among them, hTR is expressed in most cells, while hTERT is the rate-limiting component of telomerase, which is only expressed in telomerase-positive cells and is related to telomerase activity.

[0007] Telomerase activity is associated with immune aging, and telomere shortening plays a key role in immune aging. Decreased telomerase activity affects the proliferation of immune cells and causes immune cell aging. Immune cells with reduced telomerase activity or shortened telomeres are associated with a variety of age-related diseases. With age, telomerase activity in immune cells gradually decreases, while enhancing telomerase activity can improve T cell function in the elderly and have stronger proliferation capacity. Therefore, telomerase plays an important role in the immune aging process, and human leukocyte common antigen CD45 is expressed on all leukocytes. Based on this, the level of immune aging can be assessed by detecting CD45-positive immune cells with TERT activity.

[0008] The infected cell proteins (ICP) expressed by herpes simplex virus are divided into three levels: immediate early (IE), early (early) and late (late). Among them, IE protein is the key protein that affects viral replication, including: ICP0, ICP4, ICP22, ICP27 and ICP47, and ICP4 is the most critical replication-related protein. The ICP34.5 gene is the neurotoxic gene of HSV1. Deleting this gene makes the virus safer. A variety of tumor-specific promoters have been discovered. According to their characteristics, they can be divided into pan-tumor-specific promoters, tissue-specific promoters and promoters specific to certain tumors. Among them, pan-tumor-specific promoters include hTERT promoter, survivin promoter, etc. These tumor-specific promoters have been widely used in tumor gene therapy and tumor diagnosis.

[0009] If the ICP4 promoter is replaced with the human CD45 promoter, and the human TERT promoter is inserted at the position where ICP34.5 is knocked out, the expression of the green fluorescent protein eGFP is initiated, so that the new recombinant herpes simplex virus can only express its early replication protein ICP4 in immune cells that express CD45 and highly express TERT, thereby replicating and proliferating, and specifically marking, it is expected to solve the technical difficulties in detecting immune aging. Summary of the invention

[0010] At present, there is no unified and clear method for detecting TERT-positive leukocyte subpopulations in human peripheral blood at home and abroad. In order to overcome the limitations of existing methods in clinical applications, lack of uniformity and operability, etc., the present invention is specially proposed.

[0011] The present invention transforms a recombinant herpes simplex virus, which can selectively grow and reproduce in leukocytes with high TERT activity and express green fluorescent protein, thereby realizing the detection of TERT-positive leukocyte subpopulations.

[0012] The present invention develops a TERT-positive leukocyte detection method that meets clinical needs, has the advantages of real-time monitoring and low price, is of great significance for the evaluation of peripheral blood immune proliferation capacity and aging status, provides a new method for monitoring immune function, and has important clinical application value.

[0013] The present invention provides a method for detecting TERT-high-expressing leukocyte subpopulations in human peripheral blood, and realizes the detection of TERT-positive leukocyte subpopulations in peripheral blood by constructing a CD45-positive cell-specific novel recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP. The recombinant virus mainly replaces the ICP4 gene promoter in the herpes simplex virus genome containing the ICP4 gene with the human leukocyte common antigen CD45 promoter, and uses the human telomerase reverse transcriptase promoter (hTERTp) to start the expression of green fluorescent protein eGFP at the ICP34.5 site, so that the modified herpes simplex virus can more effectively and selectively grow and reproduce in human TERT-high-expressing immune cells, but not in other cells, thereby more effectively, quickly, accurately, sensitively and widely realizing the detection and evaluation of peripheral blood immune aging.

[0014] In a first aspect, the present invention provides a method for detecting leukocytes expressing TERT in peripheral blood, the method comprising:

[0015] i) obtaining isolated peripheral blood leukocytes; and

[0016] ii) incubating the leukocytes in step i) with an expression vector; wherein the expression vector comprises eGFP operably linked to a human telomerase promoter (hTERTp); and the expression vector further comprises a CD45 promoter;

[0017] The leukocytes are incubated with the expression vector for a period of time to allow eGFP to be expressed.

[0018] In a specific embodiment, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector;

[0019] More preferably, the expression vector is a viral expression vector or a plasmid.

[0020] In specific embodiments, the viral expression vector is a herpes simplex virus, an adenovirus, a poxvirus, an influenza virus, or an adeno-associated virus.

[0021] In a second aspect, the present invention provides a method for detecting leukocytes expressing TERT in peripheral blood, the method comprising:

[0022] i) obtaining isolated peripheral blood leukocytes; and

[0023] ii) incubating the leukocytes in step i) with a recombinant herpes simplex virus; wherein the ICP4 gene promoter in the recombinant herpes simplex virus is replaced by a human CD45 promoter, and the ICP34.5 in the recombinant herpes simplex virus is replaced by eGFP operably linked to a human telomerase promoter (hTERTp).

[0024] In a specific embodiment, the human CD45 promoter is as shown in SEQ ID NO:1.

[0025] In a specific embodiment, the hTERTp is as shown in SEQ ID NO:2.

[0026] In a specific embodiment, the recombinant herpes simplex virus has a structure as shown in HSV1-CD45p-ICP4-hTERTp-eGFP, wherein

[0027] HSV1 means herpes simplex virus type 1;

[0028] CD45p indicates the human CD45 promoter, which replaces the ICP4 promoter in the wild-type HSV1 genome;

[0029] hTERTp represents human telomerase promoter; it is operably linked to eGFP and can control the expression of eGFP; and

[0030] The ICP34.5 gene in the recombinant herpes simplex virus is knocked out and replaced with hTERTp-eGFP.

[0031] In a specific embodiment, the method provided by the present invention for detecting leukocytes expressing TERT in peripheral blood further comprises:

[0032] iii) a step of analyzing the ratio of TERT-expressing leukocytes using flow cytometry.

[0033] In a specific embodiment, peripheral blood leukocytes are obtained by the following steps:

[0034] ia) collecting peripheral blood samples;

[0035] ib) lysing red blood cells; and

[0036] ic) Centrifuge to obtain a leukocyte pellet.

[0037] In a specific embodiment of the method of the present invention, in step ii), the leukocytes are combined with the recombinant herpes simplex virus at MOI=1 in serum-free RPMI 1640 medium and incubated at 37° C., 5% CO 2 for 1 h; and

[0038] Supplement with RPMI 1640 complete medium containing 10% FBS and continue incubation for 16-24 h.

[0039] In a specific embodiment of the method of the present invention, the recombinant herpes simplex virus can specifically replicate in CD45-positive cells with high TERT promoter transcription activity and express green fluorescent protein.

[0040] In a third aspect, the present invention provides a recombinant herpes simplex virus, wherein the ICP4 gene promoter in the recombinant herpes simplex virus is replaced by a human CD45 promoter, and the ICP34.5 in the recombinant herpes simplex virus is replaced by eGFP operably linked to a human telomerase promoter (hTERTp).

[0041] In a specific embodiment, the human CD45 promoter is as shown in SEQ ID NO:1.

[0042] In a specific embodiment, the hTERTp is as shown in SEQ ID NO: 2.

[0043] In a specific embodiment, the recombinant herpes simplex virus has a structure as shown in HSV1-CD45p-ICP4-hTERTp-eGFP, wherein

[0044] HSV1 means herpes simplex virus type 1;

[0045] CD45p indicates the human CD45 promoter, which replaces the ICP4 promoter in the wild-type HSV1 genome;

[0046] hTERTp represents human telomerase promoter; it is operably linked to eGFP and can control the expression of eGFP; and

[0047] The ICP34.5 gene in the recombinant herpes simplex virus is knocked out and replaced with hTERTp-eGFP.

[0048] In the fourth invention, the present invention provides a method for preparing a recombinant herpes simplex virus, the method comprising the following steps:

[0049] i) providing a plasmid comprising CD45p as shown in SEQ ID NO: 1;

[0050] ii) constructing a plasmid containing CD45p-ICP4 using the plasmid in step i);

[0051] iii) using the plasmid in step ii) to construct a recombinant virus HSV1-CD45p containing CD45p, wherein CD45p replaces the ICP4 promoter in the wild-type HSV1 genome;

[0052] iv) providing a plasmid containing hTERTp-eGFP, wherein the plasmid contains flanking sequences at both ends of the ICP34.5 gene to assist homologous recombination of the exogenous gene into the ICP34.5 position of the viral genome;

[0053] Wherein, the hTERTp is shown as SEQ ID NO: 2; the eGFP is shown as SEQ ID NO: 3; and

[0054] v) allowing the recombinant virus HSV1-CD45p obtained in step iii) to infect M49 cells and extract the viral genome; transfecting M49 cells with the HSV1-CD45p viral genome and the plasmid obtained in step iv) to obtain the recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP through homologous recombination.

[0055] In a specific embodiment, the method for preparing a recombinant herpes simplex virus of the present invention comprises the following steps:

[0056] i) constructing a PUC57 vector plasmid containing CD45p; wherein the CD45p is as shown in SEQ ID NO: 1;

[0057] ii) constructing plasmid pdICP4-CD45p-ICP4; wherein the CD45p in step i) is cut out using EcoRI and AvrII, and inserted into the plasmid pdICP4-hTERTp-ICP4, replacing the hTERTp in the plasmid, to obtain the plasmid pdICP4-CD45p-ICP4;

[0058] iii) knocking out hTERTp in the HSV1 viral genome and inserting CD45p to construct the intermediate virus HSV1-CD45p;

[0059] iv) constructing plasmid pdICP34.5-hTERTp-GFP-ICP34.5;

[0060] v) constructing the target final virus HSV1-CD45p-ICP4-hTERTp-eGFP; wherein,

[0061] a: Infect M49 cells with the recombinant virus HSV1-CD45p obtained in step iii) and extract the viral genome;

[0062] b: The HSV1-CD45p viral genome and the plasmid pdICP34.5-hTERTp-eGFP-ICP34.5 obtained in step iv) are co-transfected into M49 cells. After homologous recombination, the vacant ICP34.5 position of the HSV1-CD45p virus will be replaced by the hTERTp-eGFP expression cassette of pdICP34.5-hTERTp-eGFP-ICP34.5, so that the plaques of the recombinant virus emit green fluorescence. After several rounds of plaque purification, the green plaques are selected and purified to obtain the recombinant virus HSV1-CD45p-ICP4-hTERTp-eGFP.

[0063] In a fifth aspect, the present invention provides use of the recombinant herpes simplex virus of the present invention in the preparation of a kit for detecting TERT-expressing leukocytes in peripheral blood and / or evaluating the immune aging state of human peripheral blood.

[0064] In a sixth aspect, the present invention provides a method for evaluating the immune aging state of human peripheral blood, the method comprising the following steps:

[0065] i) Collect peripheral blood samples;

[0066] ii) lysis of red blood cells;

[0067] iii) centrifugation to obtain a leukocyte pellet;

[0068] iv) mixing the leukocytes from step iii) with the recombinant herpes simplex virus of the present invention in serum-free RPMI 1640 medium, and incubating at 37° C. and 5% CO 2 for 1 hour;

[0069] v) supplementing with RPMI 1640 complete medium containing 10% FBS and continuing incubation for 16-24 hours; and

[0070] vi) Analyze the ratio of TERT-expressing leukocytes using flow cytometry. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 :Basic process of detecting TERT-positive leukocytes in peripheral blood by HSV1-CD45p-ICP4-hTERTp-eGFP virus;

[0072] Figure 2 : GFP expression in the treated peripheral blood samples 24 h after infection with HSV1-CD45p-ICP4-hTERTp-eGFP virus (100×), red arrows indicate TERT-positive leukocytes;

[0073] Figure 3 : Schematic diagram of the sample flow cytometry result analysis process. The FITC-A positive gate is the TERT high positive cell subpopulation.

[0074] Figure 4 : PCR electrophoresis results using primers specific for TERTp and CD45p; wherein, 1. marker; 2. blank control; 3. HSV1-CD45p-ICP4-hTERTp-eGFP; 4, HSV1-hTERTp-eGFP (control virus); 5. blank control; 6. HSV1-CD45p-ICP4-hTERTp-eGFP; 7, HSV1-hTERTp-eGFP (control virus).

[0075] Figure 5 Shows the detection of TERT-positive cells in human peripheral blood using viruses with different structures.

[0076] Figure 6 The correlation between TERT expression level in peripheral blood leukocytes and age was shown.

[0077] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying detailed conditions are usually carried out under conventional conditions. DETAILED DESCRIPTION

[0078] The present invention mainly replaces the ICP4 gene promoter in the herpes simplex virus genome containing the ICP4 gene with the human leukocyte common antigen CD45 promoter, and uses the human telomerase reverse transcriptase promoter (hTERTp) at the ICP34.5 site to start the expression of green fluorescent protein eGFP, so that the modified herpes simplex virus can more effectively and selectively grow and reproduce in immune cells with high expression of human TERT, but not in other cells.

[0079] Example 1. Construction of a novel recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP

[0080] A new CD45-positive cell-specific recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP was constructed to detect TERT-positive leukocyte subsets. The recombinant herpes simplex virus is characterized in that the ICP4 gene promoter in the herpes simplex virus genome containing the ICP4 gene is replaced with the human leukocyte common antigen CD45 promoter, and the human telomerase reverse transcriptase promoter (hTERTp) is used at the ICP34.5 site to start the expression of the green fluorescent protein eGFP, so that the modified virus can more effectively and selectively grow and reproduce in immune cells with high expression of human TERT, but not in other cells.

[0081] 1.1 Construction of PUC57 vector plasmid containing CD45p

[0082] The core promoter sequence of human leukocyte common antigen CD45 was cloned into the PUC57 vector, and the restriction site EcoRI (GAATTC) was inserted into the 5' end of CD45p; the restriction site AvrII (CCTAGG) was inserted into the 3' end.

[0083] The CD45 core promoter sequence is as follows (896 bp):

[0084] GCCAAGAACATCTTAAGTCACAGAAACATTAGTTTTTGGAAGCAGGGTTTGCTGTAACTATAGTAGAAATGACATTCTGATTCCACTCCTAGCTTCACAAGGATATCTGTGAAAGATTTGGGGCAAAACTGTTAAGCTGTCTGAAAGTGCTTTTGCATAAGAAATGGGTTTTACTGCTAAAACTGTCATATTGCTGAGTTTTGAATGCCCTAATGGTAAATGATACTGGGTTGCCAAAAATAACCAGATTAGTAGTTTTTTCATTCATTTGGCCGTCTCAGTAAGTCAAATATTGATACTTTCTACTAAGTCATCTTGCCAACACCCATTTTGTTATACTTATGCTGAATCTGTTTGTCATCTCTTAAGTAAGAAAATTATTGATTATTTTGTGGGGATTTAATTTAAAAAAAATGGTAATGGATACTGTAAAGGAGCATTATTTGGATGGTTTAAAAACATCTTCCTTGATGGGAAAATCTTTTAAAAGGCTTTCTAACTTGGTGTAATTACTTGAATTAAGGAAGTGCAATGCCATTCTACTGACTTAGAACAACTTTTTTGACTTCCTGCAAAGAGGACCCTTACAGTATTTTTGGAGAAGTTAGTAAAACCGAATCTGACATCATCACCTAGCAGTTCATGCAGCTAGCAAGTGGTTTGTTCTTAGGGTAACAGAGGAGGAAATTGTTCCTCGTCTGATAAGACAACAGTGGAGAgtatgcatttatttatttacttttacatttttgattcgtttttacagagaaaaacttctacagagataacaattattttgcttttcagAAGGACGCATGCTGTTTCTTAGGGACACGGCTGACTTCCAGATATGACC SEQ ID NO:1

[0085] 1.2 Construction of plasmid pdICP4-CD45p-ICP4

[0086] Based on the original plasmid pdICP4-hTERTp-ICP4, modifications were made

[0087] a: The human telomerase reverse transcriptase promoter hTERTp in the pdICP4-hTERTp-ICP4 (constructed in the laboratory of the inventor) plasmid was cut out using EcoRI and AvrII, and the restriction plasmid was verified by agarose gel electrophoresis, and the linear plasmid fragment of about 10,000 bp was cut out and recovered;

[0088] b: CD45p from the pUC57 plasmid carrying the CD45 core promoter sequence was cut out using EcoRI and AvrII, and the CD45p sequence of about 900 bp was recovered;

[0089] c: The linear vector plasmid and CD45p obtained in the above two steps were connected using T4 ligase to construct pdICP4-CD45p-ICP4, and then sequenced and identified.

[0090] 1.3 Eliminate hTERTp from the viral genome and insert CD45p to construct the intermediate virus HSV1-CD45p

[0091] Based on the constructed knockout plasmid PX459-ghTERTp-Cas9 targeting TERT, the knockout plasmid PX459-gGFP-Cas9 targeting GFP, the shuttle plasmid pdICP4-CMVp-eGFP-ICP4, and the frozen HSV1-hTERTp virus, the hTERTp at the flanking gene position of the viral ICP4 was modified:

[0092] a: HSV1-hTERTp virus infected M49 cells to amplify the viral genome. When 95% of the cells were observed to be lesions under a microscope, the viral genome DNA was extracted;

[0093] b: The HSV1-hTERTp viral genome, shuttle plasmid pdICP4-CMVp-eGFP-ICP4, and Cas9 knockout plasmid PX459-ghTERTp-Cas9 targeting TERT were co-transfected into M49 cells. After homologous recombination, the green fluorescent protein expression cassette of the shuttle plasmid pdICP4-CMVp-eGFP-ICP4 replaced the hTERTp of HSV1-hTERTp, making the plaques of the recombinant virus emit green fluorescence. After several rounds of plaque purification, the green fluorescent plaques were selected and the recombinant virus HSV1-CMVp-eGFP was purified;

[0094] c: M49 cells were infected with HSV1-CMVp-eGFP virus and viral genomic DNA was extracted;

[0095] d: The HSV1-CMVp-eGFP viral genome, shuttle plasmid pdICP4-CD45p-ICP4 and GFP-targeted Cas9 knockout plasmid PX459-gGFPp-Cas9 were co-transfected into M49 cells; through homologous recombination, the CD45p-ICP4 expression cassette of the shuttle plasmid pdICP4-CD45p-ICP4 replaced the green fluorescent protein expression cassette of the recombinant virus HSV1-CMVp-eGFP, making the newly recombinant plaques non-fluorescent. After several rounds of plaque purification, non-fluorescent plaques were selected and the recombinant virus HSV1-CD45p was purified.

[0096] 1.4 Construction of plasmid pdICP34.5-hTERTp-GFP-ICP34.5

[0097] It is based on the basic shuttle plasmid pd34.5_NEN, which contains flanking sequences at both ends of the ICP34.5 gene, which can assist the homologous recombination of foreign genes into the ICP34.5 position of the viral genome.

[0098] The core promoter sequence of human telomerase reverse transcriptase hTERTp is as follows (470 bp):

[0099] tcgcgagtttaaactggcccctccctcgggttaccccacagcctaggccgattcgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgg gcggggaagcgcggcccagaccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagtggaacgcgggcacagacgcccaggaccgcgctccccacgtggcg gagggactggggacccgggcacccgtcctgccccttcacttccagctccgcctcctccgcgcggaccccgccccgtccgacccctcccgggtccccggcccagccccctccgggccc tcccagcccctccccttcctttccgcggccccgccctctcctcgcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccgcgaagc SEQ ID NO: 2

[0100] The sequence of enhanced green fluorescent protein eGFP is as follows (798 bp):

[0101] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGAGCTGCGGCCGCTGCCGCTGCGGCAGCGGCCGAATTCCCCGGGCTCGAGAAGCTTGGATCCACCGGATCTTAGATAA SEQ ID NO:3

[0102] a: Clone the hTERTp and eGFP sequences into the PUC57 plasmid, insert the restriction enzyme site Nrul at the 5' end of hTERTp, and insert the restriction enzyme site PvuII at the 3' end of eGFP;

[0103] b: The PUC57 plasmid loaded with the hTERTp-eGFP sequence was double-digested using Nrul and PvuII enzymes, and the digested plasmid was verified by agarose gel electrophoresis, and the hTERTp-eGFP sequence was recovered by gel excision;

[0104] c: pd34.5_NEN was digested with AfeI (blunt-end restriction endonuclease), and then the 5' phosphate group was removed with alkaline phosphatase SAP. The linear fragment was purified with Tiangen plasmid mini kit for later use;

[0105] d: The purified hTERTp-eGFP linear fragment was connected with the pd34.5_NEN linear fragment to construct the plasmid pdICP34.5-hTERTp-eGFP-ICP34.5.

[0106] 1.5 Construction of target final virus: HSV1-CD45p-ICP4-hTERTp-eGFP

[0107] a: Infect M49 cells with the recombinant virus HSV1-CD45p obtained in step 3 and extract the viral genome;

[0108] b: The HSV1-CD45p viral genome and the plasmid pdICP34.5-hTERTp-eGFP-ICP34.5 obtained in step 4 were co-transfected into M49 cells. After homologous recombination, the vacant ICP34.5 position of the HSV1-CD45p virus would be replaced by the hTERTp-eGFP expression cassette of pdICP34.5-hTERTp-eGFP-ICP34.5, causing the plaques of the recombinant virus to emit green fluorescence. After several rounds of plaque purification, the green plaques were selected and purified to obtain the recombinant virus HSV1-CD45p-ICP4-hTERTp-eGFP.

[0109] 1.6 Verify the obtained recombinant virus structure:

[0110] Using primers specific for TERTp and CD45p, we verified the structure of the obtained target final virus. Figure 4 As shown. The control virus HSV1-hTERTp-eGFP used in this experiment, see Xie Peipei, Zhang Qi, Zhang Xiaoli, Wan Duo, Zhang Wen, Cheng Shujun, Zhang Kaitai. Establishment of a method for detecting telomerase reverse transcriptase-positive leukocytes in peripheral blood of patients with primary lung adenocarcinoma[J]. Carcinogenesis, Teratogenesis and Mutation, 2024, 36(6): 431-437,443.

[0111] exist Figure 4 In 1, 2, and 3, TERTp primers were used for PCR identification, and the results showed that TERTp was present in both the modified virus and the control virus;

[0112] 4, 5, and 6 are PCR identifications using primers for CD45p, and the results show that CD45p is present only in the modified virus.

[0113] Example 2. Detection of TERT-positive cells in human peripheral blood

[0114] Based on the modified recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP, the present invention has developed a new method for detecting TERT-positive leukocytes in peripheral blood. By starting the expression of green fluorescent protein (GFP) in cells with a TERT promoter transcription environment, replication and proliferation can be achieved only in CD45-positive leukocytes with high TERT expression and marking with green fluorescence, thereby detecting leukocyte subpopulations with high terminase activity in the peripheral blood, thereby effectively evaluating the immune proliferation capacity and immune response status of the peripheral blood of tumor patients, and reflecting the immune aging of the body's peripheral blood.

[0115] The modified HSV1-CD45p-ICP4-hTERTp-eGFP recombinant virus can specifically replicate in leukocytes with high TERT promoter transcription activity and express green fluorescent protein. Using this feature, we can effectively mark immune cells with high TERT expression in peripheral blood.

[0116] Use K2-EDTA anticoagulant tubes to collect 4 ml of human peripheral blood specimens, transport them on ice, and process them within 12 hours; observe for abnormalities such as hemolysis and coagulation; use red blood cell lysis buffer to lyse red blood cells at a ratio of 1:10 (red blood cells: lysis buffer); add PBS to wash the cells after centrifugation, then use serum-free RPMI 1640 medium to resuspend the white blood cell pellet, add HSV1-CD45p-ICP4-hTERTp-eGFP recombinant virus according to MOI=1, incubate at 37°C, 5% CO2 for 1 hour, supplement with RPMI 1640 complete medium containing 10% FBS to terminate the tool virus infection; after continuing to incubate for 16-24 hours, green fluorescent cells can be observed under a fluorescence microscope, which are immune cells with high expression of virus-labeled TERT. After collecting the cells and centrifuging them, the supernatant culture medium was discarded. After resuspending them in PBS, TERT-positive leukocytes were detected using a Canto II flow cytometer. The percentage of FITC-positive gate in all leukocytes was analyzed, which was the percentage of TERT-positive leukocytes. The peripheral blood immune proliferation and immune reserve capacity were evaluated, which reflected the immune aging status of human peripheral blood to a certain extent.

[0117] Specifically, the flow chart for detecting TERT-positive cells in human peripheral blood is as follows: Figure 1 shown.

[0118] Testing steps:

[0119] 1. Collect 1 mL of fresh peripheral blood using EDTA purple anticoagulant tubes, store at 4°C, and send to the laboratory for processing within 2 hours. Avoid shock during transportation to avoid affecting the status of blood cells;

[0120] 2. Check the specimen quality and conduct follow-up treatment after finding no abnormal conditions such as hemolysis or coagulation;

[0121] 3. Preparation of treatment reagents: Take out the test virus HSV1-CD45p-ICP4-hTERTp-eGFP from the -80°C refrigerator, place it in a 4°C refrigerator to slowly thaw, then take out the test virus, RPMI 1640 medium, RPMI 1640 complete medium containing 10% FBS, and PBS buffer and equilibrate at room temperature for 30 minutes;

[0122] 4. Balance the blood sample and centrifuge it at 600g for 4 minutes. The upper layer is plasma and the lower layer is whole blood cells (including red blood cells, white blood cells, etc.). Gently aspirate and discard the upper layer of plasma and keep the remaining blood cells.

[0123] 5. Use red blood cell lysis buffer (0.15M NH4Cl, 0.1mM EDTA, 10mM KHCO3; pH = 7.2) to lyse the red blood cells in the specimen at a ratio of 1:10 (red blood cells: lysis buffer). Add 5ml of filtered sterile red blood cell lysis buffer to a 15ml centrifuge tube and lyse for 8 minutes.

[0124] 6. After centrifugation at 600g for 4 minutes, discard the upper layer of lysis buffer, add 3 ml of sterile red blood cell lysis buffer again, pipette to mix the cell pellet, and continue lysis for 4 minutes;

[0125] 7. After centrifugation at 600g for 4 minutes, discard the upper lysate, add 5 ml of PBS buffer, pipette to mix the cell pellet, and centrifuge;

[0126] 8. After centrifugation, discard the upper liquid, leaving the cell pellet at the bottom of the tube, add 1 ml of RPMI 1640 medium, mix the test virus by pipetting, and calculate the number of white blood cells in 1 ml of peripheral blood to be about 4×10^6, according to MOI=1 (i.e., cell number: virus titer=1:1), add the test virus, gently resuspend the precipitated cells, transfer the cell suspension to a low-adsorption six-well plate, and culture it in a 5% CO2, 37°C incubator;

[0127] 9. After 1 hour, add 1 ml of RPMI 1640 complete medium containing 10% FBS to each well and continue culturing in a cell culture incubator for 16-24 hours;

[0128] 10. Gently blow the cells in the six-well plate, resuspend the cells thoroughly and transfer them to a 5 ml centrifuge tube. Centrifuge at 600 g for 4 minutes. The cell pellet at the bottom of the centrifuge tube can be seen. Discard the upper liquid, add 2 ml PBS buffer, gently resuspend and wash the cells, and centrifuge at 600 g for 4 minutes;

[0129] 11. Discard the upper layer of liquid, add 1 ml of PBS buffer, gently blow to resuspend the cells, and transfer them to the flow tube to prepare for the sample test;

[0130] 12. Turn on the Canto II flow cytometer, place the prepared sample into the loading area for detection, and analyze the percentage of FITC-positive gate in all white blood cells, which is the percentage of TERT-positive white blood cells.

[0131] The results are as follows Figure 2 and Figure 3 shown.

[0132] Figure 2 The modified virus was used to infect the peripheral blood of healthy volunteers, and the expression of GFP was observed under a fluorescence microscope. The results showed that a small amount of GFP green fluorescence was expressed in the peripheral blood of healthy people.

[0133] Figure 3 The modified virus was used to infect the peripheral blood of healthy volunteers, and the expression of GFP was detected by flow cytometry. The results showed that after virus treatment, white blood cells expressing GFP were present in the peripheral blood of healthy people.

[0134] The results show that the HSV1-CD45p-ICP4-hTERTp-eGFP recombinant virus of the present invention can effectively detect TERT-positive leukocytes in human peripheral blood.

[0135] Example 3. Detection of TERT-positive cells in human peripheral blood by viruses with different structures

[0136] Furthermore, the inventors compared the test of the same volunteer blood sample using virus vectors with different structures. The test scheme is the same as that of Example 2, and the results are as follows: Figure 5 shown.

[0137] Figure 5 In the figure, gray and red are control viruses, see "Xie Peipei, Zhang Qi, Zhang Xiaoli, Wan Duo, Zhang Wen, Cheng Shujun, Zhang Kaitai. Establishment of a method for detecting telomerase reverse transcriptase-positive leukocytes in peripheral blood of patients with primary lung adenocarcinoma [J]. Carcinogenesis, aberration and mutation, 2024, 36(6): 431-437, 443"; blue is the virus of the present invention.

[0138] The difference between gray and red is that when counting the proportion of GFP+ cells, gray counts the proportion of all GFP+ cells, and red counts the proportion of CD45+ and GFP+ cells. Because the control virus lacks the specific regulation of CD45+ leukocytes, the proportion of CD45+ / GFP+ cells is slightly lower than the proportion of GFP+ cells. Since the blue virus of the present invention is restricted by both CD45 and TERT, the proportion of GFP+ cells is basically the same as the proportion of CD45+ / GFP+ cells in the old virus, and both are lower than the proportion of GFP+ cells in the old virus.

[0139] Example 4. Correlation between TERT expression level in peripheral blood leukocytes and age

[0140] RNA sequencing was performed on peripheral blood leukocytes (CD45+ cells) of people of different ages, and the expression level of TERT was statistically analyzed. The results showed that the TERT expression level of CD45+ cells in the elderly was significantly lower than that in the young population, and the TERT expression level of CD45+ cells was negatively correlated with age. Figure 6 .

[0141] The experimental results of the present invention show that since ICP4 is a key gene for viral replication, the expression of ICP4 is a key restrictive protein for the virus to enter the replication cycle and express genes on the viral genome. In the wild type and other viral constructs, the expression of ICP4 is not limited to whether the host cell is an immune cell, that is, a leukocyte. In the present invention, by replacing the promoter of ICP4 with the promoter of CD45, the process of specific replication and proliferation of the modified virus in immune cells (leukocytes) is achieved. In addition, on this basis, the GFP protein regulated by the expression of the TERT promoter is further reconstructed at the ICP34.5 site. The new virus obtained on this basis expresses the tracer protein GFP. The new virus has dual limitations: 1) the host cell is a leukocyte; 2) the host leukocyte TERT is highly expressed. Our research results show that the proportion of leukocytes with high expression of TERT is significantly negatively correlated with age.

Claims

1. A method for detecting TERT-expressing leukocytes in peripheral blood, the method comprising: i) obtaining isolated peripheral blood leukocytes; and ii) incubating the leukocytes in step i) with an expression vector; wherein the expression vector comprises eGFP operably linked to a human telomerase promoter (hTERTp); and the expression vector further comprises a CD45 promoter; The leukocytes are incubated with the expression vector for a period of time to allow eGFP to be expressed; Preferably, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector; More preferably, the expression vector is a viral expression vector or a plasmid; Further preferably, the viral expression vector is herpes simplex virus, adenovirus, poxvirus, influenza virus, or adeno-associated virus.

2. The method according to claim 1, wherein the expression vector is a recombinant herpes simplex virus, the ICP4 gene promoter in the recombinant herpes simplex virus is replaced by a human CD45 promoter, and the ICP34.5 in the recombinant herpes simplex virus is replaced by eGFP operably linked to a human telomerase promoter (hTERTp), Preferably, the CD45 promoter is as shown in SEQ ID NO: 1; The hTERTp is shown in SEQ ID NO: 2; Preferably, the recombinant herpes simplex virus has a structure as shown in HSV1-CD45p-ICP4-hTERTp-eGFP.

3. The method according to claim 1 or 2, wherein the method further comprises: iii) a step of analyzing the ratio of TERT-expressing leukocytes using flow cytometry.

4. The method according to claim 1 or 2, wherein the peripheral blood leukocytes in step i) are obtained by the following steps: ia) collecting peripheral blood samples; ib) lysing red blood cells; and ic) Centrifuge to obtain a leukocyte pellet.

5. The method according to claim 2, wherein In step ii), the leukocytes are incubated with the recombinant herpes simplex virus at an MOI of 1 in serum-free RPMI 1640 medium at 37° C. and 5% CO 2 for 1 h; and Supplement with RPMI 1640 complete medium containing 10% FBS and continue incubation for 16-24h.

6. The method according to claim 2, wherein The recombinant herpes simplex virus can replicate specifically in CD45-positive cells with high TERT promoter transcriptional activity and express green fluorescent protein.

7. A recombinant herpes simplex virus, wherein the ICP4 gene promoter in the recombinant herpes simplex virus is replaced by a human CD45 promoter, and the ICP34.5 in the recombinant herpes simplex virus is replaced by eGFP operably linked to a human telomerase promoter (hTERTp), Preferably, the CD45 promoter is as shown in SEQ ID NO: 1; The hTERTp is shown in SEQ ID NO: 2; Preferably, the recombinant herpes simplex virus has a structure as shown in HSV1-CD45p-ICP4-hTERTp-eGFP.

8. A method for preparing the recombinant herpes simplex virus according to claim 7, comprising the following steps: i) providing a plasmid comprising CD45p as shown in SEQ ID NO: 1; ii) constructing a plasmid containing CD45p-ICP4 using the plasmid in step i); iii) using the plasmid in step ii) to construct a recombinant virus HSV1-CD45p containing CD45p, wherein CD45p replaces the ICP4 promoter in the wild-type HSV1 genome; iv) providing a plasmid containing hTERTp-eGFP, wherein the plasmid contains flanking sequences at both ends of the ICP34.5 gene to assist homologous recombination of the exogenous gene into the ICP34.5 position of the viral genome; Wherein, the hTERTp is shown as SEQ ID NO: 2; the eGFP is shown as SEQ ID NO: 3; and v) allowing the recombinant virus HSV1-CD45p obtained in step iii) to infect M49 cells and extract the viral genome; transfecting M49 cells with the HSV1-CD45p viral genome and the plasmid obtained in step iv) to obtain the recombinant herpes simplex virus HSV1-CD45p-ICP4-hTERTp-eGFP through homologous recombination.

9. Use of the recombinant herpes simplex virus according to claim 7 in the preparation of a kit for detecting TERT-expressing leukocytes in peripheral blood and / or evaluating the immune aging state of human peripheral blood.

10. A method for evaluating the immune aging state of human peripheral blood, the method comprising the following steps: i) Collect peripheral blood samples; ii) lysis of red blood cells; iii) centrifugation to obtain a leukocyte pellet; iv) mixing the leukocytes from step iii) with the recombinant herpes simplex virus of claim 7 in serum-free RPMI 1640 medium, and incubating at 37° C., 5% CO 2 for 1 h; v) supplementing with RPMI 1640 complete medium containing 10% FBS and continuing incubation for 16-24 hours; and vi) Analyze the ratio of TERT-expressing leukocytes using flow cytometry.

Images