Biomarker combination, kit and application thereof, and combined drug and application thereof for predicting repeated embryo implantation failure
Through the combination of biomarkers, including LCN2, fibroblast-related factors and trNK cell populations, the accurate prediction of repeated embryo transplantation failures is solved, and the lack of effective prediction and intervention methods in the prior art is improved, and the fertility health rate during the ART process is improved.
Patent Information
- Application Number
- CN202510208434.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-02-25
AI Technical Summary
At this stage, there is a lack of effective early prediction and intervention to solve the problem of repeated embryo transplantation failure, resulting in a high pregnancy failure rate for women with infertility during ART, resulting in waste of embryo and medical resources.
A biomarker combination, including lipid carrier 2 (LCN2) and fibroblast-associated factors such as FN1, COL3A1, and ZO-1, were proposed, as well as a population of trNK cells, to predict repeated embryo transplant failure. By detecting the expression amount and cell number proportion of these markers, we can accurately predict the failure of repeated embryos, and prepare kits and combination drugs for prediction to prevent or treat repeated embryos.
This biomarker combination can accurately predict repeated embryo transplant failure, help infertile women intervene as soon as possible during the ART process, improve fertility health rates, and has important scientific research and clinical transformation value.
Smart Images

Figure CN119689002B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the biological field. Specifically, the present application relates to a biomarker combination, a kit and its application, and a combined drug and its application for predicting repeated embryo implantation failure. Background Art
[0002] The ART pregnancy failure rate in infertile women is as high as 50%-60%. Among all unsuccessful pregnancies, 75% are caused by embryo implantation failure. Repeated implantation failure (RIF) is a complex disease characterized by the inability to achieve clinical pregnancy after multiple high-quality embryo transfers, accounting for about 10% of infertile patients. At present, the diagnosis and treatment of RIF in clinical practice is difficult, which has caused a huge waste of embryo resources and medical resources, and brought serious economic losses and mental stress to patients. It is a major bottleneck problem and frontier hotspot that urgently needs to be solved in the field of assisted reproduction. The etiology of RIF has been slow to progress, including embryonic factors and endometrial factors, involving genetic, endocrine, immune and other aspects of regulation. Therefore, in-depth elucidation of the pathogenesis and screening of effective potential targets for diagnosis and treatment are particularly necessary for the prediction, diagnosis and intervention of embryo implantation failure.
[0003] However, there is currently no effective target for the prediction, diagnosis and treatment of embryo implantation failure, and there is a lack of effective early prediction and intervention methods. Summary of the invention
[0004] In view of the deficiencies in the prior art, the present application proposes a biomarker combination for predicting repeated embryo implantation failure and its application, a kit for predicting repeated embryo implantation failure, a method for constructing a model for predicting repeated embryo implantation failure, a system for predicting repeated embryo implantation failure, a combined drug and its application. The biomarker combination of the present application can accurately predict repeated embryo implantation failure, and can be used to predict the risk of repeated embryo implantation failure in patients with infertile women with repeated implantation failure, which helps them to intervene as soon as possible and ensure the reproductive health of women of childbearing age. The combined drug of the present application can be used to prevent or treat the reduction of repeated embryo implantation failure, and has important scientific research and clinical transformation value for repeated embryo implantation failure.
[0005] To this end, one aspect of the present application proposes a biomarker combination for predicting repeated embryo implantation failure. According to an embodiment of the present application, the biomarker combination includes lipocalin 2 and at least one of the following: a trNK cell population and a fibroblast-associated factor, wherein the fibroblast-associated factor includes at least one of FN1, COL3A1, and ZO-1.
[0006] Endometrial factors play an important role in the process of embryo implantation. In the process of establishing endometrial receptivity, the decidualization of endometrial stromal cells involves a series of genetic reprogramming processes, which is very important for the subsequent successful embryo implantation and pregnancy support. Lipocalin 2 (LCN2) is an important adipocyte factor and innate immune molecule with high expression in endometrial tissue. LCN2 can regulate a variety of biological processes such as cell differentiation, iron ion transport, and immune defense, and has a multi-faceted effect on immune regulation. The inventors found that LCN2 levels were significantly downregulated in patients with repeated embryo implantation failure, and fibroblast-related factors were also significantly downregulated, so both can be used as markers for repeated embryo implantation failure.
[0007] The trNK cell group, i.e. decidual natural killer cells (dNK cells), is a special subgroup of natural killer cells (NK cells) that mainly exist in the uterine decidua in early pregnancy. The inventors found that when LCN2 was knocked out in both endometrial epithelial and stromal cells, the proportion of the trNK cell group in the endometrial stroma was significantly downregulated, and the differential genes of this group of cells were mainly enriched in functional items such as cell cycle, DNA replication, and positive regulation of cell proliferation, indicating that the reduction of these NK cells in a proliferative state led to impaired embryo implantation. Therefore, the proportion of the trNK cell group in the endometrial stroma can be used as a marker for repeated embryo implantation failure.
[0008] Therefore, the combination of LCN2 and fibroblast-related factors, LCN2 and trNK cell populations, and LCN2 and fibroblast-related factors and trNK cell populations as marker combinations can accurately predict repeated embryo implantation failure, and can be used to predict the risk of recurrent embryo implantation failure in infertile women with repeated implantation failure, which can help them intervene as early as possible and ensure the reproductive health of women of childbearing age.
[0009] In another aspect of the present application, the present application proposes a kit for predicting repeated embryo implantation failure. According to an embodiment of the present application, the kit includes a first reagent and at least one of the following: a second reagent and a third reagent, the first reagent is used to detect the expression of lipocalin 2, the second reagent is used to detect the number of cells in the endometrial stroma and the number of trNK cell groups in the endometrial stroma, and the third reagent is used to detect the expression of fibroblast-related factors; the fibroblast-related factors include at least one of FN1, COL3A1 and ZO-1.
[0010] In some embodiments, the first reagent and the second reagent may include Western Blot related reagents, enzyme-linked immunosorbent assay (ELISA) related reagents, immunoprecipitation related reagents, etc., and the third reagent may include flow cytometry related reagents, staining method related reagents, etc., which can be flexibly selected according to actual needs.
[0011] In another aspect of the present application, the present application proposes the use of the above-mentioned biomarker combination for predicting repeated embryo implantation failure in the preparation of a kit. According to an embodiment of the present application, the kit is used to predict repeated embryo implantation failure.
[0012] According to an embodiment of the present application, the kit includes a first reagent and at least one of the following: a second reagent and a third reagent, the first reagent is used to detect the expression of lipocalin 2 in serum, the second reagent is used to detect the total number of cells in the endometrial stroma and the number of trNK cell groups in the endometrial stroma, and the third reagent is used to detect the expression of fibroblast-related factors; the fibroblast-related factors include at least one of FN1, COL3A1 and ZO-1; the expression of lipocalin 2 in the serum of the subject is lower than the expression of lipocalin 2 in the serum of a non-embryo implantation failure subject, which is an indication of repeated embryo implantation failure of the subject; the expression of fibroblast-related factors in the serum of the subject is lower than the expression of fibroblast-related factors in the serum of a non-embryo implantation failure subject, which is an indication of repeated embryo implantation failure of the subject; the proportion of the number of trNK cell groups in the total cells of the endometrial stroma of the subject is lower than the proportion of the number of trNK cell groups in the total cells of the endometrial stroma of a non-embryo implantation failure subject, which is an indication of repeated embryo implantation failure of the subject.
[0013] In another aspect of the present application, the present application proposes the use of the aforementioned biomarker combination for predicting recurrent embryo implantation failure in constructing a model for predicting recurrent embryo implantation failure.
[0014] In another aspect of the present application, the present application proposes a method for constructing a model for predicting repeated embryo implantation failure. According to an embodiment of the present application, the method includes: (1) detecting at least one of the following 1) and 2) and 3) of the subject: 1) the total number of cells and the number of trNK cell groups in the endometrial stroma, and calculating the proportion of the number of trNK cell groups in the total cells of the endometrial stroma; 2) the expression of fibroblast-related factors in serum, wherein the fibroblast-related factors include at least one of FN1, COL3A1 and ZO-1; 3) the expression of lipocalin 2 in serum; (2) using at least one of the expression of the fibroblast-related factors and the proportion of the number of trNK cell groups in the total cells of the endometrial stroma and the expression of lipocalin 2 as feature values, and using the repeated embryo implantation failure of the subject as a marker, training and testing are performed to construct a model for predicting repeated embryo implantation failure.
[0015] In some embodiments, the model for predicting repeated embryo implantation failure adopts the following determination method:
[0016] If the expression level of lipocalin 2 in the serum of the subject is lower than that of lipocalin 2 in the serum of a subject without embryo implantation failure, the subject is determined to have repeated embryo implantation failure; if the expression level of fibroblast-related factors in the serum of the subject is lower than that of fibroblast-related factors in the serum of a subject without embryo implantation failure, the subject is determined to have repeated embryo implantation failure; if the proportion of the number of trNK cell population in the total endometrial stromal cells of the subject is lower than that of the proportion of the number of trNK cell population in the total endometrial stromal cells of a subject without embryo implantation failure, the subject is determined to have repeated embryo implantation failure.
[0017] In another aspect of the present application, the present application proposes a system for predicting repeated embryo implantation failure. According to an embodiment of the present application, the system includes: a feature acquisition module, the feature acquisition module is used to obtain the expression of lipocalin 2 in the serum of the subject and at least one of the following: the expression of fibroblast-related factors in the serum of the subject and the proportion of the number of trNK cell groups in the total endometrial stromal cells; a prediction module, the prediction module includes the prediction model obtained by the method for constructing a model for predicting repeated embryo implantation failure described above, the prediction module uses the prediction model to predict based on the features obtained by the feature acquisition module to obtain a prediction result; a prediction result output module, the prediction result output module is used to obtain the prediction result of the prediction module and output the prediction result.
[0018] In another aspect of the present application, the present application proposes the use of at least one of a fibroblast-related factor and a preparation for increasing the proportion of trNK cell population in the endometrial stroma and lipocalin 2 in the preparation of a combined drug. According to an embodiment of the present application, the combined drug is used to prevent or treat repeated embryo implantation failure; the fibroblast-related factor includes at least one of FN1, COL3A1 and ZO-1.
[0019] LCN2 promotes trNK proliferation through extracellular matrix remodeling, while endometrial trNK deficiency leads to impaired embryo implantation. LCN2 deficiency also leads to weakened tight junctions between stromal cells. The administration of LCN2 and / or fibroblast-related factors is beneficial to enhance the tight junctions between endometrial stromal cells, promote the decidualization process, improve the endometrial receptivity during the implantation window, and maintain the endometrial immune microecology by enhancing trNK cell proliferation, thereby promoting the embryo implantation process, improving the embryo implantation rate, and saving embryo implantation failure.
[0020] According to an embodiment of the present application, the combined drug is used to promote the early decidualization process of endometrial cells, promote the proliferation of endometrial trNK cells, and / or promote the formation of endometrial receptivity.
[0021] In another aspect of the present application, the present application proposes a combination drug. According to an embodiment of the present application, the combination drug includes: at least one of a fibroblast-related factor and a preparation for increasing the proportion of trNK cell groups in the endometrial stroma and lipocalin 2; the fibroblast-related factor includes at least one of FN1, COL3A1 and ZO-1. LCN2 promotes trNK proliferation through extracellular matrix remodeling, and endometrial trNK deficiency leads to impaired embryo implantation. LCN2 deficiency also leads to weakened tight junctions between stromal cells. The administration of LCN2 and / or fibroblast-related factors is beneficial to enhance the tight junctions between endometrial stromal cells, promote the decidualization process, improve the endometrial receptivity during the implantation window period, and maintain the endometrial immune microecology by enhancing trNK cell proliferation, thereby promoting the embryo implantation process and improving the embryo implantation rate.
[0022] In some embodiments, in the combination drug of the present application, each drug can be administered simultaneously or sequentially. When administered simultaneously, two or more of the drugs can be provided in the form of a pharmaceutical composition or in an independently packaged form. The specific selection can be flexibly made according to actual needs. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:
[0024] Figure 1This is a diagram of the analysis results of the endometrial tissue (16 ns. 16) public database transcriptome sequencing data (GSE106602) of patients with repeated implantation failure and female patients with infertility due to fallopian tube or male factors in Example 1 of the present invention;
[0025] Figure 2 In Example 1 of the present invention, RT-qPCR was used to evaluate the expression of LCN2 in human endometrial stromal cells;
[0026] Figure 3 The results of RNA expression of decidualization markers were determined by RT-qPCR after LCN2 was down-regulated in hESCs using shRNA in Example 1 of the present invention;
[0027] Figure 4 The ELISA technique is used in Example 1 of the present invention to analyze the serum LCN2 and FN1 protein levels in patients with repeated implantation failure and female patients in the control group with pelvic or male infertility, (A) is the serum FN1 protein level, (B) is the serum LCN2 protein level;
[0028] Figure 5 is the ROC curve for predicting the occurrence of recurrent implantation failure using serum levels of key proteins LCN2 and FN1 in Example 1 of the present invention;
[0029] Figure 6 The C57BL / 6J mouse model was used in Example 2 of the present invention to detect Lcn2 Expression pattern results during the peri-implantation period;
[0030] Figure 7 The Cre-LoxP gene recombination system was used to construct the knockout mouse model in Example 2 of the present invention to count the embryo implantation phenotypes of mice with different genotypes. (A) is determined by direct blue dye injection. Lcn2 f / f Ires cre D5 implantation defect in female mice (indicated by black arrows), (B) D5 implantation rate, (C) D5 IS number;
[0031] Figure 8 The scRNA-seq technology is used in Example 2 of the present invention to detect Lcn2 f / f Control mice and Lcn2 f / f Ires creThe results of cell type and differential gene analysis of the mouse Day 5 uterus. (A) GO analysis of differential genes in primary decidual stromal cells between the two groups of mice. (B) GO analysis of the proportion of NK_Dut cells. (C) GO analysis of highly variable genes in the NK_Dut and NK_Pclaf cell groups.
[0032] Fig. 9 is a flow cytometry analysis of the mid-luteal phase endometrium of RIF patients and control patients in Example 2 of the present invention, (A) is the CD56 + CD16 - Flow cytometric analysis of NK cells, (B) CD56 of RIF patients + CD16 - NK cell ratio, (C) is Ki67 in the control group hi Flow cytometric analysis of NK cells, (D) is Ki67 in RIF patients hi Flow cytometric analysis of NK cells, (E) is CD56 + CD16 - Proportional analysis of NK cells, (F) is Ki67 hi NK cell ratio analysis chart;
[0033] Fig.10 is the present invention Example 2 Lcn2 f / f Ires cr The results of the rescue of embryo implantation phenotype in mice after intraperitoneal injection of LCN2 recombinant protein. (A) is CD49a + EOMES + trNK cell ratio, (B) CD49a + EOMES + trNK cell number, (C) is the peak graph of flow cytometry analysis showing Ki67 hi trNK cell ratio, (D) Ki67 hi trNK cell ratio;
[0034] Fig.11 In Example 2 of the present invention, Lcn2 f / f Ires cr The results of embryo implantation phenotype rescue in mice after intraperitoneal injection of FN1 recombinant protein. (A) is CD49a + EOMES + trNK cell ratio, (B) CD49a + EOMES + trNK cell number, (C) is the peak graph of flow cytometry analysis showing Ki67hi trNK cell ratio, (D) Ki67 hi trNK cell ratio.
[0035] Fig.12 The present invention uses shRNA to knock down the HESC cell line in Example 2. LCN2 Expression of related markers and phenotypic rescue results after overexpression, (A) is the gene expression level in hESC, (B) is the electrophoresis graph, (C) is the FN1 expression level, (D) is the COL3A1 expression level, and (E) is the ZO-1 expression level. DETAILED DESCRIPTION
[0036] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used in the present application have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.
[0037] It should be noted that the specific implementation of the present invention is described in detail below in conjunction with the examples. It should be understood that the specific implementation described here is only used to illustrate and explain the present invention, and is not used to limit the present invention.
[0038] Example 1 Early prediction and diagnosis of embryo implantation failure
[0039] Published public databases were searched to obtain endometrial samples from patients with recurrent implantation failure and women with tubal or male factor infertility during the post-implantation window (control group).
[0040] The GSE106602 transcriptome sequencing data were downloaded from the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ), and the transcriptome sequencing of endometrial samples during the implantation window period after conversion was performed on 16 patients with recurrent implantation failure and 16 female patients with infertility due to fallopian tube or male factors in the control group. The differential gene expression between the groups was analyzed with the help of R language programming, and the gene expression distribution was statistically analyzed and a volcano map was made. The screening conditions (FoldChange greater than 1.5, p value less than 0.01) were set to identify differential genes. The results showed that in the endometrial tissue of the patient's implantation window period, the LCN2 level in patients with recurrent implantation failure was nearly 4 times lower than that in the control group. Figure 1 shown.
[0041] The expression of LCN2 (primer sequence F: AACCAAGGAGCTGACTTCGG (SEQ ID NO: 1) R: GGTCGATTGGGACAGGGAAG (SEQ ID NO: 2)) in human endometrial stromal cells (hESCs) was evaluated using RT-qPCR technology. 1 ml Trizol was added to the cells, and the supernatant was recovered into a 1.5 ml EP tube. Chloroform was added, mixed thoroughly, and centrifuged. The supernatant was taken and an equal volume of chloropropane was added to extract RNA. The cDNA was obtained using a PCR reverse transcription kit (TAKALA, cat no. RR047A). The PCR reaction system containing cDNA was prepared according to the protocol of the SYBR fluorescent quantitative kit (TAKALA, cat no. RR820A) and reacted in a Real-time PCR instrument. BACTIN was used as an internal reference, and PRL and IGFBP1 were used as decidualization markers. Figure 2 , after 2, 4, 6 and 8 days of induction of decidualization in HESC cells in vitro, the level of LCN2 gradually increased along with the level of decidualization.
[0042] Figure 3 In the present study, after shRNA-mediated downregulation of LCN2 in hESCs, the expression level of the decidualization marker PRL was significantly reduced, indicating that downregulation of LCN2 expression mediated the impaired decidualization of endometrial stromal cells.
[0043] Serum from 138 patients who underwent assisted reproductive treatment due to pelvic or male factors (control group) and 110 patients with recurrent implantation failure (RIF group) was collected and the corresponding ELISA kits (R&D, DLCN20; R&D, SLCN20) were used to detect the levels of LCN2 and FN1. The baseline data of the two groups of patients were comparable, as shown in Table 1. Figure 4 As shown in the figure, the serum LCN2 and FN1 levels of patients in the RIF group were significantly lower than those in the control group.
[0044] Table 1 Baseline data in Control and RIF populations
[0045]
[0046] In addition, 138 patients who underwent assisted reproductive treatment due to pelvic or male factors (control group) and 110 patients with recurrent implantation failure (RIF group) were collected to verify the sensitivity and specificity of the key molecules LCN2 and FN1 expression levels in predicting RIF diagnosis. Figure 5 As shown in the results, the two molecules have good predictive value for RIF diagnosis, and LCN2 has a better predictive effect.
[0047] The above results suggest that the detection of serum LCN2 and FN1 levels during the assisted reproductive cycle can be used for the early prediction of embryo implantation failure during the assisted reproductive cycle. Therefore, the detection of serum LCN2 and FN1 levels can be used as a feasible means of early prediction and diagnosis of embryo implantation failure.
[0048] Example 2 Early intervention for repeated implant failure
[0049] Using C57BL / 6J mouse model, we collected peri-implantation uterine tissues for RNAscope in situ hybridization experiments and found Lcn2 It is only expressed in the luminal epithelium and stromal cells near the dorsal side of the mesangium (Antimesometrialpole, AM) of the embryonic implantation chamber at the implantation site (IS), and this expression cannot be detected on Day 6 and Day 8. Figure 6 The above results suggest Lcn2 Participate in the embryo implantation process. Two conditional knockout genes in the endometrium were constructed using the Cre-LoxP gene recombination system. Lcn2 Mouse Model: Lcn2 f / f Ires cre (knockout in both endometrial epithelial and stromal cells Lcn2 )and Lcn2 f / f Ltf cre (Knockout only in endometrial epithelial cells Lcn2 ). Between 16:30 and 17:00 in the evening, male and female mice were caged at a ratio of 1:3. The next day, positive plugs were picked up and recorded as D1. The mouse uterus was sampled on D5 of pregnancy to observe the implantation of D5 embryos and record the results. The specific operation was as follows: after the mice were anesthetized by inhalation of isoflurane, 100 μl of direct blue dye was injected into the medial canthal vein. After 4 minutes, the mice were anesthetized, bled and killed by cervical dislocation. The skin and peritoneum were cut open, the mouse uterus and ovaries were completely separated, the mesentery and the fat tissue around the ovaries were cleaned, the ovaries and implantation sites in the uterus were cut off, and the implantation sites were quickly frozen and fixed.
[0050] The statistical results of D5 embryo implantation rate and implantation site (IS) are as follows Figure 7 As shown, it was found Lcn2 f / f Ires cre Embryonic implantation of female mice was significantly impaired, as manifested by a significantly reduced implantation rate, lighter IS staining (indicated by the black arrow), and a significantly increased proportion of mice with a small number of IS.
[0051] In order to explore the specific mechanism and cell-cell interactions of stromal cell LCN2 in affecting embryo implantation, Figure 8 As shown, collected Lcn2 f / f Control mice and Lcn2 f / f Ires cre Single-cell RNA sequencing (scRNA-seq) was performed on the mouse Day 5 uterus. Single-cell suspension was prepared according to the instructions of the 10×genomics single-cell kit. Single-cell capture and pre-amplification were performed on the GemCode instrument (100×genomics). The generated library was sequenced using the Illumina×10 platform, and the generated sequencing data were aligned and analyzed using the CellRanger pipeline (10×genomics). The cell gene expression matrix after quality control was analyzed using Seurat9 and DoubleFinder10, and clustering annotation was performed using UMAP. Differential gene analysis was performed on the stromal cells in the primary decidual region of scRNA-seq, and many immune-related cytokines and chemokines were found to be differentially expressed, suggesting that Lcn2 The lack of endometrial immune environment is disturbed. Differential analysis of immune cells revealed that trNK cell population Lcn2 f / f Ires cre The proportion of NK cells in the uterus of mice on Day 5 was significantly reduced. Further GO analysis found that the differentially expressed genes in this group of cells were mainly enriched in functional items such as cell cycle, DNA replication, and positive regulation of cell proliferation, indicating that the reduction of these proliferating NK cells led to impaired embryo implantation.
[0052] Mid-luteal endometrium was collected from 10 RIF patients and 4 control patients (patients undergoing assisted reproductive treatment due to pelvic or male factors) and analyzed by flow cytometry. Fig. 9 CD56 in the intima of RIF patients + CD16 - The proportion of NK cells was lower than that in the control group, and Ki67 hi NK was also lower than that of the control group, indicating that the immune disorder caused by the reduction of trNK proliferation in the mid-luteal endometrium led to embryo implantation failure. In addition, 10 RIF patients and 4 control patients were selected to verify the sensitivity and specificity of trNK cell population proportion, LCN2, and FN1 expression levels in predicting RIF diagnosis. The results showed that the combination of trNK cell population proportion + LCN2 and trNK cell population proportion + LCN2 + FN1 had good predictive value for RIF diagnosis, which can be used as a feasible means for early prediction and diagnosis of embryo implantation failure.
[0053] In the right Lcn2 f / f Ires creAfter intraperitoneal injection of LCN2 recombinant protein into mice, it was found that the embryo implantation phenotype was rescued. The uterus of mice was taken for flow cytometry analysis. The results were as follows Fig.10 As shown, mouse uterine CD49a + EOMES + The proportion and number of trNK increased, and Ki67 + The increase in the proportion of trNK cells indicated that the proliferation capacity of trNK cells in the uterine cavity was also enhanced by exogenous supplementation of LCN2 recombinant protein. Fig.11 As shown, intraperitoneal injection of FN1 recombinant protein affects the proportion and number of CD49a +EOMES + trNK in mouse uterus, Ki67 + The proportion of trNK can be salvaged.
[0054] In vitro experiments using shRNA knockdown in HESC cell lines LCN2 Decidualization was induced in vitro until day 6, and it was found that the decidualization marker PRL decreased significantly after LCN2 knockdown, and this process could be rescued by LCN2 overexpression. In addition, the expression levels of fibroblast-related factors FN1, COL3A1, and ZO-1 could also be rescued by LCN2 overexpression, such as Fig.12 The above results indicate that exogenous supplementation of LCN2 and FN1 recombinant proteins can promote the process of endometrial decidualization, maintain the homeostasis of endometrial immune microecology, and help improve embryo implantation rate.
[0055] In summary, LCN2 promotes trNK proliferation through extracellular matrix remodeling, and endometrial trNK deficiency leads to impaired embryo implantation. LCN2 deficiency also leads to weakened tight junctions between stromal cells. Overexpression of LCN2 and FN1 is beneficial to enhance the tight junctions between endometrial stromal cells, promote the decidualization process, improve the endometrial receptivity during the implantation window, and maintain the endometrial immune microecology by enhancing trNK cell proliferation, thereby promoting the embryo implantation process and improving the embryo implantation rate.
[0056] The preferred implementation modes of the present invention are described in detail above in combination with the embodiments; however, the present invention is not limited to the specific details in the above implementation modes. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical scheme of the present invention, and these simple modifications all belong to the protection scope of the present invention.
[0057] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.
[0058] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.
Claims
1. A biomarker combination for predicting recurrent embryo implantation failure, characterized in that: The biomarker combination includes lipocalin 2 and at least one of the following: a trNK cell population and a fibroblast-associated factor, wherein the fibroblast-associated factor includes at least one of FN1, COL3A1, and ZO-1.
2. A kit for predicting repeated embryo implantation failure, characterized in that: The method comprises a first reagent and at least one of the following: a second reagent and a third reagent, wherein the first reagent is used to detect the expression level of lipocalin 2, the second reagent is used to detect the number of cells in the endometrial stroma and the number of trNK cell groups in the endometrial stroma, and the third reagent is used to detect the expression level of fibroblast-related factors; the fibroblast-related factors include at least one of FN1, COL3A1 and ZO-1.
3. Use of the biomarker combination for predicting repeated embryo implantation failure according to claim 1 in preparing a kit, characterized in that: The kit is used for predicting repeated embryo implantation failure.
4. The use according to claim 3, characterized in that: The kit comprises a first reagent and at least one of the following: a second reagent and a third reagent, wherein the first reagent is used to detect the expression of lipocalin 2 in serum, the second reagent is used to detect the total number of cells in the endometrial stroma and the number of trNK cell groups in the endometrial stroma, and the third reagent is used to detect the expression of fibroblast-related factors; the fibroblast-related factors include at least one of FN1, COL3A1 and ZO-1; The expression level of lipocalin 2 in the serum of the subject is lower than the expression level of lipocalin 2 in the serum of a subject without embryo implantation failure, which is an indication of repeated embryo implantation failure of the subject; The expression level of fibroblast-related factors in the serum of the subject is lower than that in the serum of a subject without embryo implantation failure, which is an indication of repeated embryo implantation failure of the subject; The proportion of the trNK cell population in the total endometrial stromal cells of the subject is lower than that of the trNK cell population in the total endometrial stromal cells of the subject without embryo implantation failure, which is an indication of repeated embryo implantation failure of the subject.
5. Use of the biomarker combination for predicting recurrent embryo implantation failure according to claim 1 in constructing a model for predicting recurrent embryo implantation failure.
6. Use of at least one of a fibroblast-related factor and a preparation for increasing the proportion of trNK cell population in endometrial stroma and LCN2 recombinant protein in the preparation of a combined drug, characterized in that: The combined drug is used to prevent or treat repeated embryo implantation failure; The fibroblast-related factor includes at least one of FN1, COL3A1 and ZO-1.
7. The use according to claim 6, characterized in that: The combined drug is used for promoting the early decidualization process of endometrial cells, promoting the proliferation of endometrial trNK cells, and / or promoting the formation of endometrial receptivity.
8. A combined drug for preventing or treating recurrent embryo implantation failure, characterized in that: include: At least one of a fibroblast-related factor and an agent for increasing the proportion of trNK cell population in the endometrial stroma, and LCN2 recombinant protein; The fibroblast-related factor includes at least one of FN1, COL3A1 and ZO-1.
Citation Information
Patent Citations
Marker for predicting occurrence of repeated implantation failure and application thereof
CN117512096A
Marker and intervention medicine for repeated pregnancy loss early prediction and diagnosis kit
CN118326034A