Reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a as well as kit and application thereof
By using RPA-CRISPR/Cas12a technology in DAdV-3 detection, combined with specific crRNA and primer combinations, the problems of long detection time, expensive equipment and complex operation in the prior art are solved, and the rapid, sensitive and highly specific DAdV-3 detection effect is achieved.
Patent Information
- Application Number
- CN202411265214.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-10
- Publication Date
- 2025-03-25
AI Technical Summary
The prior art is difficult to detect duck adenovirus type 3 (DAdV-3) quickly, portable, highly sensitive and highly specific, and has problems such as long detection time, expensive equipment, and complex operation.
The RPA-CRISPR/Cas12a-based reagent combination and kit, including specific crRNA and primer combinations, were used to detect it through recombinase polymerase amplification technology and the CRISPR/Cas12a system to achieve rapid and sensitive DAdV-3 detection.
It achieves efficient gene amplification and result interpretation within 45 minutes, with extremely high specificity and sensitivity, can accurately detect DAdV-3 on site, and tests negative for other categories of common waterfowl viruses.
Smart Images
Figure CN119685526A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial detection, and specifically relates to a reagent combination, a kit and a detection method thereof for detecting duck adenovirus type 3 RPA-CRISPR / Cas12a. Background Art
[0002] Duck adenovirus 3 (DAdV-3) is a member of the genus Adenovirus of the family Adenoviridae and is a non-enveloped double-stranded DNA virus. DAdV-3 has strong pathogenicity. Clinical lesions of infected ducks are mainly manifested as enlargement, hemorrhage and necrosis of the liver and kidneys, with an incidence of 40% to 55% and a mortality rate of 35% to 43%. At present, the virus has become one of the important pathogens that endanger the sustainable and healthy development of the duck farming industry.
[0003] Recombinase polymerase isothermal amplification (RPA) mainly relies on three enzymes: recombinase that can bind to single-stranded nucleic acids, single-stranded binding proteins, and strand-displacing DNA polymerases, simulating DNA replication in vivo, and can be performed at 37°C-42°C. Due to the mild reaction conditions, high amplification efficiency, and simple equipment of RPA, it has been widely developed and applied in the detection of pathogens such as viruses, mycoplasmas, chlamydia, bacteria, and parasites in recent years, and is suitable for grassroots and on-site detection of pathogens.
[0004] The CRISPR-Cas system is derived from the immune defense system of bacteria against viral invasion, and can cut target DNA through Cas protein. As an emerging molecular biology tool, CRISPR / Cas12a can be used for rapid constant temperature detection of pathogens. Researchers have found that Cas12a can specifically recognize and cut dsDNA targets with PAM sequences under the guidance of crRNA. After the trans-cutting activity is activated, it cuts the single-stranded DNA of non-target sequences labeled with fluorescent groups, and the results can be determined based on the generated fluorescent signals.
[0005] At present, the detection methods of DAdV-3 mainly include pathogen identification, serological tests and polymerase chain reaction (PCR) and other related technologies. Among them, pathogen identification and serological tests are time-consuming and have problems such as low sensitivity, the need for expensive instruments and difficulty in operation. Therefore, it is necessary to study a rapid, portable, highly sensitive, highly specific and easy-to-operate DAdV-3 on-site detection method. Summary of the invention
[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and to propose a CRISPR / Cas12a reagent combination, a kit and a detection method thereof for on-site detection of DAdV-3, which can detect DAdV-3 efficiently, sensitively and specifically.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] The present invention provides a crRNA for detecting duck adenovirus type 3 DAdV-3, and the sequence of the crRNA is as follows: UAAUUUCUACUAAGUGUAGAUUCUCCUUGAGGAUUAGUUCUAAC
[0009] On the other hand, the present invention provides a primer set for detecting duck adenovirus type 3 DAdV-3, and the sequence of the primer set is as follows:
[0010]
[0011] After experimental verification, the present invention finally selected a reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a, which includes a primer pair and crRNA;
[0012] The primer pairs are any one of the four primer pairs: DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R1, DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2, DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R3, and DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R4;
[0013] The nucleotide sequences of primers DAdV-3-Fibir2-RPA-F1, DAdV-3-Fibir2-RPA-R1, DAdV-3-Fibir2-RPA-R2, DAdV-3-Fibir2-RPA-F2, DAdV-3-Fibir2-RPA-R3, and DAdV-3-Fibir2-RPA-R4 are:
[0014] DAdV-3-Fibir2-RPA-F1: 5'-CACTTACAATCGACCCTGGCAAAGGACTGGA-3'; DAdV-3-Fibir2-RPA-R1: 5'-GTCTT CTGAAGTGTGTCAGATCCACTCGTAA-3'; DAdV-3-Fibir2-RPA-R2: 5'-GAAGTGTGTCAGATCCACTCGTAAAGACATA-3'; DAdV-3-Fibir2-RPA-F2: 5'-ATCGATCAATCACTCTCCGTTAGAACTAATC-3'; DAdV-3-Fibir2-RPA-R3: 5'-CACTT GGGCTTGTGTCTTCTGAAGTGTGTCA-3';DAdV-3-Fibir2-RPA-R4:5'-CCCTGCTCCCGCAGCACACTTGGGCTTGTGTC-3';
[0015] The nucleotide sequence of the crRNA is:
[0016] 5'-UAAUUUCUACUAAGUGUAGAUUCUCCUUGAGGAUUAGUUCUAAC-3'.
[0017] Preferably, the reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a includes a primer pair DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2 and crRNA.
[0018] The reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a also includes a ssDNA probe, and the nucleotide sequence of the ssDNA probe is 5'-TTATT-3'.
[0019] The two ends of the ssDNA probe are connected to a fluorescent group or biotin respectively, the fluorescent group is FAM or BHQ, and the biotin is Biotin.
[0020] The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, that is, the ssDNA probe is 5'-FAM-TTATT-BHQ-3', and the ssDNA probe is mainly used in the fluorescence method; the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin, that is, the ssDNA probe is 5'-FAM-TTATT-Biotin-3', and the ssDNA probe is mainly used in the test strip method.
[0021] An RPA-CRISPR / Cas12a detection kit for detecting duck adenovirus type 3, comprising the reagent combination.
[0022] The RPA-CRISPR / Cas12a detection kit also includes a nucleic acid amplification reagent, a crRNA transcription reagent and a Cas12a enzyme.
[0023] The RPA-CRISPR / Cas12a detection kit, the nucleic acid amplification reagent is an RPA amplification reagent.
[0024] The RPA-CRISPR / Cas12a detection kit also includes a ssDNA probe, and the nucleotide sequence of the ssDNA probe is 5'-FAM-TTATT-BHQ-3'.
[0025] The use of the RPA-CRISPR / Cas12a detection kit as described in the detection of duck adenovirus type 3 for non-diagnostic purposes.
[0026] The application comprises the following steps:
[0027] (1) extracting DNA from the sample to be tested as template DNA;
[0028] (2) adding the template DNA obtained in step (1) to the RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, including an RPA amplification reaction;
[0029] Among them, the RPA amplification system and RPA reaction conditions of the RPA amplification reaction are as follows:
[0030] RPA amplification system: add 10 μL of Rehydration Buffer, 0.5 μL of each of the upstream and downstream primers in the primer pair with a concentration of 20 μM, 1 μL of DNA template with a concentration of 100 ng / ul, and finally add 2 μL of Starter and 6 μL of ddH2O to the RPA reaction tube containing freeze-dried enzyme powder to make the total reaction system 20 μL;
[0031] RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify for 10-30 minutes at 37-42°C;
[0032] Preferably, the RPA reaction conditions are 37-40°C for 10-20 min, more preferably, the reaction temperature is 39°C and the reaction time is 20 min.
[0033] (3) Mix the crRNA, ssDNA probe and Cas12a enzyme with the RPA product obtained in step (2) to perform a Cas12a fluorescence detection reaction; wherein the Cas12a fluorescence detection reaction system is as follows:
[0034] The 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage buffer, 1 μL 50 nM crRNA, 1 μL 100 μM LbCas12a, and 0.6 μL 4 μM ssDNA probe 5`-FAM-TTATT-BHQ-3', and 10.4 μL ddH2O was added;
[0035] The reaction conditions for Cas12a fluorescence detection are: incubate at 35-40°C for 10-40 minutes, take photos under blue light for fluorescence detection, and use an enzyme reader to detect the fluorescence signal. Preferably, incubate at 37°C for 25 minutes and take photos under blue light.
[0036] Of course, the RPA product can also be used for Cas12a test strip detection reaction. At this time, the ssDNA probe is 5'-FAM-TTATT-Biotin-3', and the other components and dosages of the reaction mixture are the same as those of the fluorescence detection method;
[0037] The reaction conditions for the Cas12a test strip detection are: incubate at 35-40°C for 10-40 minutes, and the test strip detection can read the results according to the test line. Preferably, incubate at 37°C for 25 minutes. Take 2μL of the product of the Cas12a test strip detection reaction, add 78μL of diluent, mix well and drop into the sample well on the test strip, and read the test result within 5 minutes. The "line elimination method" test strip is used for detection. After crRNA recognizes the RPA product, the Cas protein is activated and cuts the reporter to release the signal. On the premise that there is a band on the quality control line, if there is no band on the test line, that is, "line elimination", it is judged to be positive; otherwise it is negative.
[0038] In the present invention, recombinase polymerase amplification (RPA) is a commonly used constant temperature amplification technology, which uses recombinase, single-stranded binding protein and DNA polymerase to rapidly amplify nucleic acids at a constant temperature of 39° C. The recombinase of the RPA system is derived from T4 bacteriophage. In some examples of the present invention, commercial RPA system nucleic acid amplification reagents can be purchased for reaction.
[0039] In the present invention, CRISPR / Cas12a, as an emerging molecular biology tool, can be applied to rapid constant temperature detection of pathogens. Researchers found that Cas12a can specifically identify and cut dsDNA targets containing PAM sequences under the guidance of crRNA, activate trans-cutting activity to cut non-target single-stranded DNA carrying fluorescent groups, and determine the results according to the generated fluorescent signals. The main features of this method are high efficiency and rapidity, simple operation, strong specificity and high sensitivity, and it is suitable for on-site detection. Using the test strip detection method, the strips of the test strip can be directly observed by the naked eye to determine the results. This method is suitable for grassroots use and does not require expensive laboratory instruments to detect.
[0040] Compared with the prior art, the advantages of the present invention are: the present invention provides an RPA-CRISPR / Cas12a detection system composed of a primer pair and crRNA, which has extremely high specificity and sensitivity, and can accurately detect DAdV-3 on site, and is negative for other types of common waterfowl viruses; the detection method of the embodiment of the present invention uses RPA-CRISPR / Cas12a technology to complete efficient gene amplification and result interpretation within 45 minutes, and the RPA-CRISPR / Cas12a detection system established with the primer pair DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2 and crRNA has a minimum detection limit of 3.0×10 0 copies / μL of DAdV-3 DNA, short time, convenient operation, high sensitivity and simple result judgment. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] Figure 1 For RPA primer screening, lanes 1, 3, 5, and 7 are the amplification products of the primer sets DAdV-3-Fibir2-RPA-F1 / R1, DAdV-3-Fibir2-RPA-F1 / R2, DAdV-3-Fibir2-RPA-F2 / R3, and DAdV-3-Fibir2-RPA-F2 / R4, respectively. Lanes 2, 4, 6, and 8 are the control groups using ddH2O as the template.
[0042] Figure 2 is the PAM site on the conserved sequence of DAdV-3. The PAM site is TTTV, and V is G, A, C.
[0043] Figure 3 The fluorescence detection results of the RPA-CRISPR / Cas12a detection system matching different primer combinations and crRNA in Experimental Examples 1-4. Figure 3 A is the fluorescence signal detection results of Experimental Examples 1-4 and the control group with ddH2O as the template; Figure 3 B is the fluorescence signal value measured by the reaction solution corresponding to Experimental Examples 1-4 and the control group with ddH2O as the template.
[0044] Figure 4 The fluorescence detection results of the RPA-CRISPR / Cas12a detection system with different concentrations of crRNA and Cas12a protein. Figure 4 A is the fluorescence signal detection results of the RPA-CRISPR / Cas12a detection system with different concentrations of crRNA and Cas12a protein; Figure 4 B is the fluorescence signal value measured in the corresponding reaction solution.
[0045] Figure 5 The results of the sensitivity screening test of the RPA-CRISPR / Cas12a fluorescence detection system are shown in Figure 2. Figure 5 A is a fluorescence photograph of the sensitivity screening test results of the RPA-CRISPR / Cas12a detection system. The template concentration was diluted to 3.0×10 8 -3.0×10 -1 The RPA reaction was performed with a concentration gradient of 10 copies / μL to detect the sensitivity; Figure 5 B is the corresponding fluorescence signal value.
[0046] Figure 6 This is the specific detection result of the RPA-CRISPR / Cas12a fluorescence detection system. Figure 6 A is a fluorescent photograph. Figure 6 B is the corresponding fluorescence signal value measured.
[0047] Figure 7 This is a graph showing the sensitivity detection results of the RPA-CRISPR / Cas12a test strip method.
[0048] Figure 8 This is a graph showing the specific detection results of the RPA-CRISPR / Cas12a test strip method.
[0049] Fig. 9 This is a graph of the detection results of the RPA-CRISPR / Cas12a test strip method and qPCR in Example 9. DETAILED DESCRIPTION
[0050] The following will clearly and completely describe the concept of the present invention and the technical effects produced in combination with the embodiments, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by technicians in this field without creative work are all within the scope of protection of the present invention. The test methods used in the embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used, unless otherwise specified, can all be reagents and materials obtained from commercial channels.
[0051] Terminology: As used herein, the terms "comprising", "including", and "containing" are used interchangeably and include not only closed definitions, but also semi-closed and open definitions. In other words, the terms include "consisting of", "consisting essentially of". The term "crRNA" refers to CRISPR RNA.
[0052] The experimental methods without specific conditions in the following examples are selected according to conventional methods and conditions in the art, or according to the product specifications. The reagents and raw materials without specific components in the following examples are all commercially available. The quantitative tests in the following examples are all set up for three repeated experiments.
[0053] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally performed under conventional conditions or under conditions recommended by the manufacturer. Unless otherwise specified, percentages and parts are calculated by weight. Primers and crRNA are synthesized by Sangon Biotech (Shanghai) Co., Ltd. Lyophilized enzyme powder and RPA amplification reagents were purchased from the RPA amplification kit of Shenzhen Yizhi Biotech Co., Ltd.
[0054] Example 1: Determination of RPA primers
[0055] 1.1 Design and synthesis of RPA primers.
[0056] The representative DAdV-3 whole genome sequences isolated from 50 different countries and regions were downloaded from NCBI, and the conserved sequence of the Fiber 2 gene of DAdV-3 was obtained as the target sequence using MegAlign software, as shown below (5'-3'):
[0057] CACTTACAATCGACCCTGGCAAAGGACTGGATATTGATATCGATCAATCACTCTCCGTTAGAACTAATCCTCAAGGAGAGAAAGAGTTAGGCATCAACATCATCCCCACATCGTGCATAACACTAGACAACGGAGGCCT CGACCTCAAGGTGGACCCAGGAAGCCTGGCCGTCACTGACAATACCCTACACCTCACAAGCTCATACTCAACCTATGTCTTTACGAGTGGATCTGACACACTTCAGAAGACACAAGCCCAAGTGTGCTGCGGAGCAGGG
[0058] Based on the above sequence, 4 pairs of RPA primers were designed and synthesized (respectively:
[0059] DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R1 (abbreviated as
[0060] DAdV-3-Fibir2-RPA-F1 / R1), DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2 (abbreviated as DAdV-3-Fibir2-RPA-F1 / R2), DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R3 (abbreviated as DAdV-3-Fibir2-RPA-F2 / R3),
[0061] DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R4 (abbreviated as
[0062] DAdV-3-Fibir2-RPA-F2 / R4)). The primer sequences are shown in Table 1.
[0063] Table 1 RPA primers for detecting DAdV-3
[0064]
[0065] 1.2 Validation of RPA primer detection for DAdV-3.
[0066] The DAdV-3 nucleic acid samples stored in this laboratory were used as templates, and negative controls were set up. RPA amplification was performed using the RPA primers listed in Table 1 above.
[0067] The RPA amplification system is as follows: add 10 μL of Rehydration Buffer, 0.5 μL of each upstream and downstream primer in the primer pair (20 μM), 1 μL of template (100 ng / ul) to the RPA reaction tube containing freeze-dried enzyme powder, and finally add 2 μL of Starter and 6 μL of ddH2O, with a total reaction system of 20 μL.
[0068] RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify at 39°C for 20 minutes.
[0069] The purified amplified product and DL 2000 DNA Marker for molecular labeling were electrophoresed in 2% agarose gel at 120V for 30min. Figure 1 As shown, the electrophoresis results showed that the four primer sets, DAdV-3-Fibir2-RPA-F1 / R1, DAdV-3-Fibir2-RPA-F1 / R2, DAdV-3-Fibir2-RPA-F2 / R3, and DAdV-3-Fibir2-RPA-F2 / R4, could successfully amplify the target fragment.
[0070] Example 2 crRNA design and RPA-CRISPR / Cas12a detection system establishment
[0071] 2.1crRNA sequence design.
[0072] The crRNA sequence was designed for the above four primer pairs and their amplified product sequences containing PAM sites (TTTV, V is G, A, C). Figure 2 The crRNA sequence is: 5'-UAAUUUCUACUAAGUGUAGAUUCUCCUUGAGGAUUAGUUCUAAC-3' (SEQ ID NO: 7).
[0073] The 5' end of the above-mentioned crRNA (UAAUUUCUACUAAGUGUAGAU) can form a hairpin structure recognized by Cas12a, followed by a 23bp linear target gene sequence, which can recognize the target gene and activate the nonspecific shearing activity of Cas12a to initiate the occurrence of subsequent reactions.
[0074] 2.2 Primer pairs are preferably matched with crRNA.
[0075] Based on the primer amplification sequence as the target, the corresponding crRNA was selected for Cas12a reaction, and the relationship between the primer pair and crRNA combination is shown in Table 2.
[0076] Table 2. Primer combinations and crRNA detection
[0077]
[0078] Table 2 lists the primer pairs and crRNA combinations used in Experimental Examples 1-4. Experimental Examples 1-4 with different combinations were subjected to RPA-CRISPR / Cas12a detection for preliminary screening and verification.
[0079] Among them, the RPA reaction system and reaction conditions are the same as in Example 1. The RPA product obtained by the RPA reaction is mixed with crRNA, ssDNA probe and Cas12a enzyme respectively, and the Cas12a fluorescence detection reaction is carried out.
[0080] The Cas12a fluorescence detection reaction system is as follows: 20 μL reaction mixture contains 5 μL RPA product, 2 μL cleavage Buffer, 1 μL 50 nM crRNA, 1 μL 100 μM LbCas12a and 0.6 μL 4 μM ssDNA probe, add 10.4 μL ddH2O, incubate at 37 ° C for 25 minutes, and take pictures under blue light.
[0081] The sequence of the ssDNA probe is 5'-FAM-TTATT-BHQ-3', and the 5' end of the ssDNA probe is labeled with 6-FAM and the 3' end is labeled with BHQ-1.
[0082] The results are as follows Figure 3 As shown in A, the combinations of Experimental Examples 1, 2, 3, and 4 can all enable the complex in the system to activate ssDNA shearing and release fluorescent signals, thereby achieving rapid visual detection of DAdV-3.
[0083] like Figure 3 As shown in Figure B, obvious fluorescence can be observed in the combinations of Experimental Examples 1, 2, 3, and 4. Among them, the fluorescence signal value measured by the detection reaction solution of Experimental Example 2 is higher than that of Experimental Examples 1, 3, and 4, indicating that the fluorescence signal of Experimental Example 2 is the strongest.
[0084] Based on the above results, it can be shown that the combination of DAdV-3-Fibir2-RPA-F1 / R2 and crRNA is the best, which can enable the complex in the system to activate ssDNA shearing, release fluorescent signals and test strip detection signals, and realize rapid visual detection of DAdV-3.
[0085] Example 4 Optimization of RPA-CRISPR / Cas12a concentration ratio
[0086] In order to achieve rapid detection of the RPA-CRISPR / Cas12a detection system, the concentrations of Cas12a and crRNA were optimized based on the above primer screening.
[0087] 1 μL (100 ng / μL) of the template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was carried out using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair. The reaction system and reaction conditions were the same as those in Example 1.
[0088] The results are as follows Figure 4 As shown, using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA detection system, the Cas protein concentration was 100nmol / L and the crRNA concentration was 50nmol / L, and a strong fluorescence signal could still be detected, proving that this concentration can be used for DAdV-3 detection.
[0089] Example 5 Sensitivity detection of RPA-CRISPR / Cas12a fluorescence detection system
[0090] Take the DAdV-3 nucleic acid sample as the template. Dilute the template solution 10 times to prepare 3.0×10 8 -3.0×10 -1 copies / μL, 10 concentration gradients.
[0091] 1 μL of template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was performed using the DAdV-3-Fibir2-RPA-F1 / R2 primer set. The reaction system and reaction conditions were the same as those in Example 1.
[0092] 5 μL RPA reaction product was added to the Cas12a fluorescence detection reaction system, and the 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage Buffer, 1 μL 50nM crRNA, 1 μL 100nM LbCas12a, 0.6 μL 4 μM single-stranded DNA (ssDNA probe) reporter probe and 10.4 μL ddH2O, incubated at 37 ° C for 25 minutes, photographed under blue light and measured the fluorescence signal value. The ssDNA probe is 5`-FAM-TTATT-BHQ-3'.
[0093] The results are as follows Figure 5 As shown in AB, the detection system was established using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA, and the initial template amount was 3.0×10 8 -3.0×10 0 The fluorescence signal can be detected at 1000 copies / μL, so the minimum detection limit of this system is 3.0×10 0 This experiment proves that the detection system of the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA of the present invention can realize high-sensitivity visual detection of DAdV-3.
[0094] Example 6 Specificity of RPA-CRISPR / Cas12a fluorescence detection system
[0095] DNA or RNA (reverse transcribed into DNA) was extracted from DAdV-3 and eight other waterfowl viruses, including Muscovy duck parvovirus (MDPV), duck circovirus (DuCV), avian adenovirus type 4 (AdV-4), duck Tembusu virus (DTMUV), egg drop syndrome virus (EDSV), duck hepatitis virus (DHV), duck astrovirus (DAstV) and duck plague virus (DPV). Each viral DNA template was diluted to 100 ng / μL and amplified and detected using the RPA-CRISPR / Cas12a detection system established with the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA. Blue light photography and fluorescence signal value measurement were performed to determine the specificity of the detection method.
[0096] like Figure 6 As shown in AB, using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA RPA-CRISPR / Cas12a detection system, only DAdV-3 showed strong fluorescence and high fluorescence signal values, and no obvious strong fluorescence and fluorescence signal values were detected for other viruses, proving that the detection method has good specificity for DAdV-3 and can distinguish DAdV-3 from other common waterfowl viruses.
[0097] Example 7 RPA-CRISPR / Cas12a test strip method sensitivity detection
[0098] The DAdV-3 nucleic acid sample was used as a template to extract DNA. The template solution was diluted 10 times to prepare 3.0×10 8 -3.0×10 -1 copies / μL, 10 concentration gradients.
[0099] 1 μL of template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was performed using the DAdV-3-Fibir2-RPA-F1 / R2 primer set. The reaction system and reaction conditions were the same as those in Example 1.
[0100] The Cas12a test strip adopts a chromatographic double antibody sandwich method, which can quickly and specifically detect the signal generated by the Cas protein cutting the reporter, and the test results are determined by observing the appearance of the band. The ssDNA probe of the Cas12a test strip detection reaction is 5'-FAM-TTATT-Biotin-3', and the other components and dosages of the reaction mixture are the same as in Example 5. The amplification products obtained above were detected using the test strips, and the specific detection method was as follows: take 2μL of the product of the Cas12a test strip detection reaction, add 78μL of diluent, mix well and drip into the sample well on the test strip, and read the test results within 5 minutes.
[0101] The results are as follows Figure 7 As shown in the figure, the test strip detection system was established using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA, and the initial template amount was 3.0×10 8 -3.0×10 -1 When the initial template amount was diluted to 3.0×10 -1 copies / μL, the detection line of the test strip did not “disappear”, so the minimum detection limit of this system was 3.0×10 0 This experiment proves that the test strip detection system of the present invention has good sensitivity and can realize high-sensitivity on-site detection of DAdV-3.
[0102] Example 8 RPA-CRISPR / Cas12a test strip method specific detection
[0103] Take DNA or RNA (reverse transcribed into DNA) of DAdV-3 and 8 other waterfowl viruses, MDPV, DuCV, AdV-4, DTMUV, EDSV, DHV, DAstV and DPV, dilute each viral DNA template to 100 ng / μL, and use the RPA-CRISPR / Cas12a test strip detection system established with DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA for amplification detection. The test results are determined by test strip detection to determine the specificity of the detection method.
[0104] like Figure 8As shown in the figure, the RPA-CRISPR / Cas12a test strip detection system using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA has bands on the quality control line of all the test strips used, indicating that the test strips are effective. On the detection line, only the DAdV-3 experimental case successfully "disappeared", and obvious bands were observed in the experimental cases of other viruses, proving that the test strip detection method has good specificity and can effectively distinguish DAdV-3 from several other common waterfowl viruses.
[0105] Example 9 RPA-CRISPR / Cas12a detection system detects DuCV clinical samples
[0106] In order to verify the reliability of the RPA-CRISPR / Cas12a test strip method established by the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA of the present invention, the RPA-CRISPR / Cas12a test strip method established by the present invention was used to detect 95 sample nucleic acids. The detection results of the RPA-CRISPR / Cas12a test strip method are shown in Fig. 9 , 48 samples were positive and 47 were negative, while the fluorescence quantitative PCR detected 48 positive and 47 negative samples. The coincidence rate between the two reached 100.00%. The comparison of CRISPR and fluorescence PCR test results is shown in Table 3.
[0107] Table 3. Comparison of the consistency of CRISPR and fluorescent PCR detection results of DAdV-3
[0108]
[0109] From the above results, it can be seen that the RPA-CRISPR / Cas12a detection system established using the DAdV-3-Fibir2-RPA-F1 / R2 primer pair and crRNA of the present invention can achieve high specificity, high sensitivity and visual detection of DAdV-3 positive samples, which is of great value for DAdV-3 disease detection and prevention and control.
[0110] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.
Claims
1. A reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a, characterized in that: It includes primer pairs and crRNA; The primer pairs are any one of the four primer pairs: DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R1, DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2, DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R3, and DAdV-3-Fibir2-RPA-F2 / DAdV-3-Fibir2-RPA-R4; The nucleotide sequences of primers DAdV-3-Fibir2-RPA-F1, DAdV-3-Fibir2-RPA-R1, DAdV-3-Fibir2-RPA-R2, DAdV-3-Fibir2-RPA-F2, DAdV-3-Fibir2-RPA-R3, and DAdV-3-Fibir2-RPA-R4 are: DAdV-3-Fibir2-RPA-F1: 5'-CACTTACAATCGACCCTGGCAAAGGACTGGA-3'; DAdV-3-Fibir2-RPA-R1: 5'-GTCTT CTGAAGTGTGTCAGATCCACTCGTAA-3'; DAdV-3-Fibir2-RPA-R2: 5'-GAAGTGTGTCAGATCCACTCGTAAAGACATA-3'; DAdV-3-Fibir2-RPA-F2: 5'-ATCGATCAATCACTCTCCGTTAGAACTAATC-3'; DAdV-3-Fibir2-RPA-R3: 5'-CACTT GGGCTTGTGTCTTCTGAAGTGTGTCA-3';DAdV-3-Fibir2-RPA-R4:5'-CCCTGCTCCCGCAGCACACTTGGGCTTGTGTC-3'; The nucleotide sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUUCUCCUUGAGGAUUAGUUCUAAC-3'.
2. The reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: It includes primer pair DAdV-3-Fibir2-RPA-F1 / DAdV-3-Fibir2-RPA-R2 and crRNA.
3. The reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a according to claim 1 or 2, characterized in that: It also includes a ssDNA probe, the nucleotide sequence of which is 5'-TTATT-3'.
4. The reagent combination for detecting duck adenovirus type 3 based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, or the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin.
5. An RPA-CRISPR / Cas12a detection kit for detecting duck adenovirus type 3, characterized in that: The invention comprises the reagent combination as claimed in claim 1.
6. The RPA-CRISPR / Cas12a detection kit according to claim 5, characterized in that: It also includes nucleic acid amplification reagents, crRNA transcription reagents and Cas12a enzymes.
7. The RPA-CRISPR / Cas12a detection kit according to claim 6, characterized in that: The nucleic acid amplification reagent is an RPA amplification reagent.
8. The RPA-CRISPR / Cas12a detection kit according to claim 5 or 6, characterized in that: It also includes a ssDNA probe, the nucleotide sequence of which is 5'-FAM-TTATT-BHQ-3'.
9. Use of the RPA-CRISPR / Cas12a detection kit as described in claim 8 in non-diagnostic detection of duck adenovirus type 3.
10. The use according to claim 9, characterized in that: The following steps are involved: (1) extracting DNA from the sample to be tested as template DNA; (2) adding the template DNA obtained in step (1) to the RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, including an RPA amplification reaction; Among them, the RPA amplification system and RPA reaction conditions of the RPA amplification reaction are as follows: RPA amplification system: add 10 μL of Rehydration Buffer, 0.5 μL of each of the upstream and downstream primers in the primer pair with a concentration of 20 μM, 1 μL of DNA template with a concentration of 100 ng / ul, and finally add 2 μL of Starter and 6 μL of ddH2O to the RPA reaction tube containing freeze-dried enzyme powder to make the total reaction system 20 μL; RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify for 10-30 minutes at 37-42°C; (3) Mix the crRNA, ssDNA probe and Cas12a enzyme with the RPA product obtained in step (2) to perform a Cas12a fluorescence detection reaction; wherein the Cas12a fluorescence detection reaction system is as follows: The 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage buffer, 1 μL 50 nM crRNA, 1 μL 100 μM LbCas12a, and 0.6 μL 4 μM ssDNA probe 5`-FAM-TTATT-BHQ-3', and 10.4 μL ddH2O was added; The reaction conditions for Cas12a fluorescence detection are: incubate at 35-40°C for 10-40 minutes, and fluorescence detection can be photographed under blue light.