InDel marker for identifying germplasm of Chinese cherry and European sweet cherry and application of InDel marker

Abstract

The invention relates to the technical field of molecular marker-assisted germplasm resource identification and breeding of cherries, in particular to an InDel marker for identifying germplasm of Chinese cherries and European sweet cherries and application of the InDel marker, which are suitable for identifying two species of the Chinese cherries and the European sweet cherries and interspecific hybrid cherry resources of the two species of the Chinese cherries and the European sweet cherries. The InDel molecular marker is developed by designing a specific PCR (Polymerase Chain Reaction) primer by utilizing InDel sequence information of a cherry genome Cp235932912 site, extracting genomic DNA (Deoxyribose Nucleic Acid) of Chinese cherries and European sweet cherries, performing PCR amplification and polyacrylamide gel electrophoresis, reading electrophoretic bands, identifying the Chinese cherries, the European sweet cherries and interspecific hybrids thereof according to the positions and the number of the bands, and identifying the Chinese cherries, the European sweet cherries and the interspecific hybrids of the Chinese cherries, the European sweet cherries and the European sweet cherries according to the InDel molecular marker. The molecular marker can be used for germplasm identification of Chinese cherries and European sweet cherries, and can also be used for early identification of hybrid authenticity of interspecific filial generations of the Chinese cherries and the European sweet cherries, and results are accurate and reliable.

Description

Technical Field

[0001] The invention relates to the technical field of cherry molecular marker-assisted germplasm resource identification and breeding, and specifically to an InDel marker suitable for identifying Chinese cherry and European sweet cherry germplasm and an application thereof. Background Art

[0002] Chinese cherry (Cerasus pseudocerasus (Lindl.) G.Don) and European sweet cherry (Cerasus avium (L.) Moench.) are the two main fruit cherry species in my country. The two cherry species are rich in resources. Due to differences in growth environment and development period, they often show many similarities in phenotype, which causes some troubles in the identification of Chinese cherry and European sweet cherry resources. In particular, in terms of germplasm characteristics, Chinese cherry is native to my country, has wide adaptability and strong stress resistance, and is widely cultivated in both southern and northern my country. The fruit is fresh and juicy, with a strong flavor, but the fruit is small, the texture is soft, and it is not resistant to storage and transportation; while European sweet cherry requires a certain amount of cold to complete flower bud differentiation and normal flowering and fruiting. The fruit is large, the texture is hard, and it is resistant to storage and transportation. It is mainly developed on a large scale in northern my country. Therefore, making full use of the characteristics of these two cherry species and hybridizing and cultivating breakthrough new cherry varieties with excellent comprehensive traits has important development and utilization prospects, and the development of simple, fast and highly reliable molecular marker technology for germplasm identification and molecular-assisted selection of breeding materials can achieve its efficient utilization. However, since Chinese cherry is tetraploid and its genome is relatively complex, while European sweet cherry is diploid and has a high proportion of genomic repetitive sequences, these germplasm characteristics have greatly affected the development of stable and efficient molecular markers from the Chinese cherry and European sweet cherry genomes. Insertion-deletion (InDel) is one of the most abundant types of structural variation in plant genomes. It is a co-dominant marker with high polymorphism, good repeatability and versatility, and is often used in crop germplasm identification, map construction, genetic diversity analysis and other studies. Therefore, for the identification of polyploid Chinese cherry and diploid European sweet cherry germplasm with high repetitive sequences, the development of efficient, stable and accurate InDel molecular markers based on the whole genome is of particular significance for the identification of Chinese cherry and European sweet cherry species and the early identification of the authenticity of their interspecific hybrid offspring. Summary of the invention

[0003] The technical problem to be solved by the present invention is to overcome the shortcoming of the prior art in that the detection accuracy of structural variations in species with complex genomes is low, and to provide a specific InDel marker for identifying Chinese cherry and European sweet cherry germplasm and its application.

[0004] A specific primer for amplifying InDel markers of Chinese cherry and European sweet cherry germplasm comprises a forward primer and a reverse primer. The nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0005] An InDel marker for identifying Chinese cherry and European sweet cherry germplasm is obtained by amplification using the above-mentioned specific primers and genomic DNA as a template. The amplification product of the Chinese cherry is 191bp, and the amplification product of the European sweet cherry is 173bp.

[0006] The 113th to 130th positions of the amplified product of Chinese cherry are 5'-TGCTATTGCCAAATGAAG-3', and the 113th position of the amplified product of European sweet cherry is missing 5'-TGCTATTGCCAAATGAAG-3', a total of 18 bases.

[0007] The sequence of the amplified product of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 191 bp;

[0008] The sequence of the amplified product of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173 bp.

[0009] Application of the above-mentioned specific primers or InDel markers in identifying Chinese cherry and European sweet cherry germplasm.

[0010] The application uses specific primers to amplify InDel markers using genomic DNA as a template; wherein the amplified product of Chinese cherry is 191 bp, the amplified product of European sweet cherry is 173 bp, and the amplified product of the hybrid of Chinese cherry and European sweet cherry has two fragments, which are 191 bp and 173 bp respectively. The specific primers are:

[0011] The nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT,

[0012] The reverse primer nucleotide sequence was AGGGATGTTGGTTCTGATGG.

[0013] The genomic DNA comes from leaves.

[0014] The invention obtains an InDel marker for identifying Chinese cherry and European sweet cherry germplasm, the primer number is Cp2_35932912, and the InDel marker comprises a forward primer and a reverse primer. The nucleotide sequence of the forward primer of the InDel marker is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0015] The present invention also provides an application of the InDel primer Cp2_35932912 in the identification of Chinese cherry and European sweet cherry germplasm, comprising the following steps:

[0016] (1) Extraction of genomic DNA: Extracting genomic DNA from the sample to be tested;

[0017] (2) Development of molecular markers: The whole genome resequencing data of the samples of the present invention are aligned to the reference genome of the Chinese cherry Luoyang ancient cherry (which has been uploaded to the CNGB database, Accession Number: CNP0006741), and the InDel primers in claim 1 are screened out from the primers developed at specific sites of the whole genome through variation detection and site filtering for subsequent experiments and analysis;

[0018] (3) PCR amplification: using the InDel primers in claim 1 to perform PCR amplification on the genomic DNA obtained in step (1);

[0019] (4) Polyacrylamide gel electrophoresis and silver staining: The PCR product obtained in step (3) was electrophoresed on an 8% denaturing polyacrylamide gel, followed by staining and development, and photographed on a gel imaging system;

[0020] (5) Data statistics and band type analysis: In Quantity One software, Trans2K Plus DNA Marker was used as a reference to calculate the specific band size (bp) and perform data statistics. The sample was determined to be Chinese cherry or European sweet cherry based on the specific band size. Finally, the PCR products of representative individuals were subjected to Sanger sequencing (Biological Engineering), and the obtained sequences were compared to further verify the accuracy of variation detection, PCR amplification, and electrophoresis results. Since 'Landing No. 2' and 'Kao Te' were heterozygous at this site, five independent PCR amplifications and Sanger sequencing were performed on these two samples to determine the base type of complex variation sites.

[0021] The specific steps of the application of Chinese cherry and European sweet cherry germplasm identification in the present invention are as follows:

[0022] (1) Genomic DNA extraction: The total genomic DNA of all samples was extracted using a genomic DNA extraction kit (TIANamp Genomic DNA Kit), and 1% agarose gel electrophoresis was used to verify the integrity of the DNA. The purity and concentration of the genomic DNA of each sample were detected using a nucleic acid protein quantitative analyzer (Thermo Scientific NanoDrop spectrophotometer);

[0023] (2) Development of molecular markers: Using the Chinese cherry Luoyang Ancient Cherry as the reference genome (uploaded to the CNGB database, Accession Number: CNP0006741), the whole genome resequencing data of 184 Chinese cherries and 95 European sweet cherries were aligned to the reference genome, and GATK and Sentieon were used for variation detection to obtain the original gvcf file, and the InDel file was extracted to screen out the species-specific InDel sites of Chinese cherry and European sweet cherry. It was found that the 35932912 site of linkage group 2 had a deletion of 18bp (5'-TGCTATTGCCAAATGAAG-3') in all European sweet cherry samples. Primers were designed for this site in Primer 3, and the above-mentioned InDel primers were obtained for subsequent experiments and analysis;

[0024] Combined with the whole genome resequencing variation detection results of the target region, the target sequence of Chinese cherry amplification was predicted: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAA CCAACATCCCT-3', a total of 191 bp;

[0025] The results of whole genome resequencing variation detection showed that in the amplified target sequence region, in addition to the target deletion variation starting from position 113, there was also a base substitution from G to A in the European sweet cherry at position 148 of the Chinese cherry amplified sequence, that is, position 130 of the European sweet cherry amplified sequence, relative to the Chinese cherry. Therefore, the expected amplified target sequence of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173bp.

[0026] (3) PCR amplification: PCR amplification of the genomic DNA obtained in step (1) was performed using the InDel primers in claim 1. PCR amplification system (20 μL): 1 μL DNA template, 1 μL forward and reverse primers, 7 μL ddH2O, 10 μL Taq mix (vazyme); amplification program: 94°C pre-denaturation for 4 min, 94°C denaturation for 50 s, 56°C annealing for 1 min, 72°C extension for 110 s, a total of 34 cycles, and finally 72°C extension for 8 min, 12°C forever;

[0027] (4) Polyacrylamide gel electrophoresis and silver staining: The PCR product obtained in step (3) was electrophoresed on an 8% denaturing polyacrylamide gel at a voltage of 1000 V, a current of 50 mA, and a power of 50 W for 3 h. The polyacrylamide gel after electrophoresis was then silver stained in a 0.1% AgNO3 solution for 10 min. The gel was removed and rinsed with distilled water until it turned light milky white. The gel was then placed in a NaOH and formaldehyde colorimetric solution for color development for 6 min. Finally, the gel was photographed and recorded on a gel imaging system.

[0028] (5) Data statistics and band type analysis: In Quantity One software, Trans2K Plus DNAMarker was used as a reference to calculate the specific band size (bp) and perform data statistics. Samples that produced a 191bp electrophoresis band were determined to be Chinese cherries, samples that produced a 173bp band were determined to be European sweet cherries, and samples with both 191bp and 173bp electrophoresis bands were determined to be hybrids of Chinese cherries and European sweet cherries. At the same time, PCR products of 4 Chinese cherries, 4 European sweet cherries, and 2 European sweet cherries × Chinese cherries hybrid offspring were selected for Sanger sequencing (Biogen), and the sequenced nucleotide sequences were compared and analyzed to further verify the accuracy of variation detection, PCR amplification, and electrophoresis results. Since ‘Landing No. 2’ and ‘Kao Te’ were heterozygous at this site, these two samples were subjected to five independent PCR amplifications and Sanger sequencing to determine the base type of complex variation sites.

[0029] In step (2), the nucleotide sequence of the forward primer for PCR amplification is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0030] The present invention has the following advantages and beneficial effects:

[0031] (1) The present invention obtains an InDel marker that can efficiently and stably identify Chinese cherry and European sweet cherry germplasm at the species level. Through PCR amplification, only one pair of primers were used to successfully achieve rapid identification of 68 Chinese cherry intraspecific hybrid F1 progeny, Chinese cherry cultivated germplasm and Chinese cherry wild germplasm, and 30 European sweet cherry cultivated germplasm and European sweet cherry wild germplasm, with an accuracy rate of 100%. The operation method is simple, accurate, low-cost, and has good repeatability. It is currently the simplest, fastest, and most accurate method for identifying Chinese cherry and European sweet cherry germplasm at the species level.

[0032] (2) The target fragment amplified by the marker primer Cp2_35932912 of the present invention is a nucleotide sequence unique to both Chinese cherry and European sweet cherry at the species level, accurately identifying the triploid hybrid offspring of the two, providing an efficient germplasm identification molecular marker for molecular-assisted breeding between Chinese cherry and European sweet cherry. This is of great significance for the exploration and utilization of germplasm resources of perennial woody fruit trees with different ploidy levels and highly heterozygous genomes. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the implementation flow chart for this application case.

[0034] Figure 2The polyacrylamide gel electrophoresis results of the PCR amplification products of the InDel marker Cp2_35932912 in this application in 100 samples. Among them, the marker is Trans2K Plus DNA Marker (TransGen Biotech), samples 1-24 are F1 progeny of intraspecific hybridization of Chinese cherry, samples 25-66 are cultivated germplasm of Chinese cherry, samples 67 and 68 are wild germplasm of Chinese cherry, samples 69-97 are cultivated germplasm of European sweet cherry, and sample 98 is wild germplasm of European sweet cherry ('Mazade'), and samples 99 and 100 are triploid hybrid offspring 'Landing 2' and 'Kao Te' produced by hybridization of European sweet cherry (diploid) and Chinese cherry (tetraploid).

[0035] Figure 3 The Sanger sequencing peak graph and PCR amplification sequence of the representative individuals of this application. In order to verify the stability and accuracy of the results of variation detection, PCR amplification and polyacrylamide gel electrophoresis, PCR products of 10 representative individuals (4 Chinese cherries, 4 European sweet cherries and 2 European sweet cherries × Chinese cherry hybrid offspring 'Landing No. 2' and 'Kao Te') were selected for Sanger sequencing (Shengong). The Sanger sequencing results showed that there was no variation in the PCR amplification sequence of the primers between different germplasms of the same species. Therefore, only the sequencing peak graphs of 3 representative individuals ('Hongfei', 'Mei Zao' and 'Kao Te') of Chinese cherry, European sweet cherry and European sweet cherry × Chinese cherry are presented here. Using the Cp2_35932912 forward and reverse primer sequences as the starting sequence and the stop sequence, the sequencing results were read and spliced ​​according to the Sanger sequencing peak graph, and the low-quality sequencing fragments at the beginning and end of the forward and reverse sequencing files were removed in the Chromas software (the gray mask in the figure), and the miscellaneous peaks of the first and last sequencing fragments were verified and corrected in combination with the corresponding resequencing results. 'Kaote' is a hybrid of European sweet cherry and Chinese cherry. When there is an insertion-deletion type variation and the variation site is a heterozygous genotype, there are two lengths of fragments in the PCR amplification product. Therefore, starting from the variation start site in the sequencing peak graph, the sequencing results will show obvious hybrid peaks. And 'Kaote' is a triploid hybrid. Starting from the variation start site, when the height of the hybrid peak is nearly half or more of the height of the main peak, it is determined to be a secondary peak. When there is no obvious hybrid peak, the secondary peak base is consistent with the main peak base. When the hybrid peak amplitude is small, the base type of the site is determined based on the five sequencing results.

[0036] Figure 4The results of Sanger sequencing sequence comparison of 10 representative individuals in this application. The spliced ​​sequences of 10 Sanger sequencing samples were compared with the expected amplified target sequences. The results showed that the PCR product sequences of the samples in this application were indeed the expected amplified target sequences, the deletion sequences were consistent with the whole genome resequencing variation detection results, and the genotypes of different germplasms were consistent with the gel electrophoresis results. In this figure, the numbers in brackets of the germplasm names correspond to the individuals in Tables 1 and Figure 2 The digital code in . DETAILED DESCRIPTION

[0037] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0038] The invention provides an InDel marker primer for identifying Chinese cherry and European sweet cherry germplasm. The primer comprises a forward primer and a reverse primer. The nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

[0039] The molecular markers and their applications for identification of Chinese cherry and European sweet cherry germplasm were taken as examples: the following Chinese cherry, European sweet cherry germplasm and their interspecific hybrid progeny.

[0040] 1 Materials and methods

[0041] 1.1 Test materials

[0042] In this example, 100 materials were selected for amplification of Chinese cherry and European sweet cherry specific InDel markers, of which 54 samples were included in the whole genome resequencing samples for variation detection in this application, and 46 materials were non-resequencing samples (Table 1), as follows:

[0043] (1) This example uses 24 intraspecific hybrid F1 progenies of Chinese cherry from 3 different hybrid combinations, 44 cultivated Chinese cherry germplasms and wild Chinese cherry germplasms from 26 counties and cities in 8 provinces (municipalities) in my country, and 30 cultivated European sweet cherry germplasms and wild European sweet cherry germplasms. These samples represent the main geographical distribution of Chinese cherry and cover the main phenotypes and genotypes of Chinese cherry and European sweet cherry, as shown in Table 1, where 1-24 are intraspecific hybrid F1 progenies of Chinese cherry, 25-66 are local Chinese cherry germplasms, 67 and 68 are wild Chinese cherry germplasms, 69-97 are cultivated European sweet cherry germplasms, and 98 is the European sweet cherry wild germplasm 'Mazade'.

[0044] (2) This example also includes two triploid hybrid offspring obtained by interspecific crosses between European sweet cherry and Chinese cherry, as shown in Table 1, No. 99 and No. 100 are European sweet cherry × Chinese cherry 'Landing No. 2' and 'Kao Te'.

[0045] Table 1 Testing and identification materials for this application

[0046]

[0047]

[0048] Note: All 100 germplasm PCR products were tested by polyacrylamide gel electrophoresis. 1 ” indicates germplasm that was not involved in the whole genome sequence Indel analysis; 2 "Indicates that the PCR product was subjected to Sanger sequencing to further compare and analyze the nucleotide sequence and further verify the accuracy of the variation detection, PCR amplification and electrophoresis results.

[0049] 1.2 Test methods

[0050] 1.2.1 Extraction of genomic DNA

[0051] The DNA of Chinese cherry, European sweet cherry and their hybrids were extracted using the TIANamp Genomic DNA Kit:

[0052] (1) Weigh 2 g of silica gel dried leaf sample and place it in a mortar. Add liquid nitrogen and grind thoroughly. Then add 400 μL of LP1 buffer and 6 μL of RNase A (10 mg / ml). Vortex the mixture for 1 min. Let it stand at room temperature for 10 min. Then add 130 μL of buffer LP2 and mix thoroughly. Vortex the mixture again for 1 min. Centrifuge at 12,000 rpm for 5 min. Aspirate the supernatant and transfer it to a new centrifuge tube.

[0053] (2) Add 1.5 times the volume of buffer LP3, vortex and mix thoroughly for 15 seconds, add the resulting solution and flocculent precipitate to adsorption column CB3, centrifuge at 12,000 r / min for 30 seconds, remove the waste liquid, place the adsorption column CB3 in a collection tube, add 600 μL of PW rinse solution, centrifuge at 12,000 r / min for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0054] (3) Repeat step (2) once. After the adsorption column CB3 is placed at room temperature to dry the residual rinse solution, it is placed in a new centrifuge tube, 100 μL of TE elution buffer is added to the middle part of the adsorption membrane, and the mixture is placed at room temperature for 5 minutes. Centrifuge at 12,000 r for 2 minutes, and the solution is collected in a centrifuge tube to obtain the genomic DNA of the sample.

[0055] 1.2.2 Development of molecular markers

[0056] Taking the Chinese cherry Luoyang ancient cherry genome as the reference genome, the whole genome resequencing data of Chinese cherry and European sweet cherry were aligned to the reference genome in BWA, and mutation detection was performed in GATK and Sentieon to obtain mutation files, from which InDel sites were extracted, and specific sites at the species level of Chinese cherry and European sweet cherry were detected through local scripts. It was found that the 35932912 site of linkage group 2 had a deletion of 18bp (5'-TGCTATTGCCAAATGAAG-3') in all European sweet cherry samples compared to Chinese cherry. Primers were designed in Primer 3 for this site, and the InDel primer Cp2_35932912 in claim 1 was obtained for subsequent experiments and analysis.

[0057] Combined with the whole genome resequencing variation detection results of the target region, the expected amplified target sequence of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAATACCTTTTCTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTGCCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 191 bp;

[0058] The results of whole genome resequencing variation detection showed that in the amplified target sequence region, in addition to the target deletion variation starting from position 113, there was also a base substitution from G to A in the European sweet cherry at position 148 of the Chinese cherry amplified sequence, that is, position 130 of the European sweet cherry amplified sequence, relative to the Chinese cherry. Therefore, the expected amplified target sequence of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173bp.

[0059] 1.2.3 PCR amplification

[0060] The present invention adopts a 20 μL InDel-PCR reaction system: 10 μL 2×Taq mix (vazyme); 1 μL DNA template; 7 μL ddH2O; 1 μL forward primer; and 1 μL reverse primer.

[0061] The PCR reaction program was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 50 s, annealing at 56°C for 1 min, extension at 72°C for 110 s, for a total of 34 cycles, and finally extension at 72°C for 8 min and 12°C forever.

[0062] 1.2.4 Polyacrylamide gel electrophoresis and silver staining

[0063] (1) Glass plate pretreatment: wipe two glass plates with anhydrous ethanol, evenly apply affinity silane on one of the glass plates, place a layering strip on both sides and the middle of the glass plate after drying, cover it with another glass plate, fix the two glass plates with clips, and seal the sides and bottom of the glass plate with 1% agarose gel.

[0064] (2) Preparation of gel: Evenly mix 50 mL of 8% polyacrylamide stock solution, 200 μL of 10% ammonium persulfate, and 20 μL of TEMED (N,N,N,N-tetramethylethylenediamine). Pour the gel into the groove of the glass plate, tilt the glass plate to remove bubbles, insert a comb, and let it stand for 2 hours to dry.

[0065] (3) Pre-electrophoresis: Place the gel glass plate in a vertical electrophoresis tank, remove the shark teeth, blow and wash with a pipette to remove impurities, insert the comb in reverse to form a spot hole, and then add 1×TBE. Pre-electrophoresis for 10 minutes at a voltage of 1000 V, a current of 50 mA, and a power of 50 W.

[0066] (4) Electrophoresis: Use a pipette to draw 1 μL of PCR product and spot it. Perform electrophoresis at a voltage of 1000 V, a current of 50 mA, and a power of 50 W for 3 h.

[0067] (5) Staining and color development: After the electrophoresis is completed, pry open the glass plate and immerse the gel plate in a 0.1% AgNO3 solution for silver staining for 10 minutes. Then use distilled water to clean the gel surface to remove the residual staining solution. After cleaning, place the polyacrylamide gel in a color development solution (1.5% NaOH, 0.25% formaldehyde) for 6 minutes for color development. When bands appear on the gel, take it out and place it in a gel imaging system to take pictures.

[0068] 1.2.5 Data Statistics and Band Analysis

[0069] Using Trans2K Plus DNA Marker (TransGen Biotech) as a reference, the size (bp) of each sample-specific target band was estimated in Quantity One software. Samples that produced a 191bp electrophoresis band were determined to be Chinese cherry, samples that produced a 173bp band were determined to be European sweet cherry, and samples with both 191bp and 173bp electrophoresis bands were determined to be hybrids of Chinese cherry and European sweet cherry. At the same time, PCR products of 4 Chinese cherry, 4 European sweet cherry, and 2 European sweet cherry × Chinese cherry hybrid offspring ('Landing 2' and 'Kao Te') were selected for Sanger sequencing (Sangong), and the sequenced nucleotide sequences were compared and analyzed with the reference genome to further test the stability and accuracy of variant detection, PCR amplification, and electrophoresis results. Since 'Landing 2' and 'Kao Te' were heterozygous at this site, five independent PCR amplifications and Sanger sequencing were performed on these two samples for the determination of base types at complex variant sites.

[0070] 2 Test results

[0071] according to Figure 1 The specific site InDel detection was performed at the whole genome level according to the process in the previous article. The deletion site of 18 bp (5'-TGCTATTGCCAAATGAAG-3') at 35932912 on linkage group 2 was selected and the primer Cp2_35932912 (shown in Table 2) was designed for PCR amplification and polyacrylamide gel electrophoresis of 100 Chinese cherry, European sweet cherry and their hybrid offspring. Figure 2It can be seen that a specific electrophoresis band of 191bp was detected in 68 intraspecific hybrids of Chinese cherry, cultivated Chinese cherry germplasm and wild Chinese cherry germplasm. A specific band of 173bp was detected in 30 cultivated European sweet cherry germplasm and wild European sweet cherry germplasm. Two specific bands of 191bp and 173bp were detected in the triploid hybrid offspring of two European sweet cherries and Chinese cherries. Among these 100 samples, the gel electrophoresis results of 46 non-resequencing samples were consistent with the results of 54 resequencing samples ( Figure 2 ), which proved the stability of the band pattern of the PCR amplification products of primer Cp2_35932912 in Chinese cherry, European sweet cherry and their hybrid progeny in polyacrylamide gel electrophoresis.

[0072] In addition, PCR products from 10 representative individuals (including 5 resequencing samples and 5 non-resequencing samples) were sequenced by Sanger sequencing ( Figure 3 , Figure 4 ). Among them, all Chinese cherry amplified sequences and all European sweet cherry PCR amplified sequences were consistent with the expected amplified sequences ( Figure 4 ). This result shows that the PCR amplification sequence of Cp2_35932912 primers in Chinese cherry and European sweet cherry samples is accurate, and the species-level identification accuracy of Cp2_35932912 primers in Chinese cherry and European sweet cherry is 100%. In addition, the hybrid offspring of two European sweet cherry × Chinese cherry are heterozygous at the InDel mutation site, which contains both the same sequence (191bp) as Chinese cherry and the same 18bp deletion mutation as European sweet cherry, indicating that Cp2_35932912 primers can also stably and accurately identify the hybrid offspring of Chinese cherry and European sweet cherry. The optimal PCR reaction program for this pair of primers is: 94℃ pre-denaturation for 4min, 94℃ denaturation for 50s, 56℃ annealing for 1min, 72℃ extension for 110s, 34 cycles, 72℃ extension for 8min, 12℃ forever.

[0073] Table 2 Sequence information of InDel marker primer Cp2_35932912

[0074]

[0075] In the present invention, the InDel marker Cp2_35932912 is specifically amplified in all the germplasms of Chinese cherry and European sweet cherry and their hybrid offspring tested, with good repeatability and high stability. The accuracy of identifying Chinese cherry and European sweet cherry germplasm at the species level is 100%, and the specific bands of the parents are detected in the hybrid offspring of the two. This shows that the InDel primer Cp2_35932912 can be used for the identification of Chinese cherry and European sweet cherry germplasm, and can also be used for the identification of their hybrid offspring. The specific embodiments described above further explain the purpose, technical scheme and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A specific primer for amplifying the InDel marker of Chinese cherry and European sweet cherry germplasm, comprising a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, and the nucleotide sequence of the reverse primer is AGGGATGTTGGTTCTGATGG.

2. An InDel marker for identifying Chinese cherry and European sweet cherry germplasm, which is obtained by amplification using the specific primers described in claim 1 and genomic DNA as a template, wherein the amplified product of Chinese cherry is 191bp, and the amplified product of European sweet cherry is 173bp.

3. The InDel marker according to claim 2, wherein the 113th to 130th positions of the amplified product of Chinese cherry are 5'-TGCTATTGCCAAATGAAG-3', and the amplified product of European sweet cherry is missing 5'-TGCTATTGCCAAATGAAG-3' from the 113th position, a total of 18 bases.

4. The InDel marker according to claim 3, wherein the sequence of the amplified product of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAA CCAACATCCCT-3', a total of 191 bp; The sequence of the amplified product of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173 bp.

5. Use of the specific primer described in claim 1 or the InDel marker described in any one of claims 2 to 4 in identifying Chinese cherry and European sweet cherry germplasm.

6. The use according to claim 5, using the specific primers according to claim 1, and amplifying the InDel marker using genomic DNA as a template; wherein the amplified product of Chinese cherry is 191 bp, the amplified product of European sweet cherry is 173 bp, and the amplified product of the hybrid of Chinese cherry and European sweet cherry has two fragments, 191 bp and 173 bp respectively, and the specific primers are: The nucleotide sequence of the forward primer is GGCTAATCCAAAATTGCCCT, The reverse primer nucleotide sequence was AGGGATGTTGGTTCTGATGG.

7. The use according to claim 6, wherein the 113th to 130th positions of the amplified product of Chinese cherry are 5'-TGCTATTGCCAAATGAAG-3', and the 113th position of the amplified product of European sweet cherry is missing 5'-TGCTATTGCCAAATGAAG-3', a total of 18 bases.

8. The use according to claim 7, wherein the sequence of the amplified product of Chinese cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTGCTATTG CCAAATGAAGTAGGTGATTCCAACATGGTGTTGGGGATGTGGTTATACTCTCCATCAGAA CCAACATCCCT-3', a total of 191 bp; The sequence of the amplified product of European sweet cherry is: 5'-GGCTAATCCAAAATTGCCCTAATTAATAAAATTAAAATCCAAGTTAAAAAATACCTTTT CTTGAAGACATTTTTGTTCTTGCAATCTTGGTCAGAGATCTCACTCATTGGGCTAGGTGA TTCCAACATGATGTTGGGGATGTGGTTATACTCTCCATCAGAACCAACATCCCT-3', a total of 173 bp.

9. The use according to claim 6, wherein the genomic DNA is derived from leaves.

Images