Method for verifying cis-trans structures of adjacent SNP loci based on NGS platform
By designing PCR amplification and sequencing primers, the cistrans structure of mutant sites is judged using the sequencing peak chart of the NGS platform, and the problem of difficulty in verification when the distance between the mutant sites is greater than the length of sequencing reads in the prior art is solved, and fast and low-cost cistrans structure verification is achieved.
Patent Information
- Application Number
- CN202411857200.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-17
- Publication Date
- 2025-03-25
AI Technical Summary
It is difficult for existing NGS platforms to directly judge the cistrans structure of two mutation sites, especially when the distance between the mutation sites is greater than the length of a single sequencing read, other means are needed to assist in verification, but the existing methods are complex, time-consuming or costly.
PCR amplification primers and sequencing primers were designed, and the sequencing peak diagram of mutant bases was obtained through PCR amplification and sequencing reactions. The cis-trans structure of the two SNP sites was determined by comparing the height of the peak diagram.
A fast and low-cost method is provided to verify the cistrans structure of two mutation sites, reducing the experimental cycle and cost, and simple and intuitive operation.
Smart Images
Figure CN119685455A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene mutation detection, and in particular relates to a method for verifying the cis-trans structure of adjacent SNP sites based on an NGS platform. Background Art
[0002] In recent years, with the development of life sciences and gene sequencing technology, more and more people choose to use blood, saliva, tissue and other specimens for NGS sequencing. After NGS sequencing of the specimens, the testing center uses bioinformatics analysis and other means to analyze genetic information from a large amount of sequencing data, and then predict the possibility of an individual suffering from various diseases, and carry out prevention and treatment.
[0003] In the field of gene mutation detection, when the base positions of two mutations of the same gene are close and they are located on the same allele, they are cis mutations, and when they are located on different alleles, they are trans mutations. At present, some cis-trans mutations have been detected in patients, and their clinical significance cannot be ignored, which will directly affect the patient's medication regimen. For example: in the treatment of lung cancer, patients may develop drug resistance after using osimertinib, among which the EGFR C797S mutation has been identified as a drug-resistant mutation site for the third-generation EGFR TKI, and preclinical studies have found that if EGFR T790M and C797S are trans mutations, they are sensitive to the combination of first-generation and third-generation EGFR TKIs, and if they are cis mutations, they are resistant to all EGFR TKIs.
[0004] However, due to the limitation of the read length of the NGS platform, if the distance between the two mutation sites is greater than the read length of a single sequencing read, the cis-trans structure of the two mutations cannot be directly determined from the sequencing data, and other means are required for auxiliary verification. The existing methods for cis-trans structure verification are limited, mainly including gene cloning verification, ARMS-PCR, digital PCR, etc. Gene cloning refers to the simultaneous amplification of two mutation sites with one PCR reaction, and then the PCR product containing the two mutation sites is connected to the T vector (or other vector), and the successfully connected vector is transformed into a competent state. After cultivation, a single clone is picked, and the colony PCR is performed with the universal primer of the vector. The target band is subjected to Sanger sequencing for the expected product. The cis-trans is judged by whether the sequencing results of the same product contain two mutation sites. If both are included, it is cis, otherwise it is trans. The results of this scheme are accurate and reliable, but it takes a long time and the cost is relatively high. The principle of ARMS-PCR is mainly to use sequence-specific primers to selectively amplify the template to achieve the purpose of detecting gene mutations. It is simple to operate and has a short detection time, but the sensitivity is low. Digital PCR is an absolute quantification technology for nucleic acid molecules. It is based on single-molecule PCR for nucleic acid quantification. Currently, it mainly uses microfluidics or microdroplet methods to infer the nucleic acid concentration in the original solution based on the fluorescence signal intensity in the reactor. This method is costly and complex to operate. Summary of the invention
[0005] To solve the above problems, the present invention discloses a method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform, which solves the problem of complex verification of the cis-trans structure of adjacent SNP sites detected by the existing NGS platform.
[0006] To achieve the above object, the technical solution of the present invention is as follows: A detection method for verifying the cis-trans structure of adjacent SNP sites based on an NGS platform comprises the following steps: S1: Design PCR amplification primers according to the adjacent mutation sites annotated in the NGS sequencing data. After the PCR is completed, the product is subjected to agarose gel electrophoresis quality inspection to ensure that the size of the amplified product band is in line with expectations and the band is single.
[0007] Preferably, TaKaRa HS Taq is recommended for PCR amplification, which has good specificity, stable performance, strong versatility, and high cost performance. The specific amplification system and PCR program can be adjusted according to one's own needs.
[0008] Preferably, the adjacent mutation sites need to have clear RS numbers or coordinates, and the length should be within one Sanger sequencing reaction.
[0009] Preferably, the length of the amplification primer is generally about 20 bp, the annealing temperature is about 60° C., and it has no special structure, so as to ensure specific amplification.
[0010] S2: Design forward and reverse sequencing primers. Two pairs of sequencing primers are required to ensure that the first SNP site is located at the 3' end of the binding end of the sequencing primer and the template chain. The 3' end base of the first pair of primers is the same as the wild type, and the 3' end base of the second pair of primers is the same as the detected mutant.
[0011] Preferably, PAGE is recommended as the primer purification method, which has high electrophoresis resolution, high DNA purity and high loading capacity. The specific purification method can be selected according to one's own needs, including but not limited to PAGE, HAP, and DHLPC.
[0012] S3: Purification of PCR products: the PCR products obtained in step S1 were purified using the shrimp alkali enzyme method (SAP+ExoI), which was run at 37°C for 30 min and 80°C for 15 min.
[0013] S4: Sequencing reaction PCR amplification, performing sequencing reaction PCR amplification on step S3, the specific steps are as follows: S4-1: First, mix 3.5 μL of sequencing primer (1.5 μmol) and 1 μL of the product from step S3, run at 95°C for 5 min to denature the template, take the product out of the PCR instrument 30 s after the denaturation, and immediately put it in an ice bath to allow the sequencing primer to bind to the template; S4-2: After the ice bath, add 0.5 μL of diluted BDT (BigDye™ Terminator 3.1 ReadyReaction Mix, ABI), dilution ratio: BDT:5*seq buffer=1:1; S4-3: Perform sequencing reaction PCR, running the program at 95℃ for 30s, 50℃ for 5s, and 60℃ for 4min; S4-4: The above three steps are run for 25 cycles and maintained at 16°C after the program is completed.
[0014] S5: Perform ethanol precipitation on the PCR product of step S4. Add 2 μL 0.01mol / L EDTA to the product, centrifuge briefly, then add 15 μL anhydrous ethanol, centrifuge at 4000rpm, 4℃ for 40min to precipitate DNA. After the precipitation, discard the supernatant, add 70 μL 75% ice ethanol to rinse, centrifuge at 4000rpm for 15min, discard the supernatant, add 70 μL 75% ice ethanol to rinse again, centrifuge at 4000rpm for 15min, discard the supernatant, and let stand at room temperature for 10min until the ethanol evaporates completely.
[0015] S6: Add 10ul of formamide to the PCR product of step S5, denature at 95°C for 5min, and then quickly cool in an ice bath. Place the cooled product into a 3730 sequencer and perform capillary electrophoresis sequencing to obtain the original sequencing peak map.
[0016] S7. Determine the cis-trans structure. Analyze the sequencing peak graph of step S6, and determine the cis-trans structure of the two SNP sites by comparing the height of the base peak graph of the second mutation site: if the mutation base peak is high, the two SNPs are trans structures; conversely, if the mutation base peak is low, the two SNPs are cis structures.
[0017] The beneficial effects of the present invention are: (1) The present invention provides a method for rapidly verifying the cis-trans structures of two mutations, which greatly reduces the cost and shortens the experimental cycle.
[0018] (2) The cis-trans structure verification method provided by the present invention does not require a specific kit, and only requires the design and synthesis of PCR primers according to the scheme of the present invention, thereby reducing the reagent cost.
[0019] (3) The present invention determines the cis-trans structure of SNP through the sequencing peak diagram of the mutant base, which is simple, intuitive, clear and unambiguous. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Schematic diagram of an implementation scheme of the detection method of the present invention; Figure 2 This is the base peak diagram of the sequencing result of FLG-F in Example 3 of the present invention; Figure 3 This is the base peak diagram of the sequencing result of FLG-R in Example 3 of the present invention; Figure 4 This is the base peak diagram of the sequencing result of FLG-F2 in Example 3 of the present invention; Figure 5 This is the base peak diagram of the sequencing result of FLG-R2 in Example 3 of the present invention; Figure 6 This is the final amplification product sequence in Example 2 of the present invention. DETAILED DESCRIPTION
[0021] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. It should be understood that the following specific embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The materials, reagents, instruments, etc. used in the examples are all commercially available unless otherwise specified. It should be understood that the embodiments described herein are only a part of the embodiments of the present invention and are not intended to limit the present invention. Based on the embodiments of the present invention, all other embodiments of the changes or replacements of the experimental steps and conditions of the present invention belong to the protection scope of the present invention.
[0022] The definitions of the main abbreviations and key terms involved in the present invention are as follows: NGS: Next Generation Sequencing, also known as second-generation sequencing or high-throughput sequencing, is a technology that can perform parallel sequencing on a large number of nucleic acid molecules at one time; ARMS-PCR: Amplification Refractory Mutation System-Polymerase Chain Reaction, also known as allele-specific amplification, is a detection method based on the fact that Taq DNA polymerase cannot repair a single base mismatch at the 3' end of the primer, thereby hindering amplification; Sanger sequencing: also known as first-generation sequencing and dideoxy sequencing, is a method for determining the chain termination of DNA nucleotide sequences; rs number: reference SNP ID, a string of numbers to identify the variant site; PAGE purification: Polyacrylamide Gel Electrophoresis, polyacrylamide gel electrophoresis; HAP: High Affinity Purification, a new oligo DNA purification method independently developed by Sangon Biotechnology; DHLPC: Denaturing high performance liquid chromatography, denaturing high performance liquid chromatography technology; dNTP: deoxy-ribonucleoside triphosphate, deoxyribonucleoside triphosphate; Rpm: Revolutions per minute, which means the number of rotations of the device per minute; WT: Wild type, wild type; MT:Mutation type.
[0023] Example 1: Principle of verification of cis-trans structures of adjacent SNP sites based on NGS platform NGS sequencing was performed on the FLG gene, and two mutation sites, rs773818576[TTGT / -] and rs781362878[T / -], were detected simultaneously in the NGS data. The two mutation sites were 460 bp apart. Based on the original sequencing peak graph and the cloning verification method, the cis-trans structure of the two SNP sites was determined by comparing the height of the base peak graph of the second mutation site: if the mutation base peak was high, the two SNPs were in a trans structure; conversely, if the mutation base peak was low, the two SNPs were in a cis structure.
[0024] Example 2: A detection scheme for cis-trans structure verification of adjacent SNP sites based on NGS platform The specific steps of the detection scheme for cis-trans structure verification are as follows: S1: Design PCR amplification primers. According to the two mutation sites rs773818576[TTGT / -] and rs781362878[T / -] detected by NGS sequencing data of the FLG gene, amplification primers FLG-rs773818576-F and FLG-rs200519781-R were designed. After the PCR, the product was subjected to agarose gel electrophoresis quality inspection to ensure that the size of the amplified product band was in line with expectations and the band was single (see Table 1).
[0025] In the embodiments of the present invention, TaKaRa HS Taq is recommended for PCR amplification, which has good specificity, stable performance, strong versatility, and high cost performance. The specific amplification system and PCR program can be adjusted according to one's own needs.
[0026] In an embodiment of the present invention, the adjacent mutations have clear RS numbers or coordinates, and the length is within one reaction of Sanger sequencing.
[0027] In an embodiment of the present invention, the lengths of the amplification primers FLG-rs773818576-F and FLG-rs773818576-R are 19 bp and 20 bp, respectively, and the annealing temperatures are 62.1° C. and 60.8° C., respectively. They have no special structure and can ensure specific amplification.
[0028] S2: Design forward and reverse sequencing primers. A total of two pairs of primers need to be designed to ensure that the first SNP site is located at the binding end of the sequencing primer and the template chain (i.e., the 3' end). The 3' end base of the first pair of primers is the same as the wild type, and the 3' end base of the second pair of primers is the same as the detected mutant type. The first pair of sequencing primers are FLG-F and FLG-R, and the second pair of sequencing primers are FLG-F2 and FLG-R2 (see Table 1).
[0029] Table 1. Designed amplification primers and sequencing primers Primer name Primer sequences Primer properties FLG-rs773818576-F GTCCTGGACCCCGATGATT Amplification Primer F FLG-rs200519781-R AATCAGGAACTCCTCACGCA Amplification Primer R FLG-F AGCCGTCTCCTGATTGTTTGT WT sequencing primer F FLG-R TCCGCACGTGACTGGTCA WT sequencing primer R FLG-F2 GGAGCCGTCTCCTGATTGTCC MT sequencing primer F FLG-R2 TCCGCACGTGACTGGTCG MT sequencing primer R In the embodiment of the present invention, the primer purification method is PAGE, which has high electrophoresis resolution, high DNA purity and high loading capacity. The specific purification method can be selected according to one's own needs, including but not limited to PAGE, HAP, and DHLPC.
[0030] S3: Purification of PCR products: The PCR products obtained in step S1 were purified using the shrimp alkali enzyme method (SAP+ExoI) at 37°C for 30 min and 80°C for 15 min. The main purpose of this step is to remove excess primers and dNTPs in the product.
[0031] S4: Sequencing reaction PCR amplification, performing sequencing reaction PCR amplification on step S3, the specific steps are as follows: S4-1: First, mix 3.5 μL of sequencing primer (1.5 μmol) and 1 μL of the product from step S3, run at 95°C for 5 min to denature the template, take the product out of the PCR instrument 30 s after the denaturation, and immediately put it in an ice bath to allow the sequencing primer to bind to the template; S4-2: After the ice bath, add 0.5 μL of diluted BDT (BigDye™ Terminator 3.1 ReadyReaction Mix, ABI), dilution ratio: BDT:5*seq buffer=1:1; S4-3: Perform sequencing reaction PCR, running the program at 95℃ for 30s, 50℃ for 5s, and 60℃ for 4min; S4-4: The above three steps are run for 25 cycles and maintained at 16°C after the program is completed.
[0032] S5: Ethanol precipitate the PCR product of step S4, add 2 μL 0.01mol / L EDTA to the product, centrifuge briefly, then add 15 μL anhydrous ethanol, centrifuge at 4000rpm, 4℃ for 40min to precipitate DNA, discard the supernatant after the end, add 70 μL 75% ice ethanol to rinse, centrifuge at 4000rpm for 15min, discard the supernatant, add 70 μL 75% ice ethanol to rinse again, centrifuge at 4000rpm for 15min, discard the supernatant, and let stand at room temperature for 10min until the ethanol evaporates completely. The sequence of the final amplified product is as follows: GTCCTGGACCCCGATGATT GTTCCTGTCCCACCTGTGAGTGTCTAGAGCTGTCAGCCCAAGAGGCAGCTTCATGGTGACGTGACCCTGAGTGCCT GGAGCCGTCTCCTGATTGTTTGTCCTTACGAGTTTGTCTGCTTGCACTTCTGGATCCTGACTGCCCATGGGAGGCATCAGACCTTCCCTGGGATGTGGTGTGGCTGTGATGGGACCCTGAGTGTCCAGATCTATCTACCGATTGCTCATGGTGGGATCCCTGCCTTCCTCCTCTCCTTGACCCCGGGTGTGCAC GAATGGTGTCCTGACCCTCTTGGGACGCTGAGTGCCTGGAGCTGTCTCGTGCCTGCTCGTGGTGGGATCCTTGTCTTCGTCCAGTGCTGGTCCTGGTCCGCCCATGGGCAGACTCAGACTGTTCATGAGTGCTCACCTGGTAGATGAAAGACCCTGAACGTCCAGACCTTCCCCC TGACCAGTCACGTGCGGA CTCTTGGTGGCTCTGCTGATGGGGCCCATCCTGTCCATGGCCTGACACTGACTGTGTGTCTGACTCCTCTGAATGTCCCTCACTATCACTGGCCTGACTACCACTGGACCCCCAGTGTCCACTGTCTCTGACTGCA GATGAAGCTTGTCTGCGCGGAATGCCTGAGTGTCTGGAGCTGTCTGCTGACTGCTGTGGCGGGATCCGTGTCTTTCTCCTGGACTTGATCTTGCCTGTTCATGGGATGACGCAGCCTGTCCACCAGAGGAAGTCTC TGCGTGA GGAGTTCCTGATT like Figure 6 As shown, the four sequences in large bold are: amplification primer F sequence, MT sequencing primer F sequence, reverse sequencing primer position, and reverse complementary sequence of amplification primer R.
[0033] S6: Add 10ul of HI-DI (formamide) to the PCR product in step S5, denature at 95°C for 5min, and then quickly cool in an ice bath. Place the cooled product into a 3730 sequencer and perform capillary electrophoresis sequencing to obtain the original sequencing peak map.
[0034] Example 3: Determining cis-trans structures based on sequencing result peaks According to step S6, the original sequencing peak map is obtained to determine the cis-trans structure of the mutation site.
[0035] FLG-F sequencing results can be found at Figure 2, the WT peak is high and the MT peak is low, supporting the cis mutation; FLG-R sequencing results can be found at Figure 3 , the WT peak is high and the MT peak is low, supporting the cis mutation; FLG-F2 sequencing results can be found at Figure 4 , the WT peak is low and the MT peak is high, supporting cis mutation; FLG-R2 sequencing results can be found at Figure 5 , the WT peak is low and the MT peak is high, supporting cis mutation.
[0036] In summary, the structures of the two mutation sites are cis mutations.
[0037] It should be noted that the above is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made on the basis of the above embodiments without departing from the principles of the present invention. These improvements and modifications all fall within the scope of protection of the claims of the present invention.
Claims
1. A method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform, characterized in that: The following steps are involved: S1: Design PCR primers according to the adjacent mutation sites annotated in the NGS sequencing data. After the PCR is completed, the product is subjected to agarose gel electrophoresis quality inspection to ensure that the size of the amplified product band meets the expectation and the band is single; S2: Design forward and reverse sequencing primers. Two pairs of sequencing primers are required to ensure that the first SNP site is located at the 3' end of the binding end of the sequencing primer and the template chain. The 3' end base of the first pair of primers is the same as the wild type, and the 3' end base of the second pair of primers is the same as the detected mutant type. S3: Purification of PCR products: purifying the PCR products obtained in step S1 using the shrimp alkali enzyme method, running at 37°C for 30 min and 80°C for 15 min; S4: sequencing reaction PCR amplification, performing sequencing reaction PCR amplification on step S3; S5: ethanol precipitation of the PCR product of step S4, adding 2 μL 0.01mol / L EDTA to the product, centrifuging instantly, then adding 15 μL anhydrous ethanol, centrifuging at 4000rpm, 4℃ for 40min to precipitate DNA, discarding the supernatant after the end, adding 70 μL 75% ice ethanol to rinse, centrifuging at 4000rpm for 15min, discarding the supernatant, adding 70 μL 75% ice ethanol to rinse again, centrifuging at 4000rpm for 15min, discarding the supernatant, and standing at room temperature for 10min until the ethanol evaporates completely; S6: Add 10ul of formamide to the PCR product of step S5, denature at 95°C for 5min, and then quickly cool in an ice bath. Place the cooled product into a 3730 sequencer and perform capillary electrophoresis sequencing to obtain the original sequencing peak map.
2. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to claim 1, characterized in that: The specific steps of sequencing reaction PCR amplification in step S4 are as follows: S4-1: First, mix 3.5 μL of sequencing primer and 1 μL of the product from step S3, run at 95°C for 5 min to denature the template, take the product out of the PCR instrument 30 s after the denaturation, and immediately put it in an ice bath to allow the sequencing primer to bind to the template; S4-2: After the ice bath, add 0.5 μL of diluted BDT, the dilution ratio is: BDT:5*seq buffer=1:1; S4-3: Perform sequencing reaction PCR, running the program at 95℃ for 30s, 50℃ for 5s, and 60℃ for 4min; S4-4: The above three steps are run for 25 cycles and maintained at 16°C after the program is completed.
3. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to claim 1, characterized in that: The PCR amplification primer in step S1 is TaKaRa HS Taq.
4. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to claim 1, characterized in that: The adjacent mutation sites in step S1 need to have clear RS numbers or coordinates, and the length should be within one Sanger sequencing reaction.
5. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to claim 1, characterized in that: The length of the amplification primer in step S1 is 15-25 bp, the annealing temperature is 55-65° C., and the amplification primer has no special structure.
6. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to claim 1, characterized in that: The primer purification method in step S2 is any one of PAGE, HAP and DHLPC.
7. The method for verifying the cis-trans structure of adjacent SNP sites based on the NGS platform according to any one of claims 1 to 6, characterized in that: The following steps are also included: S7: Analyze the sequencing peak graph obtained in step S6; S8: Compare step S7 with the height of the base peak graph of the second SNP site to determine the cis-trans structure of the two SNP sites: when sequencing with the first pair of primers, if the peak of the mutant base is high, the two SNP sites are in a trans structure; conversely, when sequencing with the second pair of primers, if the peak of the mutant base is low, the two SNP sites are in a cis structure.