DCAPS molecular marker for identifying soybean 11S globulin A5 subunit deletion and application of dCAPS molecular marker

Abstract

The invention discloses a dCAPS molecular marker for identifying soybean 11S globulin A5 subunit deletion and application of the dCAPS molecular marker. The nucleotide sequence of the dCAPS molecular marker is as shown in SEQ ID NO.1 or SEQ ID NO.2. A primer pair for the dCAPS molecular marker comprises an upstream primer with the nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer with the nucleotide sequence as shown in SEQ ID NO.4. The dCAPS molecular marker can identify soybean 11S globulin A5 subunit deletion. According to the method, PCR amplification is carried out on the to-be-detected soybean genome DNA by introducing the primer pair with the mismatched basic group, the purposes of synchronously screening the soybean genome DNA without site mutation and identifying the soybean A5 subunit deletion variety are achieved, the soybean A5 subunit deletion variety can be rapidly and accurately identified, the screening time is shortened, and the screening efficiency is improved. The method has high screening efficiency and screening accuracy.

Description

Technical Field

[0001] The present application belongs to the technical field of soybean molecular breeding, and specifically relates to a dCAPS molecular marker for identifying the deletion of soybean 11S globulin A5 subunit and its application. Background Art

[0002] Glycinin is a storage globulin of soybean seeds, with a sedimentation coefficient of 11S. It consists of 6 subunits, each of which is formed by an acidic polypeptide chain A and a basic polypeptide chain B connected by a disulfide bond. Each polypeptide chain subunit of soybean globulin (11S) has different functional properties, so it can be used in food processing.

[0003] Studies have shown that soybean 11S globulin (glycine) accounts for about one-third of the total protein in soybean seeds. Soybean 11S globulin is composed of 6 subunits, including acidic subunits (A1a, A1b, A2, A3, A4, A5) and basic subunits (B1a, B1b, B2, B3, B4). Among them, the A5 subunit is an acidic subunit of 11S globulin. The loss of the A5 subunit may affect the functional properties of soybean protein. For example, acidic subunits usually have good gel-forming ability, and the loss of the A5 subunit may change the gel-forming ability, emulsification activity and emulsification stability of the protein.

[0004] In order to overcome the shortcomings of traditional breeding methods, the use of molecular marker methods is of great significance to crop genetic breeding. The use of molecular markers in gene selection has the characteristics of not being affected by environmental and dominant factors. It has been widely used in the fields of gene positioning, molecular marker-assisted breeding, etc. and has high application value.

[0005] However, there is no report on the dCAPS molecular marker technology designed for the deletion of soybean 11S globulin A5 subunit. Summary of the invention

[0006] In view of this, the primary purpose of the present application is to provide a dCAPS molecular marker for identifying the deletion of soybean 11S globulin A5 subunit. The present application uses the identified gene variation sites to design and develop corresponding molecular markers. The development of this marker can judge the subunit synthesis situation from a molecular perspective. Compared with one-way sequencing, it is simpler and faster, and can effectively reduce costs.

[0007] In order to achieve the above objectives, this application adopts the following technical solutions:

[0008] One aspect of the present application provides a dCAPS molecular marker for identifying the deletion of soybean 11S globulin A5 subunit, and the nucleotide sequence thereof is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0009] Another aspect of the present application provides a primer pair for amplifying the dCAPS molecular marker of claim 1, wherein the primer pair comprises: an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4.

[0010] Another aspect of the present application provides the use of the dCAPS molecular marker or the primer pair described above in the breeding of soybean 11S globulin A5 subunit deletion mutants.

[0011] Another aspect of the present application provides the use of the dCAPS molecular marker or the primer pair described above in the preparation of a product for identifying soybean 11S globulin A5 subunit deletion mutants.

[0012] Another aspect of the present application provides a kit for identifying soybean 11S globulin A5 subunit deletion mutants, wherein the kit contains the dCAPS molecular marker or the primer pair described above.

[0013] Another aspect of the present application provides a method for identifying the deletion of soybean 11S globulin A5 subunit, comprising the following steps:

[0014] Extracting soybean genomic DNA to be tested;

[0015] The extracted soybean genomic DNA was amplified by PCR using the primer pairs described above to obtain an amplified product;

[0016] After enzymatic digestion of the amplified product, an enzymatic digestion product is obtained;

[0017] The enzyme cleavage products are detected by electrophoresis.

[0018] Beneficial effects of this application:

[0019] The present application uses a mismatched base primer to perform PCR amplification on the soybean genomic DNA to be tested, thereby achieving the purpose of simultaneously screening soybean genomic DNA without site mutation and identifying soybean A5 subunit deletion varieties, reducing screening time and improving screening efficiency and screening accuracy.

[0020] The present application develops a primer pair for specifically amplifying the molecular marker based on the difference between the molecular marker in soybeans with A5 subunit deficiency and soybeans without A5 subunit deficiency. By using the primer pair provided by the present invention, it is only necessary to extract soybean genomic DNA for PCR amplification, and then perform agarose gel electrophoresis after enzyme digestion to quickly and accurately identify soybean 11S globulin A5 subunit deficiency varieties, and it is possible to conveniently, effectively and accurately identify soybean 11S globulin A5 subunit deficiency varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the gel imaging result of the PCR amplification product in Example 3 of the present application, wherein M represents 2K DNA Marker, 1 represents the A5 subunit mutant Luodou No. 1, and 2 represents the non-A5 subunit-deficient Wangzhaidou.

[0022] Figure 2 This is the gel imaging result of the enzyme cleavage product in Example 3 of the present application, wherein M represents 2K DNA Marker, 1 represents the A5 subunit mutant Luodou No. 1, and 2 represents the non-A5 subunit-deficient Wangzhaidou.

[0023] Figure 3 This is the electrophoresis band diagram of the missing A5 subunit of 11S protein in Example 4 of the present application. DETAILED DESCRIPTION

[0024] The following will clearly and completely describe the implementation methods of the present application. The technical solutions in the implementation methods described below are exemplary and are only possible technical implementations of the present application, not all possible implementations. Those skilled in the art can fully combine the implementation methods of the present application to obtain other implementation methods without creative work, and these implementation methods are also within the scope of protection of the present application.

[0025] The first aspect of the present application discloses a dCAPS molecular marker for identifying the deletion of soybean 11S globulin A5 subunit, and the nucleotide sequence thereof is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0026] The present application sequenced and analyzed the 11S globulin A5 subunit synthesis gene Glyma.10G037100 (nucleotide sequence as shown in SEQ ID NO.5) and found that there was a SNP site at the 3245986 bp, and the base was A or G, wherein the soybean variety with the A genotype was an A5 subunit deletion mutant, and the soybean variety with the G genotype was a non-A5 subunit deletion soybean variety. The A5 subunit deletion mutant had a single base mutation at the 3245986 bp of Glyma.10G037100 on soybean chromosome 10, which led to a non-synonymous mutation, causing the start codon to mutate, resulting in the gene not being translated from the reference start site, resulting in variant amino acids. Therefore, the present application developed a dCAPS marker based on the variant site.

[0027] Among them, for the normal soybean varieties of A5 subunit, the nucleotide sequence of its dCAPS molecular marker is as follows (the underline is the variable site):

[0028] ATTAACACTTCCTTAGTTCAATAT G GGGAAGCCCTTCACTCTCTCTC(SEQ ID NO.1);

[0029] For the A5 subunit deletion mutant, the dCAPS molecular marker nucleotide sequence is as follows (the underline indicates the mutation site):

[0030] ATTAACACTTCCTTAGTTCAATAT A GGGAAGCCCTTCACTCTCTCTC (SEQ ID NO. 2).

[0031] The second aspect of the present application discloses a primer pair for amplifying the dCAPS molecular marker described above. By designing the dCAPS primer to introduce a mismatched base C near the mutation site, normal soybean germplasm of the A5 subunit will produce a restriction endonuclease NdeⅠ cleavage site (CA^TATG), while the A5 subunit deletion mutant will not produce the above-mentioned restriction endonuclease site, thereby achieving specific amplification.

[0032] In the present application, the primer pair includes: an upstream primer having a nucleotide sequence as shown in SEQ ID NO.3 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.4.

[0033] The third aspect of the present application provides the use of the dCAPS molecular marker or the primer pair described above in the breeding of soybean 11S globulin A5 subunit deletion mutants.

[0034] The fourth aspect of the present application provides the use of the dCAPS molecular marker or the primer pair described above in the preparation of a product for identifying soybean 11S globulin A5 subunit deletion mutants.

[0035] The primer pairs designed in the present application can specifically amplify the dCAPS molecular marker, thereby achieving the purpose of rapidly, effectively and accurately identifying and distinguishing soybean varieties lacking the soybean 11S globulin A5 subunit.

[0036] In the present application, the product is preferably a kit.

[0037] The fifth aspect of the present application discloses a kit for identifying soybean 11S globulin A5 subunit deletion mutants, wherein the kit contains the dCAPS molecular marker or primer pair described above.

[0038] It is understandable that, in addition to the dCAPS molecular marker or the primer pair described above, the kit may also contain other reagents required for detection, such as DNA extraction reagents and PCR amplification reagents. Specific examples include extraction solutions, solvents, buffer solutions, etc., which can be configured according to needs, so there is no special limitation.

[0039] The sixth aspect of the present application discloses a method for identifying the deficiency of soybean 11S globulin A5 subunit, comprising the following steps:

[0040] Extracting soybean genomic DNA to be tested;

[0041] The extracted soybean genomic DNA was amplified by PCR using the primer pairs described above to obtain an amplified product;

[0042] After enzymatic digestion of the amplified product, an enzymatic digestion product is obtained;

[0043] The enzyme cleavage products are detected by electrophoresis.

[0044] In the present application, the reaction conditions and reaction system of the PCR amplification can be determined by a person skilled in the art through a known method or experiment according to a specific primer pair. The person skilled in the art has such ability. In some specific embodiments of the present application, the reaction conditions of the PCR are: 95°C pre-denaturation for 5 min; 95°C denaturation for 15 s, 52°C annealing for 15 s, 72°C extension for 15 s, 36 cycles in total; and finally 72°C extension for 5 min. The reaction system of the PCR amplification is: 2 μL of genomic DNA of the soybean to be tested, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 7.5 μL of Taq enzyme and 4.3 μL of ddH2O.

[0045] After amplification, the soybean germplasm without A5 subunit deletion had Nde I restriction site, but the A5 subunit deletion mutant did not. Therefore, the A5 subunit deletion mutant could be identified after digestion with Nde I restriction endonuclease.

[0046] Specifically, the enzyme digestion system and enzyme digestion conditions can be determined by a person skilled in the art by known methods or experiments, so there is no special limitation. In some specific embodiments of the present application, the enzyme digestion system is: 10 μL of PCR product, 0.5 μL of Nde I restriction endonuclease, 2 μL of Cutsmart Buffer and 2.5 μL of ddH2O; the enzyme digestion conditions are: 37°C for 15 min.

[0047] After enzyme digestion, the soybean germplasm without the A5 subunit can be cut due to the presence of the Nde I enzyme cutting site, but one of the band fragments is too small to be presented in the gel electrophoresis results, so only a low band is presented; the A5 subunit deletion mutant will not be digested due to the absence of the enzyme cutting site, so a high band is presented.

[0048] The following are specific embodiments of the present application. It should be noted that the following specific embodiments are only for illustrative purposes and do not limit the scope of the present application in any way.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0050] In addition, unless otherwise specified, methods without specific conditions or steps are conventional methods, and the reagents and materials used are all commercially available.

[0051] Example 1 Obtaining SNP mutation sites

[0052] In this example, 500 copies of soybean genome resequencing data (data source: https: / / sfgb.rmbreeding.cn / index) were analyzed for genotype and phenotype, and it was found that the SNP mutation site was located at 3245986bp of the Glyma.10G037100 gene on soybean chromosome 10, with a base of A or G, and the soybean reference genome was Glyma.Wm82.a4.v1. Among them, the soybean variety with genotype A is an A5 subunit deletion mutant, and the soybean variety with genotype G is a non-A5 subunit deletion soybean variety.

[0053] Example 2 Primer Design

[0054] According to the SNP site at 3245986bp of chromosome 10 of soybean obtained in Example 1, the site-related sequence was extracted:

[0055] In soybeans lacking non-A5 subunits, the dCAPS molecular marker nucleotide sequence is:

[0056] ATTAACACTTCCTTAGTTCAATAT G GGGAAGCCCTTCACTCTCTCTC(SEQ ID NO.1);

[0057] In the A5 subunit deletion mutant, the dCAPS molecular marker nucleotide sequence is:

[0058] ATTAACACTTCCTTAGTTCAATAT A GGGAAGCCCTTCACTCTCTCTC (SEQ ID NO. 2).

[0059] The restriction endonuclease NdeⅠ was selected using the online enzyme recognition software dCAPS Finder2.0, and the restriction endonuclease recognition sequence was CA^TATG.

[0060] Primer design: The primer pairs designed using the dCAPS Finder 2.0 website and Primer5.0 software are:

[0061] Upstream primer dCAPS-F (5'→3'):

[0062] ATTAACACTTCCTTAGTTCCATAT(SEQ ID NO.3);

[0063] Downstream primer dCAPS-R (5'→3'):

[0064] CATGTTTGAATCAAACCACCTTCG (SEQ ID NO. 4).

[0065] Example 3 Identification of soybean 11 globulin A5 subunit deletion mutant

[0066] This example discloses the identification of soybean 11 globulin A5 subunit deletion mutants using the dCAPS molecular marker in Example 1 and the primers designed in Example 2. The specific steps are as follows:

[0067] 1. Soybean seed DNA extraction

[0068] (1) Powder the soybean varieties using a puncher and put them into a 2 mL centrifuge tube for later use;

[0069] (2) Add 1200 μL of SDS extract to each centrifuge tube, incubate at 65°C for 30 min, shake well every 10 min, and centrifuge at 12000 rpm for 10 min after the water bath.

[0070] (3) Pipette 1000 μL of supernatant, add 1000 μL of DNA extraction solution 25:24:1 (shake until foam is generated before use), mix well, shake for 5 min, let stand for 5 min, and then centrifuge at 12000 r / min for 10 min;

[0071] (4) 800 μL of the supernatant was aspirated, 800 μL of chloroform-isoamyl alcohol (nucleic acid extraction solution 24:1) was added, shaken for 5 min, allowed to stand for 5 min, and centrifuged at 12,000 rpm for 20 min;

[0072] (5) Pipette 600 μL of the supernatant, add 600 μL of isopropanol, shake well, and place in a -20°C refrigerator for 30 min;

[0073] (6) After standing, centrifuge at 12000 r / min for 10 min and discard the supernatant;

[0074] (7) Pipette 800 μL of 75% ethanol solution and rinse repeatedly three times;

[0075] (8) Place in a fume hood overnight and add 100 μL of distilled water to dissolve;

[0076] (9) Use an ultra-micro spectrophotometer to measure the DNA concentration and dilute it according to the concentration before use.

[0077] 2. PCR amplification of DNA fragments

[0078] The extracted soybean DNA fragment was amplified using the primer pair described in SEQ ID No. 3 and 4 designed in Example 2 to obtain an amplified product.

[0079] The PCR reaction system is as follows:

[0080]

[0081] The specific PCR amplification procedure is as follows:

[0082]

[0083] 3. Agarose gel electrophoresis

[0084] Take 5 μL of PCR amplification product, use 1.5% agarose gel for electrophoresis detection, and verify the bands using a gel imager. Figure 1 As shown in .

[0085] pass Figure 1 It can be seen that the primers designed by mismatch bases can effectively amplify the non-A5 subunit mutant and A5 subunit mutant target fragments, proving that the designed primers are specific and avoid homology with non-target sequences.

[0086] 4. After verifying the band, perform enzyme digestion on the PCR amplification product: add restriction endonuclease and perform enzyme digestion at 37°C for 15 minutes, then take 5 μL of the digestion product, perform electrophoresis on 3% agarose gel, and observe the band type of the digestion product by gel imaging;

[0087] Among them, the enzyme digestion system is as follows:

[0088]

[0089] For gel imaging results of enzyme digestion products, see Figure 2 .

[0090] like Figure 2As shown in the figure, the soybean variety of genotype G, i.e., the soybean variety without A5 subunit deletion, has the restriction endonuclease Nde I cleavage site (enzyme recognition sequence is CA^TATG), which causes the target fragment to be cut. Among the two cut fragments, one of the bands is smaller, which makes it impossible to show in the gel electrophoresis imaging. Therefore, Figure 2 In the A genotype soybean variety, i.e., the A5 subunit deletion mutant, the target fragment will not be cut because there is no restriction site. Figure 2 Therefore, the height of the band can be used to identify whether the soybean is an A5 subunit deletion mutant.

[0091] Example 4

[0092] In this example, 500 soybean materials were tested using the method of Example 3 to verify the dCAPS molecular markers and primer pairs provided in this application. Figure 3 .

[0093] The 57 A5 subunit deletion mutants screened out include Black Tiger, NG94-156, Luodou No. 1, and Yongchuan Sanjiao Limin Bean; the rest are non-A5 subunit deletion soybean varieties, including Kenjiandou 27, Guannan Xiaoqingdou, Wangzhaidou, and Weizidou.

[0094] pass Figure 3 Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) showed that Kenjian bean 27, Guannan small green bean, Wangzhai bean, and Weizi bean had A5 subunit bands, while Black Tiger, NG94-156, Luodou No. 1, and Yongchuan Sanjiao Limin bean-2 did not have A5 subunit bands.

[0095] The above results indicate that the dCAPS molecular marker and primer pair in the present application can accurately and quickly identify the deletion of the A5 subunit of 11S globulin in soybean materials and identify A5 subunit deletion mutants.

[0096] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the main purpose of the present application, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. A dCAPS molecular marker for identifying the absence of soybean 11S globulin A5 subunit, characterized in that: The nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.

2.

2. A primer pair for amplifying the dCAPS molecular marker according to claim 1, characterized in that: The primer pair includes: an upstream primer whose nucleotide sequence is shown as SEQ ID NO.3 and a downstream primer whose nucleotide sequence is shown as SEQ ID NO.

4.

3. Use of the dCAPS molecular marker according to claim 1 or the primer pair according to claim 2 in the breeding of soybean 11S globulin A5 subunit deletion mutants.

4. Use of the dCAPS molecular marker according to claim 1 or the primer pair according to claim 2 in preparing a product for identifying soybean 11S globulin A5 subunit deletion mutants; Preferably, the product is a kit.

5. A kit for identifying soybean 11S globulin A5 subunit deletion mutants, characterized in that: The kit contains the dCAPS molecular marker according to claim 1 or the primer pair according to claim 2.

6. A method for identifying the deficiency of soybean 11S globulin A5 subunit, characterized in that: The following steps are involved: Extracting soybean genomic DNA to be tested; Using the primer pair described in claim 2 to perform PCR amplification on the extracted soybean genomic DNA to obtain an amplified product; After enzymatic digestion of the amplified product, an enzymatic digestion product is obtained; The enzyme cleavage products are detected by electrophoresis.

7. The method according to claim 6, characterized in that The reaction conditions of the PCR amplification are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 15 s, for a total of 36 cycles; and finally extension at 72°C for 5 min.

8. The method according to claim 6, characterized in that The reaction system of the PCR amplification is: 2 μL of genomic DNA of soybean to be tested, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 7.5 μL of Taq enzyme and 4.3 μL of ddH2O.

9. The method according to claim 6, characterized in that The amplified product is digested with Nde I restriction endonuclease to obtain a digestion product; Preferably, the enzyme digestion system is: 10 μL of PCR product, 0.5 μL of Nde I restriction endonuclease, 2 μL of Cutsmart Buffer and 2.5 μL of ddH2O; Preferably, the enzyme digestion conditions are: 37°C for 15 min.

10. The method according to claim 6, characterized in that When the enzyme cleavage product appears as a high band, the soybean to be tested is the soybean lacking the A5 subunit; when the enzyme cleavage product appears as a low band, the soybean to be tested is the soybean lacking the non-A5 subunit.

Images